Divergence of Beauvericin Synthase Gene among Fusarium and Trichoderma Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strains, Media and Growth Conditions
2.2. DNA Extraction, Molecular Identification, PCR Primers, Cycling Profiles and DNA Sequencing
2.3. Sequence Analyses and Phylogeny Reconstruction
2.4. Mycotoxin Analyses
2.4.1. Chemicals
2.4.2. Extraction, Purification and Liquid Chromatography Mass Spectrometry Analyses
3. Results and Discussion
3.1. Fungal Species Identification
3.2. Non-Ribosomal Peptide Synthase Genes Divergence
3.3. In Vitro BEA Biosynthesis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hornbogen, T.; Glinski, M.; Zocher, R. Biosynthesis of Depsipeptide Mycotoxins in Fusarium. Eur. J. Plant Pathol. 2002, 108, 713–718. [Google Scholar] [CrossRef]
- Jestoi, M. Emerging Fusarium-Mycotoxins Fusaproliferin, Beauvericin, Enniatins, and Moniliformin: A Review. Crit. Rev. Food Sci. Nutr. 2008, 48, 21–49. [Google Scholar] [CrossRef]
- Sivanathan, S.; Scherkenbeck, J. Cyclodepsipeptides: A Rich Source of Biologically Active Compounds for Drug Research. Molecules 2014, 19, 12368–12420. [Google Scholar] [CrossRef] [PubMed]
- Urbaniak, M.; Stepien, L.; Uhlig, S. Evidence for Naturally Produced Beauvericins Containing N-Methyl-Tyrosine in Hypocreales Fungi. Toxins 2019, 11, 182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nilanonta, C.; Isaka, M.; Kittakoop, P.; Trakulnaleamsai, S.; Tanticharoen, M.; Thebtaranonth, Y. Precursor-Directed Biosynthesis of Beauvericin Analogs by the Insect Pathogenic Fungus Paecilomyces tenuipes Bcc 1614. Tetrahedron 2002, 58, 3355–3360. [Google Scholar] [CrossRef]
- Isaka, M.; Yangchum, A.; Sappan, M.; Suvannakad, R.; Srikitikulchai, P. Cyclohexadepsipeptides from Acremonium Sp Bcc 28424. Tetrahedron 2011, 67, 7929–7935. [Google Scholar] [CrossRef]
- Xu, Y.; Zhan, J.; Wijeratne, E.M.K.; Burns, A.M.; Gunatilaka, A.A.L.; Molnar, I. Cytotoxic and Antihaptotactic Beauvericin Analogues from Precursor-Directed Biosynthesis with the Insect Pathogen Beauveria bassiana Atcc 7159. J. Nat. Prod. 2007, 70, 1467–1471. [Google Scholar] [CrossRef] [PubMed]
- Fukuda, T.; Arai, M.; Tomoda, H.; Omura, S. New Beauvericins, Potentiators of Antifungal Miconazole Activity, Produced by Beauveria Sp Fki-1366-Ii. Structure Elucidation. J. Antibiot. 2004, 57, 117–124. [Google Scholar] [CrossRef] [Green Version]
- Jow, G.M.; Chou, C.J.; Chen, B.F.; Tsai, J.H. Beauvericin Induces Cytotoxic Effects in Human Acute Lymphoblastic Leukemia Cells through Cytochrome C Release, Caspase 3 Activation: The Causative Role of Calcium. Cancer Lett. 2004, 216, 165–173. [Google Scholar] [CrossRef]
- Lin, H.I.; Lee, Y.J.; Chen, B.F.; Tsai, M.C.; Lu, J.L.; Chou, C.J.; Jow, G.M. Involvement of Bcl-2 Family, Cytochrome C and Caspase 3 in Induction of Apoptosis by Beauvericin in Human Non-Small Cell Lung Cancer Cells. Cancer Lett. 2005, 230, 248–259. [Google Scholar] [CrossRef]
