Next Article in Journal
Frequency, Timing, and Patient Factors Associated with Recurrence of Disseminated Cutaneous Coccidioidomycosis
Next Article in Special Issue
Scedosporium apiospermum: An Emerging yet Overlooked Fungal Pathogen in Veterinary Medicine—A Case-Based Review
Previous Article in Journal
Molecular Mechanisms of Temperature-Regulated Cordycepin Biosynthesis in Cordyceps militaris
Previous Article in Special Issue
First Report on Antifungal Activity of Metschnikowia pulcherrima Against Ascosphaera apis, the Causative Agent of Chalkbrood Disease in Honeybee (Apis mellifera L.) Colonies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 12
Issue 2
10.3390/jof12020119
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Metschnikowia bicuspidata in Chinese Mitten Crabs (Eriocheir sinensis) Using Recombinase Polymerase Amplification

by
Lu Liu
1,2,†,
Ye Zhao
1,2,†,
Xiaoyu Zhang
1,2,
Chengcheng Feng
1,2,
Cangshuo Liu
1,2,
Jie Bao
1,2,* and
Hongbo Jiang
1,2,3,*
1
Aquaculture Department, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Shenyang 110866, China
2
Key Laboratory of Breeding and Reproductive Cultivation of Chinese Mitten Crab, Ministry of Agriculture and Rural Affairs, Shenyang Agricultural University, Shenyang 110866, China
3
Key Laboratory of Livestock Infectious Diseases, Ministry of Education, Shenyang Agricultural University, Shenyang 110866, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Fungi 2026, 12(2), 119; https://doi.org/10.3390/jof12020119
Submission received: 6 January 2026 / Revised: 5 February 2026 / Accepted: 5 February 2026 / Published: 8 February 2026
(This article belongs to the Special Issue Fungal Diseases in Animals, 4th Edition)
Browse Figures
Versions Notes

Abstract

The fungal pathogen Metschnikowia bicuspidata causes “milky disease” in the Chinese mitten crab (Eriocheir sinensis), which poses substantial challenges to sustainable aquaculture development considering the current lack of effective treatment interventions. To address this issue, in laboratory validation, we developed two rapid recombinase polymerase amplification (RPA) detection methods for M. bicuspidata in E. sinensis targeting the histone acetyltransferase B-type subunit 2 gene (HAT-B2): an electrophoretic assay (RPA-AGE) and a colloidal gold lateral flow dipstick assay (RPA-LFD). We optimized RPA-AGE and RPA-LFD protocols for specific pathogen detection. Target detection was achieved within 35 min using RPA-AGE (30 min amplification at 37 °C followed by 5 min agarose gel electrophoresis), whereas RPA-LFD provided results in 15 min with high specificity (10 min amplification at 37 °C plus 5 min strip reading). Both methods exhibited exclusive specificity to M. bicuspidata, with no cross-reactivity with six pathogens, including Escherichia coli, Staphylococcus aureus, Aeromonas hydrophila, Candida albicans, Saccharomyces cerevisiae, and Microsporidia sp. The detection sensitivity of both platforms reached 4.8 copies/μL in laboratory validation. For field testing, the detection results from 30 field samples showed that although the 70% detection rate was lower than the 83.3% achieved by quantitative PCR, these approaches surpassed the detection rate of conventional PCR (53.3%). Notably, the RPA-LFD platform is applicable under field conditions as no specialized equipment is required. These rapid, sensitive, and specific detection systems provide practical tools for the early diagnosis and containment of M. bicuspidata infections in aquaculture settings.