- Xu, Y.; Orozco, R.; Wijeratne, E.M.; Gunatilaka, A.A.; Stock, S.P.; Molnar, I. Biosynthesis of the Cyclooligomer Depsipeptide Beauvericin, a Virulence Factor of the Entomopathogenic Fungus Beauveria bassiana. Chem. Biol. 2008, 15, 898–907. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, L.X.; Yan, K.Z.; Zhang, Y.; Huang, R.; Bian, J.; Zheng, C.S.; Sun, H.X.; Chen, Z.H.; Sun, N.; An, R.; et al. High-Throughput Synergy Screening Identifies Microbial Metabolites as Combination Agents for the Treatment of Fungal Infections. Proc. Natl. Acad. Sci. USA 2007, 104, 4606–4611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hilgenfeld, R.; Saenger, W. Structural Chemistry of Natural and Synthetic Ionophores and Their Complexes with Cations. Top. Curr. Chem. 1982, 101, 1–82. [Google Scholar] [CrossRef] [PubMed]
- Hamill, R.L.; Higgens, C.E.; Boaz, H.E.; Gorman, M. The Structure of Beauvericin, a New Depsipeptide Antibiotic Toxic to Artemia salina. Tetrahedron Lett. 1969, 10, 4255–4258. [Google Scholar] [CrossRef]
- Weng, Q.; Zhang, X.; Chen, W.; Hu, Q. Secondary Metabolites and the Risks of Isaria fumosorosea and Isaria farinosa. Molecules 2019, 24, 664. [Google Scholar] [CrossRef] [Green Version]
- Luangsa-Ard, J.J.; Berkaew, P.; Ridkaew, R.; Hywel-Jones, N.L.; Isaka, M. A Beauvericin Hot Spot in the Genus Isaria. Mycol. Res. 2009, 113, 1389–1395. [Google Scholar] [CrossRef]
- Galvez, L.; Urbaniak, M.; Waskiewicz, A.; Stepien, L.; Palmero, D. Fusarium proliferatum-Causal Agent of Garlic Bulb Rot in Spain: Genetic Variability and Mycotoxin Production. Food Microbiol. 2017, 67, 41–48. [Google Scholar] [CrossRef]
- Logrieco, A.; Rizzo, A.; Ferracane, R.; Ritieni, A. Occurrence of Beauvericin and Enniatins in Wheat Affected by Fusarium avenaceum Head Blight. Appl. Environ. Microbiol. 2002, 68, 82–85. [Google Scholar] [CrossRef] [Green Version]
- Jestoi, M.; Rokka, M.; Yli-Mattila, T.; Parikka, P.; Rizzo, A.; Peltonen, K. Presence and Concentrations of the Fusarium-Related Mycotoxins Beauvericin, Enniatins and Moniliformin in Finnish Grain Samples. Food Addit. Contam. 2004, 21, 794–802. [Google Scholar] [CrossRef]
- Xu, L.J.; Liu, Y.S.; Zhou, L.G.; Wu, J.Y. Enhanced Beauvericin Production with in Situ Adsorption in Mycelial Liquid Culture of Fusarium redolens Dzf2. Process. Biochem. 2009, 44, 1063–1067. [Google Scholar] [CrossRef]
- Covarelli, L.; Beccari, G.; Prodi, A.; Generotti, S.; Etruschi, F.; Meca, G.; Juan, C.; Manes, J. Biosynthesis of Beauvericin and Enniatins in Vitro by Wheat Fusarium Species and Natural Grain Contamination in an Area of Central Italy. Food Microbiol. 2015, 46, 618–626. [Google Scholar] [CrossRef] [PubMed]
- Stepien, L.; Waskiewicz, A.; Urbaniak, M. Wildly Growing Asparagus (Asparagus officinalis L.) Hosts Pathogenic Fusarium Species and Accumulates Their Mycotoxins. Microb. Ecol. 2016, 71, 927–937. [Google Scholar] [CrossRef] [Green Version]
- Mukherjee, P.K.; Buensanteai, N.; Moran-Diez, M.E.; Druzhinina, I.S.; Kenerley, C.M. Functional Analysis of Non-Ribosomal Peptide Synthetases (NRPS) in Trichoderma Virens Reveals a Polyketide Synthase (PKS)/NRPS Hybrid Enzyme Involved in the Induced Systemic Resistance Response in Maize. Microbiology 2012, 158, 155–165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peeters, H.; Zocher, R.; Kleinkauf, H. Synthesis of Beauvericin by a Multifunctional Enzyme. J. Antibiot. 1988, 41, 352–359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, T.; Zhuo, Y.; Jia, X.; Liu, J.; Gao, H.; Song, F.; Liu, M.; Zhang, L. Cloning and Characterization of the Gene Cluster Required for Beauvericin Biosynthesis in Fusarium proliferatum. Sci. China Life Sci. 2013, 56, 628–637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gallo, A.; Ferrara, M.; Perrone, G. Phylogenetic Study of Polyketide Synthases and Nonribosomal Peptide Synthetases Involved in the Biosynthesis of Mycotoxins. Toxins 2013, 5, 717–742. [Google Scholar] [CrossRef] [Green Version]
- Bushley, K.E.; Turgeon, B.G. Phylogenomics Reveals Subfamilies of Fungal Nonribosomal Peptide Synthetases and Their Evolutionary Relationships. BMC Evol. Biol. 2010, 10, 26. [Google Scholar] [CrossRef] [Green Version]
- Blaszczyk, L.; Strakowska, J.; Chelkowski, J.; Gabka-Buszek, A.; Kaczmarek, J. Trichoderma Species Occurring on Wood with Decay Symptoms in Mountain Forests in Central Europe: Genetic and Enzymatic Characterization. J. Appl. Genet. 2016, 57, 397–407. [Google Scholar] [CrossRef] [Green Version]
- Jelen, H.; Blaszczyk, L.; Chelkowski, J.; Rogowicz, K.; Strakowska, J. Formation of 6-N-Pentyl-2h-Pyran-2-One (6-PAP) and Other Volatiles by Different Trichoderma Species. Mycol. Prog. 2014, 13, 589–600. [Google Scholar] [CrossRef] [Green Version]
- Blaszczyk, L.; Popiel, D.; Chelkowski, J.; Koczyk, G.; Samuels, G.J.; Sobieralski, K.; Siwulski, M. Species Diversity of Trichoderma in Poland. J. Appl. Genet. 2011, 52, 233–243. [Google Scholar] [CrossRef] [Green Version]
- Stepien, L.; Waskiewicz, A. Sequence Divergence of the Enniatin Synthase Gene in Relation to Production of Beauvericin and Enniatins in Fusarium Species. Toxins 2013, 5, 537–555. [Google Scholar] [CrossRef] [PubMed]
- Stepien, L.; Koczyk, G.; Waskiewicz, A. Diversity of Fusarium Species and Mycotoxins Contaminating Pineapple. J. Appl. Genet. 2013, 54, 367–380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gorczyca, A.; Oleksy, A.; Gala-Czekaj, D.; Urbaniak, M.; Laskowska, M.; Waskiewicz, A.; Stepien, L. Fusarium Head Blight Incidence and Mycotoxin Accumulation in Three Durum Wheat Cultivars in Relation to Sowing Date and Density. Sci. Nat-Heidelb. 2018, 105, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tomczyk, L.; Stepien, L.; Urbaniak, M.; Szablewski, T.; Cegielska-Radziejewska, R.; Stuper-Szablewska, K. Characterisation of the Mycobiota on the Shell Surface of Table Eggs Acquired from Different Egg-Laying Hen Breeding Systems. Toxins 2018, 10, 293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kozlowska, E.; Urbaniak, M.; Hoc, N.; Grzeszczuk, J.; Dymarska, M.; Stepien, L.; Plaskowska, E.; Kostrzewa-Suslow, E.; Janeczko, T. Cascade Biotransformation of Dehydroepiandrosterone (DHEA) by Beauveria Species. Sci. Rep. 2018, 8, 13449. [Google Scholar] [CrossRef]