1. Introduction

The Chinese mitten crab (Eriocheir sinensis), a crucial species in China’s aquaculture industry, has significant economic value attributed to its widespread cultivation and market demand. In 2024, the production of Chinese mitten crabs in China surpassed 894,000 tons, and the total value exceeded 14 billion US dollars [1]. However, the sustainable development of this sector faces growing challenges because of emerging diseases [2,3,4,5,6], particularly a devastating fungal infection termed “milky disease.” It is characterized by hemolymph noncoagulation, limb autotomy, and systemic organ failure in infected individuals and has been linked to mortality rates exceeding 20% in affected populations [7]. Previous studies have shown that a variety of pathogens, including alpha-proteobacteria [8], Vibrio alginolyticus [9], Microsporidium [10], Hematodinium sp. [11], and Metschnikowia bicuspidata [7], are capable of causing milky disease in crabs. Epidemiological studies have identified M. bicuspidata as the causative yeast pathogen that infects E. sinensis and threatens various other aquatic species owing to its broad host tropism, including Palaemonetes sinensis, Macrobrachium nipponense, Portunus trituberculatus, Macrobrachium rosenbergii, and Exopalaemon carinicauda [12,13,14,15,16,17]. Current disease management strategies remain largely ineffective, as no pharmacological interventions have demonstrated consistent therapeutic efficacy against M. bicuspidata infections [18]. M. bicuspidata can be effectively inhibited by various antifungal drugs, including ketoconazole, fluconazole, econazole, clotrimazole, amphotericin B, itraconazole, and nystatin [19]; however, these drugs are currently only used in humans and cannot yet be applied to aquatic animals because of issues including prohibitively high costs and lack of safety evaluation.
The molecular mechanisms underlying host–pathogen interactions and disease progression are poorly characterized, limiting the development of targeted control measures [20,21,22,23]. Although preventive approaches have been prioritized, their implementation is hampered by the lack of rapid diagnostic tools suitable for field deployment [24,25]. Conventional detection methods, such as histopathological analysis and culture-based identification, are time-consuming and require specialized laboratory infrastructure. The economic repercussions of this disease underscore the urgency of developing improved diagnostic solutions. Li et al. [26] utilized recombinase polymerase amplification (RPA), real-time recombinase polymerase amplification (real-time RPA), and recombinase polymerase amplification combined with lateral flow dipstick (RPA-LFD) methods improve diagnostic efficiency for Edwardsiella ictaluri disease in fish farms. Milky disease outbreaks are associated with marked reductions in edible yield and hepatopancreatic indices, which are key parameters of crab nutritional quality, and exacerbate financial losses in aquaculture operations. Furthermore, emerging evidence suggests that environmental stress factors, including improper use of pesticides and sudden changes in water quality parameters, such as salinity, pH, and dissolved oxygen, during the critical development stage exert pressure on the physiological functions of crustaceans, thus increasing their susceptibility to infection [27,28,29]. This requires the establishment of a comprehensive disease-surveillance system.
Early-stage M. bicuspidata infections in crabs present significant diagnostic challenges owing to subclinical pathogen concentrations that are below microscopic detection thresholds. Although conventional polymerase chain reaction (PCR) has been widely adopted for its operational simplicity and species-specific identification via sequencing [12], current assays exhibit critical limitations. Diagnostic specificity is compromised by cross-reactivity with phylogenetically related pathogens, whereas sensitivity constraints impede the early detection of low-titer infections. Although nested PCR protocols achieve higher sensitivity [24], their reliance on specialized equipment, multi-hour processing times, and technical expertise limits their application to laboratory settings.
Recombinase polymerase amplification has emerged as a transformative isothermal nucleic acid amplification technology characterized by rapid kinetics (10–30 min), low-temperature operation (37–42 °C), and minimal instrumentation requirements [30]. This mechanism involves recombinase-mediated primer invasion of double-stranded DNA, which initiates exponential amplification via strand displacement polymerization. Coupled with lateral flow dipstick visualization, this system enables equipment-free interpretation of results within minutes [31,32], demonstrating its suitability for field diagnostics.