- Carbone, I.; Kohn, L.M. A Method for Designing Primer Sets for Speciation Studies in Filamentous Ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Samuels, G.J.; Dodd, S.L.; Gams, W.; Castlebury, L.A.; Petrini, O. Trichoderma Species Associated with the Green Mold Epidemic of Commercially Grown Agaricus bisporus. Mycologia 2002, 94, 146–170. [Google Scholar] [CrossRef]
- Thompson, J.D.; Gibson, T.J.; Higgins, D.G. Multiple Sequence Alignment Using ClustalW and ClustalX. Curr. Protoc. Bioinform. 2002, 00, 2.3.1–2.3.22. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. Mega7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Urbaniak, M.; Waskiewicz, A.; Trzebny, A.; Koczyk, G.; Stepien, L. Cyclodepsipeptide Biosynthesis in Hypocreales Fungi and Sequence Divergence of the Non-Ribosomal Peptide Synthase Genes. Pathogens 2020, 9, 552. [Google Scholar] [CrossRef]
- Leslie, J.F.; Summerell, B.A. Fusarium Laboratory Workshops-a Recent History. Mycotoxin Res. 2006, 22, 73–74. [Google Scholar] [CrossRef] [PubMed]
- Leslie, J.F.; Zeller, K.A.; Lamprecht, S.C.; Rheeder, J.P.; Marasas, W.F. Toxicity, Pathogenicity, and Genetic Differentiation of Five Species of Fusarium from Sorghum and Millet. Phytopathology 2005, 95, 275–283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Desjardins, A.E.; Maragos, C.M.; Proctor, R.H. Maize Ear Rot and Moniliformin Contamination by Cryptic Species of Fusarium subglutinans. J. Agric. Food Chem. 2006, 54, 7383–7390. [Google Scholar] [CrossRef] [PubMed]
- Arie, T. Fusarium Diseases of Cultivated Plants, Control, Diagnosis, and Molecular and Genetic Studies. J. Pestic. Sci. 2019, 44, 275–281. [Google Scholar] [CrossRef] [Green Version]
- Beccari, G.; Arellano, C.; Covarelli, L.; Tini, F.; Sulyok, M.; Cowger, C. Effect of Wheat Infection Timing on Fusarium Head Blight Causal Agents and Secondary Metabolites in Grain. Int. J. Food Microbiol. 2019, 290, 214–225. [Google Scholar] [CrossRef]
- Gordon, T.R. Fusarium oxysporum and the Fusarium Wilt Syndrome. Annu. Rev. Phytopathol. 2017, 55, 23–39. [Google Scholar] [CrossRef]
- Clements, M.J.; Kleinschmidt, C.E.; Maragos, C.M.; Pataky, J.K.; White, D.G. Evaluation of Inoculation Techniques for Fusarium Ear Rot and Fumonisin Contamination of Corn. Plant Dis. 2003, 87, 147–153. [Google Scholar] [CrossRef]
- Logrieco, A.; Moretti, A.; Perrone, G.; Mule, G. Biodiversity of Complexes of Mycotoxigenic Fungal Species Associated with Fusarium Ear Rot of Maize and Aspergillus Rot of Grape. Int. J. Food Microbiol. 2007, 119, 11–16. [Google Scholar] [CrossRef]
- Dorn, B.; Forrer, H.R.; Jenny, E.; Wettstein, F.E.; Bucheli, T.D.; Vogelgsang, S. Fusarium Species Complex and Mycotoxins in Grain Maize from Maize Hybrid Trials and from Grower’s Fields. J. Appl. Microbiol. 2011, 111, 693–706. [Google Scholar] [CrossRef]
- Vogelgsang, S.; Musa, T.; Banziger, I.; Kagi, A.; Bucheli, T.D.; Wettstein, F.E.; Pasquali, M.; Forrer, H.R. Fusarium Mycotoxins in Swiss Wheat: A Survey of Growers’ Samples between 2007 and 2014 Shows Strong Year and Minor Geographic Effects. Toxins 2017, 9, 377. [Google Scholar] [CrossRef] [Green Version]