2. Materials and Methods

2.1. Sample Collection

E. sinensis were sampled in the morning of May from a commercial aquaculture farm in Panjin City, Liaoning Province, China. Ninety crabs were obtained and transported to an aquaculture facility at Shenyang Agricultural University for acclimatization. Three 400 L culture tanks were prepared 24 h before use, disinfected with 0.1% potassium permanganate solution, and continuously oxygenated for 7 days. Each tank contained 30 Chinese mitten crabs. During the trial period, the crabs were fed artificial pellet feed (3–5% of body weight) twice per day, with one-third of the water volume replaced daily to maintain water quality. The feed was produced by Huainan Wangbeiyuan Agriculture and Animal Husbandry Technology Co., Ltd. (Huainan, China).
For pathogen screening, 10 crabs were randomly selected from each culture tank, anesthetized by ice immersion (5 min), and dissected under aseptic conditions. Hepatopancreatic tissues were immediately preserved in 100% ethanol and stored at −80 °C for subsequent molecular analysis.

2.2. DNA Extraction

Hepatopancreatic samples (30 mg) were aseptically collected from anesthetized crabs using alcohol- and flame-sterilized forceps. Genomic DNA was extracted using the Tiangen Marine Animal DNA Extraction Kit (Tiangen Biotech, Beijing, China) following the manufacturer’s instructions. DNA concentration and purity were quantified using a micro-spectrophotometer (K5600, Beijing Kaiao Technology Development Co., Ltd., Beijing, China), and all extracts were stored at −20 °C until further analysis.

2.3. Primer and Probe Design

Five RPA primer pairs targeting the HAT-B2 gene were designed using Premier software (version 5.0), adhering to the specifications of the DNA Constant Temperature Rapid Amplification Kit (AMP-Future (Changzhou) Biotech Co., Ltd., Changzhou, China) (basic and colloidal gold variants). After empirical validation, the optimal primer pair was selected for downstream application (Table 1). Fluorescence quantitative PCR and conventional PCR primers were designed according to established protocols, and all oligonucleotides were synthesized by Shanghai Bioengineering Co., Ltd. (Shanghai, China).

2.4. Recombinant Plasmid Standard Preparation

A 1056 bp fragment of the histone subunit 2 gene (XM_018854199.1) (Metschnikowia bicuspidata var. bicuspidata NRRL YB-4993, GenBank assembly accession: GCF_001664035.1) was amplified from M. bicuspidata-positive samples using high-fidelity PCR. The amplicon was gel-purified using a FastPure Gel DNA Extraction Mini Kit (Vazyme Biotech Co., Ltd., Nanjing, China) and cloned into the pMD19-T vector using TA cloning. The recombinant plasmid was transformed into DH5α competent cells and plated on ampicillin–LB agar plates containing X-Gal/IPTG. After 1 h of incubation at 25 °C, the plates were inverted and cultured at 37 °C for 16 h.
Single white colonies were resuspended in sterile ddH2O for colony PCR screening using M13 universal primers (Promega Corporation, Madison, WI, USA). Positive clones were inoculated into ampicillin–LB broth and incubated at 37 °C under shaking until turbidity was observed and the mycelia became visible. Plasmid DNA was extracted using the FastPure Plasmid Mini Kit, quantified via spectrophotometry, and stored at −20 °C as quantitative standards for subsequent serial dilution to determine the limit of detection assay. Formula for calculating the number of DNA copies: Number of DNA copies = Amount (ng) × 6.02 × 1023/[(Length (bp) × 1 × 109 × 660)].
To verify the cloned target gene and confirm its suitability as the diagnostic test template, the recombinant plasmids were Sanger-sequenced (Shanghai Bioengineering Co., Ltd., Shanghai, China). Sequences were aligned with the reference (XM_018854199.1), and only 100% matching plasmids were used in subsequent experiments.

2.4.1. Optimization of RPA-AGE Amplification Parameters

Amplification reactions were performed using the DNA Constant Temperature Rapid Amplification Kit (Basic Type; Changzhou Amp Future Biotechnology Co., Ltd., Changzhou, China) in a 50 μL reaction system containing 33.4 μL Reaction Buffer, 2 μL each of forward/reverse primers (10 μM), 9.1 μL dd H2O, 1 μL DNA template (100 ng), and 2.5 μL Buffer B. The positive control was a sample of an E. sinensis individual that showed obvious milky disease symptoms caused by M. bicuspidate. The negative controls contained ddH2O instead of the DNA template. Lyophilized enzyme pellets were reconstituted following the manufacturer’s instructions.
The reaction parameters were systematically optimized by testing four incubation durations (10, 20, 30, and 40 min) and five temperatures (25, 30, 37, 39, and 42 °C). After amplification, the products were purified using Tris-saturated phenol: chloroform: isoamyl alcohol (25:24:1, v/v) by centrifugation (13,400× g, 5 min). Supernatants (4 μL) were mixed with 5× Loading Buffer (1 μL) and electrophoresed on 2% agarose gels at 120 V for 30 min. Amplification efficiency was visualized by ethidium bromide staining under UV illumination.

2.4.2. Optimization of RPA-LFD Amplification Parameters

Amplification reactions were performed using a DNA Constant Temperature Amplification Kit (Colloidal Gold Lateral Flow Dipstick Type; Changzhou Amp Future Biotechnology Co., Ltd., Changzhou, China). The 50 μL reaction mixture contained 33.4 μL of Reaction Buffer, 2 μL each of forward/reverse primers (10 μM), 0.6 μL of probe (10 μM), 8.5 μL of dd H2O, 1 μL of DNA template (100 ng), and 2.5 μL of Buffer B. Positive and negative controls were used as described in Section 2.4.1
The reaction conditions were optimized by testing three incubation durations (5, 10, and 20 min) and five temperatures (25, 30, 37, 39, and 42 °C), with all procedures conducted on ice to prevent non-specific amplification. Post amplification, 10 μL of the product was diluted in 190 μL of ddH2O and applied to colloidal gold LFD strips (Changzhou Amp Future Biotechnology Co., Ltd. , Changzhou, China) according to the manufacturer’s instructions. Following thorough vortexing, 80 μL of the diluted solution was loaded into the sample well. Test line (T) and control line (C) signals were interpreted within 15 min under natural light.

2.5. RPA Specificity Testing

Genomic DNA was extracted from the hepatopancreatic tissues of M. bicuspidata-infected crabs (positive controls) and pathogen-free healthy crabs (negative controls). The specificity of the assay was evaluated by testing for cross-reactivity with six taxonomically and phylogenetically diverse microbial pathogens covering prokaryotic and eukaryotic lineages: the Gram-negative bacteria Escherichia coli and Aeromonas hydrophila, the Gram-positive bacterium Staphylococcus aureus, the phylogenetically related fungi Candida albicans and Saccharomyces cerevisiae, and Microsporidia sp. All pathogenic DNAs were obtained from authenticated cultures maintained in our laboratory.

2.6. RPA Sensitivity Assessment

Serially diluted recombinant plasmid standards (4.8 × 105 to 4.8 × 100 copies/μL) were analyzed to determine the detection limits of RPA-AGE and RPA-LFD. Sensitivity thresholds were defined as the lowest concentrations yielding visible target bands (RPA-AGE) or test line signals (RPA-LFD) under the standardized detection conditions.

2.7. Clinical Sample Validation

Thirty E. sinensis specimens from three geographically distinct aquaculture ponds were analyzed using four parallel detection methods: conventional PCR, RPA-AGE, RPA-LFD, and quantitative PCR (qPCR). PCR with the cycling parameters 95 °C for 3 min, and 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, and a final extension step at 72 °C for 5 min. qPCR assays followed the protocol of Xing et al. (2023) [25], performed on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with the cycling parameters 95 °C for 3 min, and 40 cycles of 95 °C for 15 s, and 60 °C for 30 s; melting curve analysis was subsequently performed at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The amplification efficiency E corresponding to the slope of the standard curve was 90–110%.