- Jajic, I.; Dudas, T.; Krstovic, S.; Krska, R.; Sulyok, M.; Bagi, F.; Savic, Z.; Guljas, D.; Stankov, A. Emerging Fusarium Mycotoxins Fusaproliferin, Beauvericin, Enniatins, and Moniliformin in Serbian Maize. Toxins 2019, 11, 357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chilaka, C.A.; De Boevre, M.; Atanda, O.O.; De Saeger, S. Occurrence of Fusarium Mycotoxins in Cereal Crops and Processed Products (Ogi) from Nigeria. Toxins 2016, 8, 342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strakowska, J.; Blaszczyk, L.; Chelkowski, J. The Significance of Cellulolytic Enzymes Produced by Trichoderma in Opportunistic Lifestyle of This Fungus. J. Basic Microbiol. 2014, 54 (Suppl. 1), 2–13. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Jiang, L.; Bai, H.; Yong, Q.; Yu, S. Regular Enzyme Recovery Enhances Cellulase Production by Trichoderma reesei in Fed-Batch Culture. Biotechnol. Lett. 2017, 39, 1493–1498. [Google Scholar] [CrossRef] [PubMed]
- Rahman, Z.; Shida, Y.; Furukawa, T.; Suzuki, Y.; Okada, H.; Ogasawara, W.; Morikawa, Y. Evaluation and Characterization of Trichoderma reesei Cellulase and Xylanase Promoters. Appl. Microbiol. Biotechnol. 2009, 82, 899–908. [Google Scholar] [CrossRef]
- Pimentel, M.F.; Arnao, E.; Warner, A.J.; Subedi, A.; Rocha, L.F.; Srour, A.; Bond, J.P.; Fakhoury, A.M. Trichoderma Isolates Inhibit Fusarium virguliforme Growth, Reduce Root Rot, and Induce Defense-Related Genes on Soybean Seedlings. Plant Dis. 2020, 104, 1949–1959. [Google Scholar] [CrossRef]
- Blaszczyk, L.; Basinska-Barczak, A.; Cwiek-Kupczynska, H.; Gromadzka, K.; Popiel, D.; Stepien, L. Suppressive Effect of Trichoderma Spp. On Toxigenic Fusarium Species. Pol. J. Microbiol. 2017, 66, 85–100. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Sun, R.; Yu, J.; Saravanakumar, K.; Chen, J. Antagonistic and Biocontrol Potential of Trichoderma asperellum Zjsx5003 against the Maize Stalk Rot Pathogen Fusarium graminearum. Indian J. Microbiol. 2016, 56, 318–327. [Google Scholar] [CrossRef] [Green Version]
- Harman, G.E.; Howell, C.R.; Viterbo, A.; Chet, I.; Lorito, M. Trichoderma Species—Opportunistic, Avirulent Plant Symbionts. Nat. Rev. Microbiol. 2004, 2, 43–56. [Google Scholar] [CrossRef]
- Sette, L.D.; Passarini, M.R.; Delarmelina, C.; Salati, F.; Duarte, M.C.T. Molecular Characterization and Antimicrobial Activity of Endophytic Fungi from Coffee Plants. World J. Microbiol. Biotechnol. 2006, 22, 1185–1195. [Google Scholar] [CrossRef]
- Reino, J.L.; Guerrero, R.F.; Hernández-Galán, R.; Collado, I.G. Secondary Metabolites from Species of the Biocontrol Agent Trichoderma. Phytochem. Rev. 2008, 7, 89–123. [Google Scholar] [CrossRef]
- Nakari, T.; Alatalo, E.; Penttila, M.E. Isolation of Trichoderma reesei Genes Highly Expressed on Glucose-Containing Media: Characterization of the Tef1 Gene Encoding Translation Elongation Factor 1 Alpha. Gene 1993, 136, 313–318. [Google Scholar] [CrossRef]
- Kristensen, R.; Torp, M.; Kosiak, B.; Holst-Jensen, A. Phylogeny and Toxigenic Potential Is Correlated in Fusarium Species as Revealed by Partial Translation Elongation Factor 1 Alpha Gene Sequences. Mycol. Res. 2005, 109, 173–186. [Google Scholar] [CrossRef] [PubMed]
- Jurado, M.; Marin, P.; Callejas, C.; Moretti, A.; Vazquez, C.; Gonzalez-Jaen, M.T. Genetic Variability and Fumonisin Production by Fusarium proliferatum. Food Microbiol. 2010, 27, 50–57. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, K.; Ward, T.J.; Geiser, D.M.; Corby Kistler, H.; Aoki, T. Genealogical Concordance between the Mating Type Locus and Seven Other Nuclear Genes Supports Formal Recognition of Nine Phylogenetically Distinct Species within the Fusarium graminearum Clade. Fungal Genet. Biol. 2004, 41, 600–623. [Google Scholar] [CrossRef] [PubMed]
- Stepien, L. The Use of Fusarium Secondary Metabolite Biosynthetic Genes in Chemotypic and Phylogenetic Studies. Crit. Rev. Microbiol. 2014, 40, 176–185. [Google Scholar] [CrossRef] [PubMed]
- Liuzzi, V.C.; Mirabelli, V.; Cimmarusti, M.T.; Haidukowski, M.; Leslie, J.F.; Logrieco, A.F.; Caliandro, R.; Fanelli, F.; Mule, G. Enniatin and Beauvericin Biosynthesis in Fusarium Species: Production Profiles and Structural Determinant Prediction. Toxins 2017, 9, 45. [Google Scholar] [CrossRef] [Green Version]
- Kulik, T.; Pszczolkowska, A.; Fordonski, G.; Olszewski, J. Pcr Approach Based on the Esyn1 Gene for the Detection of Potential Enniatin-Producing Fusarium Species. Int. J. Food Microbiol. 2007, 116, 319–324. [Google Scholar] [CrossRef]
- Kulik, T.; Pszczolkowska, A.; Lojko, M. Multilocus Phylogenetics Show High Intraspecific Variability within Fusarium avenaceum. Int. J. Mol. Sci. 2011, 12, 5626–5640. [Google Scholar] [CrossRef] [Green Version]
- Glinski, M.; Urbanke, C.; Hornbogen, T.; Zocher, R. Enniatin Synthetase Is a Monomer with Extended Structure: Evidence for an Intramolecular Reaction Mechanism. Arch. Microbiol. 2002, 178, 267–273. [Google Scholar] [CrossRef]
- Yu, D.; Xu, F.; Zi, J.; Wang, S.; Gage, D.; Zeng, J.; Zhan, J. Engineered Production of Fungal Anticancer Cyclooligomer Depsipeptides in Saccharomyces cerevisiae. Metab. Eng. 2013, 18, 60–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Decleer, M.; Landschoot, S.; De Saeger, S.; Rajkovic, A.; Audenaert, K. Impact of Fungicides and Weather on Cyclodepsipeptide-Producing Fusarium Spp. And Beauvericin and Enniatin Levels in Wheat Grains. J. Sci. Food Agric. 2019, 99, 253–262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stepien, L.; Jestoi, M.; Chelkowski, J. Cyclic Hexadepsipeptides in Wheat Field Samples and Esyn1 Gene Divergence among Enniatin Producing Fusarium avenaceum Strains. World Mycotoxin J. 2013, 6, 399–409. [Google Scholar] [CrossRef]
- Stanciu, O.; Juan, C.; Miere, D.; Loghin, F.; Manes, J. Presence of Enniatins and Beauvericin in Romanian Wheat Samples: From Raw Material to Products for Direct Human Consumption. Toxins 2017, 9, 189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bae, H.; Sicher, R.C.; Kim, M.S.; Kim, S.H.; Strem, M.D.; Melnick, R.L.; Bailey, B.A. The Beneficial Endophyte Trichoderma hamatum Isolate Dis 219b Promotes Growth and Delays the Onset of the Drought Response in Theobroma cacao. J. Exp. Bot. 2009, 60, 3279–3295. [Google Scholar] [CrossRef]