2.8. Sequence Alignment Analysis and Phylogenetic Tree Construction

HAT-B2 nucleic acid and amino acid sequences of Aspergillus melleus, Candida albicans, Neurospora crassa, Saccharomyces cerevisiae, Arabidopsis thaliana, and Fusarium musae, along with 16S rRNA amino acid sequences of Escherichia coli, Staphylococcus aureus, Aeromonas hydrophila, and 18S rRNA amino acid sequences of C. albicans, S. cerevisiae, Microsporidia sp., and Metschnikowia bicuspidata, were retrieved from the NCBI database.
Multiple sequence alignment was performed using the Clustal algorithm integrated in MEGA-X (version 10.2.6) software: HAT-B2 nucleic acid sequences were uniformly truncated to 1100 bp prior to alignment, while HAT-B2 amino acid sequences, 16S rRNA amino acid sequences, and 18S rRNA amino acid sequences were retained at their original lengths without modification.
The best-fit amino acid substitution models were identified via MEGA-X’s built-in Model Selection function based on the AICc criterion: LG + G for HAT-B2 amino acid sequences, and LG for 16S rRNA and 18S rRNA amino acid sequences. Phylogenetic trees were constructed using the Maximum Likelihood (ML) method in MEGA-X with parameters set as 1000 bootstrap replicates and complete deletion of gaps.

3. Results

3.1. Optimization of RPA-AGE and RPA-LFD Reaction Conditions

For RPA-AGE temperature optimization, reactions were incubated at 25, 30, 37, 39, and 42 °C for 30 min. While faint target bands were detectable at 25 °C, significantly enhanced band intensity and clarity were observed at 37, 39, and 42 °C (Figure 1A). Based on the signal-to-noise ratios, 37 °C was selected as the optimal reaction temperature. Time-course analysis at 37 °C revealed progressive amplification efficiency, with maximal band intensity achieved at 30 min (Figure 1B), establishing this duration as the standard protocol.
For RPA-LFD optimization, reactions were conducted at 30, 35, 37, and 39 °C for 10 min, which demonstrated detectable test line signals across all temperatures. However, 37 °C yielded the most pronounced colorimetric intensity (Figure 1C). Subsequent temporal analysis at 37 °C showed that 10 min reactions generated peak detection line intensity (Figure 1D), with no significant improvement observed at extended durations (15–20 min). Thus, the finalized RPA-LFD protocol used 37 °C for 10 min.

3.2. Specificity Evaluation of RPA-AGE and RPA-LFD

Both RPA platforms demonstrated exclusive specificity for M. bicuspidata detection. RPA-AGE revealed distinct target bands exclusively in M. bicuspidata-infected E. sinensis hepatopancreas samples (Figure 2A), with no cross-reactivity against the six tested pathogens. Similarly, the RPA-LFD analysis produced definitive red test line signals only in M. bicuspidata-positive samples (Figure 2B), confirming species-specific primer binding.

3.3. Sensitivity Determination of RPA Platforms

Serial dilutions of recombinant plasmid standards (4.8 × 105 to 4.8 × 100 copies/μL) established identical detection limits for both methods. RPA-AGE was used to visualize the target bands (Figure 2C), and RPA-LFD generated test line signals (Figure 2D) down to 4.8 × 100 copies/μL, with complete signal loss at lower concentrations.

3.4. Clinical Validation with Field Samples

The diagnostic performance was evaluated across 30 E. sinensis specimens from three aquaculture facilities using four parallel detection platforms (Table 2). RPA-AGE and RPA-LFD demonstrated comparable detection rates (21/30, 70.0%), significantly surpassing conventional PCR (16/30, 53.3%) and showing moderate concordance with qPCR (25/30, 83.3%). Notably, RPA-LFD achieved 100% agreement with RPA-AGE for all samples, validating its reliability for field applications.