- Hanada, R.E.; de Jorge Souza, T.; Pomella, A.W.; Hebbar, K.P.; Pereira, J.O.; Ismaiel, A.; Samuels, G.J. Trichoderma martiale Sp. Nov., a New Endophyte from Sapwood of Theobroma cacao with a Potential for Biological Control. Mycol. Res. 2008, 112, 1335–1343. [Google Scholar] [CrossRef]
- Constantin, M.E.; de Lamo, F.J.; Vlieger, B.V.; Rep, M.; Takken, F.L.W. Endophyte-Mediated Resistance in Tomato to Fusarium oxysporum Is Independent of Et, Ja, and Sa. Front. Plant Sci. 2019, 10, 979. [Google Scholar] [CrossRef] [Green Version]
- Marasas, W.F.O.; Nelson, P.E.; Toussoun, T.A.; Van Wyk, P.S. Fusarium polyphialidicum, a New Species from South Africa. Mycologia 1986, 78, 678–682. [Google Scholar] [CrossRef]
- Nel, B.; Steinberg, C.; Labuschagne, N.; Viljoen, A. Isolation and Characterization of Nonpathogenic Fusarium oxysporum Isolates from the Rhizosphere of Healthy Banana Plants. Plant Pathol. 2006, 55, 207–216. [Google Scholar] [CrossRef]
- Silva, F.A.; Liotti, R.G.; Boleti, A.P.A.; Reis, E.M.; Passos, M.B.S.; Dos Santos, E.L.; Sampaio, O.M.; Januario, A.H.; Branco, C.L.B.; Silva, G.F.D.; et al. Diversity of Cultivable Fungal Endophytes in Paullinia cupana (Mart.) Ducke and Bioactivity of Their Secondary Metabolites. PLoS ONE 2018, 13, e0195874. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.Y.; Yu, Y.; Zhang, T.Y.; Zhang, M.Y.; Zhang, Y.X. Trichoderma panacis Sp. Nov., an Endophyte Isolated from Panax notoginseng. Int. J. Syst. Evol. Microbiol. 2020, 70, 3162–3166. [Google Scholar] [CrossRef] [PubMed]
- Romao-Dumaresq, A.S.; de Araujo, W.L.; Talbot, N.J.; Thornton, C.R. RNA Interference of Endochitinases in the Sugarcane Endophyte Trichoderma virens 223 Reduces Its Fitness as a Biocontrol Agent of Pineapple Disease. PLoS ONE 2012, 7, e47888. [Google Scholar] [CrossRef] [PubMed]
- Rojo, F.; Ferez, M.; Reynoso, M.; Torres, A.; Chulze, S. Effect Of Trichoderma Species on Growth of Fusarium proliferatum and Production of Fumonisins, Fusaproliferin and Beauvericin. Mycotoxin Res. 2007, 23, 173–179. [Google Scholar] [CrossRef] [PubMed]
- Suhaida, S.; NurAinIzzati, M.Z. The Efficacy of Trichoderma harzianum T73s as a Biocontrol Agent of Fusarium Ear Rot Disease of Maize. Int. J. Agric. Biol. 2013, 15, 1175–1180. [Google Scholar]
- Xu, L.; Wang, J.; Zhao, J.; Li, P.; Shan, T.; Wang, J.; Li, X.; Zhou, L. Beauvericin from the Endophytic Fungus, Fusarium redolens, Isolated from Dioscorea zingiberensis and Its Antibacterial Activity. Nat. Prod. Commun. 2010, 5, 811–814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, L.; Marques, G. Fusarium, an Entomopathogen-A Myth or Reality? Pathogens 2018, 7, 93. [Google Scholar] [CrossRef] [Green Version]
- Zocher, R.; Keller, U.; Kleinkauf, H. Enniatin Synthetase, a Novel Type of Multifunctional Enzyme Catalyzing Depsipeptide Synthesis in Fusarium oxysporum. Biochemistry 1982, 21, 43–48. [Google Scholar] [CrossRef]
Species | Strain | Source/Host | References |
---|---|---|---|
T. atroviride | AN240 | decaying wood | [28] |
T. viride | AN255 | decaying wood | [29] |