3.5. Sequence Alignment Analysis and Phylogenetic Tree Construction

Phylogenetic analysis was performed to evaluate the sequence homology and genetic relatedness of the target gene HAT-B2 in Metschnikowia biscuspidata with homologous sequences from other species. M. bicuspidata exhibited relatively low sequence homology (<34% for HAT-B2 homologs) and distant genetic relationships with Fusarium musae, Saccharomyces cerevisiae, Neurospora crassa, Arabidopsis thaliana, Candida albicans, and Aspergillus melleus (Figure S1). This observation supports the notion that the adaptive evolution of HAT-B2 may have enhanced the target specificity of the established detection method, as the low homology with these species reduces the potential for cross-reactivity. In contrast, M. bicuspidata shares relatively closer genetic relationships with several microorganisms, including Escherichia coli, Staphylococcus aureus, Aeromonas hydrophila, C. albicans, S. cerevisiae, and Microsporidia sp. (Figure S1). This suggests that these microorganisms might pose a risk of interfering with the specific detection of M. bicuspidata, as their higher genetic relatedness could lead to non-specific binding or amplification.

4. Discussion

Current diagnostic methods for M. bicuspidata primarily rely on conventional PCR, which requires sequencing for the interpretation of results, a process that is technically demanding and time-consuming [25,33]. Although qPCR offers improved sensitivity and specificity compared to standard PCR, its dependence on specialized instrumentation and lengthy protocols limits its practical utility in field settings [34,35]. Microscopic examination of hepatopancreatic smears, although applicable for advanced infections, fails to detect early-stage pathogens [36]. Although histopathology and electron microscopy provide definitive identification, these techniques require specialized expertise and are unsuitable for rapid field diagnosis [37], thereby hindering timely disease management.
Recent advances in RPA have expanded its applications for pathogen detection in aquaculture, agriculture, and food safety, including bacterial, viral, fungal, and parasitic targets [38,39,40]. To address the specificity limitations of ribosomal DNA-targeted PCR assays, we developed two RPA detection platforms targeting the histone acetyltransferase B-type subunit 2 gene (HAT-B2): agarose gel electrophoresis (RPA-AGE) for laboratory confirmation and lateral flow dipstick (RPA-LFD) for on-site deployment. Target detection was achieved within 35 min using RPA-AGE (30 min amplification at 37 °C followed by 5 min agarose gel electrophoresis), whereas RPA-LFD provided results in 15 min with high specificity (10 min amplification at 37 °C plus 5 min strip reading). The developed method circumvents the logistical and financial burdens associated with laboratory-dependent testing, offering aquaculture operators rapid (<40 min) and accessible diagnostic solutions. By facilitating the timely identification of subclinical infections, these advancements have significant potential for improving milky disease management in E. sinensis aquaculture systems.
The HAT-B2 sequence of M. bicuspidata shows low homology with that of F. musae, S. cerevisiae and other related species, and their genetic relationship is distant; this evolutionary divergence informed our primer design strategy, targeting the HAT-B2 for M. bicuspidata identification. Histone acetyltransferases (HATs), which catalyze lysine acetylation at positions 9 and 56 of histone H3, play critical roles in fungal chromatin remodeling and transcriptional regulation [41]. These enzymes are classified into two groups based on their subcellular localization: nuclear Type A HATs mediate transcriptional histone acetylation, whereas cytoplasmic Type B HATs primarily acetylate nascent histones to regulate nucleosome assembly [42,43]. The observed low sequence conservation of Type B HATs across species [44] corroborates their functional specialization and supports the specificity of our HAT-B2-targeted detection system. Other candidate markers were excluded because of their relatively high sequence conservation in related species, which would increase the risk of cross-reactivity during detection. Therefore, the histone acetyltransferase gene is the optimal target for M. bicuspidata detection. Our findings demonstrate that the RPA assay exhibits exceptional specificity, effectively distinguishing M. bicuspidata from other bacterial, fungal, and viral pathogens. The operational simplicity of the system is noteworthy: RPA achieves target amplification at 25 °C and produces detectable results at 37 °C, a temperature that requires no specialized equipment.
The optimized RPA-LFD protocol generated reliable results within 10 min, which is ideal for field applications, whereas RPA-AGE required 30 min for optimal amplification. Compared with conventional PCR, both RPA methods significantly reduced processing time and eliminated thermal cycler dependence through isothermal operation at 37 °C, consistent with the results of Zhou et al. on RPA efficiency under similar conditions [45]. Sensitivity analyses revealed a detection limit of 4.8 copies/μL for both RPA platforms, surpassing the threshold of conventional PCR (7.60 × 102 copies/μL) [23]. Clinical validation showed 70% detection accuracy for RPA methods versus 53.3% for PCR, demonstrating superior diagnostic capability despite a slightly lower sensitivity than that of qPCR (83.3%). This performance meets the essential field-testing requirements for the early monitoring of infections. In addition, the essential objective of this approach is rapid detection, and there is still room for improvement in the sample preprocessing digestion stage and the operation process. Therefore, compared with qPCR, its sensitivity is slightly different. From the perspective of application positioning, this method is easy to operate, has a short detection cycle, and can provide protection against risks in agricultural production.
Table 2 comprehensively compares the results of PCR, qPCR, RPA-AGE, and RPA-LFD. Although PCR is suitable for standard laboratory confirmation, qPCR is optimal for quantifying subclinical infections that are undetectable by microscopy. In field scenarios requiring rapid diagnosis without quantitative data, RPA-LFD provides immediate results, particularly when microscopic screening yields negative outcomes during the initial stages of infection.
In conclusion, RPA-AGE and RPA-LFD for the detection of M. bicuspidata may work at a consistent temperature of 37 °C. RPA-LFD works in 10 min, with detection findings evaluable in 5 min, requiring no specialized equipment and exhibiting more sensitivity than conventional PCR procedures. This approach exhibits good specificity and detection efficiency in clinical samples, making it appropriate for the on-site detection of M. bicuspidata in E. sinensis farms without specialized laboratory equipment.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof12020119/s1, Figure S1: Multiple sequence comparison and Phylogenetic tree construction.