T. koningiopsis | AN251 | decaying wood | [28] |
T. koningiopsis | AN143 | decaying wood | [30] |
T. viride | AN242 | decaying wood | [28] |
T. gamsii | AN327 | decaying wood | [28] |
T. longipile | AN359 | decaying wood | [28] |
T. viride | AN421 | decaying wood | [28] |
T. atroviride | AN528 | decaying wood | Present study |
T. paraviridescens | AN494 | decaying wood | [28] |
T. gamsii | AN550 | decaying wood | [30] |
F. proliferatum | KF3566 | Oryza sativa | [31] |
F. oxysporum | KF3386 | Ananas comosus | [32] |
F. concentricum | KF3406 | Ananas comosus | [32] |
F. polyphialidicum | KF3564 | Ananas comosus | [32] |
F. nygamai | KF337 | Cajanus indicus | [31] |
F. guttiforme | KF3327 | Ananas comosus | [32] |
Marker | 5′ > 3′ Sequence | Temperature of Annealing (°C) | Amplicon Size (bp) | Reference |
---|---|---|---|---|
Ef728M TefR1 | CATCGAGAAGTTCGAGAAGG GCCATCCTTGGAGATACCAGC | 63 | 600 | [36,37] |
BEA_F2 BEA_R2 | TGGACDTCHATGTAYGAYGG GGCTCRACRAGMARYTCYTC | 61 | 570 | Present study |
Compound | Parent Ion (m/z) [M+NH4]+ | Primary Daughter Ion (m/z) | Secondary Daughter Ion (m/z) | Collision Energy (eV) | LOD a (ng/g) | LOQ b (ng/g) |
---|---|---|---|---|---|---|
BEA | 801.2 | 784.0 | 244.1 * | 28 | 1 | 3 |
Species | Strain | Concentration of Beauvericin [µg/g] | References |
---|---|---|---|
T. atroviride | AN240 | 8.78 ± 0.92 | Present study |
T. viride | AN255 | 3.02 ± 0.41 | Present study |
T. koningiopsis | AN251 | 3.85 ± 2.77 | Present study |
T. koningiopsis | AN143 | 4.22 ± 0.39 | Present study |
T. viride | AN242 | 2.74 ± 0.35 | Present study |
T. gamsii | AN327 | ND | Present study |
T. longipile | AN359 | ND | Present study |
T. viride | AN421 | ND | Present study |
T. atroviride | AN528 | 5.54 ± 0.46 | Present study |
T. paraviridescens | AN494 | ND | Present study |
T. gamsii | AN550 | ND | Present study |
F. proliferatum | KF 3566 | 90.85 ± 10.21 | [31] |
F. oxysporum | KF 3386 | ND | [32] |
F. concentricum | KF 3406 | 0.51 ± 0.06 | [32] |
F. polyphialidicum | KF 3564 | ND | [32] |
F. nygamai | KF 337 | 22.86 ± 2.66 | [31] |
F. guttiforme | KF 3327 | 7.70 ± 1.15 | [32] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Urbaniak, M.; Waśkiewicz, A.; Koczyk, G.; Błaszczyk, L.; Stępień, Ł. Divergence of Beauvericin Synthase Gene among Fusarium and Trichoderma Species. J. Fungi 2020, 6, 288. https://doi.org/10.3390/jof6040288
Urbaniak M, Waśkiewicz A, Koczyk G, Błaszczyk L, Stępień Ł. Divergence of Beauvericin Synthase Gene among Fusarium and Trichoderma Species. Journal of Fungi. 2020; 6(4):288. https://doi.org/10.3390/jof6040288
Chicago/Turabian StyleUrbaniak, Monika, Agnieszka Waśkiewicz, Grzegorz Koczyk, Lidia Błaszczyk, and Łukasz Stępień. 2020. "Divergence of Beauvericin Synthase Gene among Fusarium and Trichoderma Species" Journal of Fungi 6, no. 4: 288. https://doi.org/10.3390/jof6040288
APA StyleUrbaniak, M., Waśkiewicz, A., Koczyk, G., Błaszczyk, L., & Stępień, Ł. (2020). Divergence of Beauvericin Synthase Gene among Fusarium and Trichoderma Species. Journal of Fungi, 6(4), 288. https://doi.org/10.3390/jof6040288