Author Contributions

L.L. and Y.Z.: Methodology, Software, Investigation, Formal Analysis, Writing—Original Draft; X.Z.: Methodology, Software, Investigation, Formal Analysis, Writing—Original Draft; C.F.: Data Curation, Writing—Original Draft; C.L.: Methodology, Software, Investigation, Formal Analysis; J.B. and H.J. (Corresponding Author): Conceptualization, Funding Acquisition, Resources, Supervision, Writing—Original Draft, Writing—Review and Editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by China Agriculture Research System of MOF and MARA (CARS-48); Liaoning Provincial Department of Agriculture and Rural Affairs Characteristic Industry Project (TSCY001); Liaoning Province Shrimp and Crab Industry Innovation Team Project (2025XXCYLNCXTDYBFK); Liaoning Provincial Science and Technology Plan Joint Program (Natural Science Foundation-Doctoral Scientific Research Initiation Project (2024-BSLH-279)); and the Joint Fund of Department of Science and Technology Project of Liaoning Province (2023-BSBA-284).

Institutional Review Board Statement

This animal study was reviewed and approved by the Animal Experiments Ethics Committee of Shenyang Agricultural University (Permit No. SYXK2025-0095).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author due to privacy limitations.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ministry of Agriculture and Rural Affairs. China Fishery Statistical Yearbook, 2025; China Agriculture Press: Beijing, China, 2025; p. 39. [Google Scholar]
  2. Ding, Z.; Yao, Y.; Zhang, F.; Wan, J.; Sun, M.; Liu, H.; Zhou, G.; Tang, J.; Pan, J.; Xue, H.; et al. The First Detection of White Spot Syndrome Virus in Naturally Infected Cultured Chinese Mitten Crabs, Eriocheir sinensis in China. J. Virol. Methods 2015, 220, 49–54. [Google Scholar] [CrossRef] [PubMed]
  3. Coates, C.J.; Rowley, A.F. Emerging Diseases and Epizootics in Crabs Under Cultivation. Front. Mar. Sci. 2022, 8, 809759. [Google Scholar] [CrossRef]
  4. Gu, Q.; Wang, Y.; Zhao, X.; Yuan, B.; Zhang, M.; Tan, Z.; Zhang, X.; Chen, Y.; Wu, H.; Luo, Y.; et al. Inhibition of Histone Acetyltransferase GCN5 by a Transcription Factor FgPacC Controls Fungal Adaption to Host-Derived Iron Stress. Nucleic Acids Res. 2022, 50, 6190–6210. [Google Scholar] [CrossRef]
  5. Ding, Z. Current Disease Threats for Cultivated Crab Eriocheir sinensis in China. Transbound. Emerg. Dis. 2023, 2023, 3305963. [Google Scholar] [CrossRef] [PubMed]
  6. Wang, Y.; Feng, C.; Xing, Y.; Hu, Q.; Li, X.; Bao, J.; Jiang, H. Morphological Transformation and Pathogenicity of Metschnikowia bicuspidata in Chinese Mitten Crab (Eriocheir sinensis). Aquaculture 2025, 597, 741921. [Google Scholar] [CrossRef]
  7. Jiang, H.; Bao, J.; Xing, Y.; Feng, C.; Li, X.; Chen, Q. Proteomic Analysis of the Hemolymph After Metschnikowia bicuspidata Infection in the Chinese Mitten Crab Eriocheir sinensis. Front. Immunol. 2021, 12, 659723. [Google Scholar] [CrossRef] [PubMed]
  8. Eddy, F.; Powell, A.; Gregory, S.; Nunan, L.M.; Lightner, D.V.; Dyson, P.J.; Rowley, A.F.; Shields, R.J. A Novel Bacterial Disease of the European Shore Crab, Carcinus maenas—Molecular Pathology and Epidemiology. Microbiology 2007, 153, 2839–2849. [Google Scholar] [CrossRef]
  9. Shi, C.; Xia, M.; Li, R.; Mu, C.; Zhang, L.; Liu, L.; Ye, Y.; Wang, C. Vibrio Alginolyticus Infection Induces Coupled Changes of Bacterial Community and Metabolic Phenotype in the Gut of Swimming Crab. Aquaculture 2019, 499, 251–259. [Google Scholar] [CrossRef]
  10. Coates, C.J.; Kraev, I.; Rowley, A.F.; Lange, S. Extracellular Vesicle Signatures and Protein Citrullination Are Modified in Shore Crabs (Carcinus maenas) Infected with Hematodinium sp. Virulence 2023, 14, 2180932. [Google Scholar] [CrossRef]
  11. Stentiford, G.D.; Bateman, K.S.; Dubuffet, A.; Chambers, E.; Stone, D.M. Hepatospora Eriocheir (Wang and Chen, 2007) Gen. et Comb. Nov. Infecting Invasive Chinese Mitten Crabs (Eriocheir sinensis) in Europe. J. Invertebr. Pathol. 2011, 108, 156–166. [Google Scholar] [CrossRef]
  12. Bao, J.; Jiang, H.; Shen, H.; Xing, Y.; Feng, C.; Li, X.; Chen, Q. First Description of Milky Disease in the Chinese Mitten Crab Eriocheir sinensis Caused by the Yeast Metschnikowia bicuspidata. Aquaculture 2021, 532, 735984. [Google Scholar] [CrossRef]
  13. Cao, G.; Bao, J.; Feng, C.; Li, X.; Lang, Y.; Xing, Y.; Jiang, H. First Report of Metschnikowia bicuspidata Infection in Chinese Grass Shrimp (Palaemonetes sinensis) in China. Transbounding Emerg. Dis 2022, 69, 3133–3141. [Google Scholar] [CrossRef]
  14. Yu, Y.; You, S.; Feng, C.; Li, X.; Xing, Y.; Hu, Q.; Bao, J.; Jiang, H. First Report of Metschnikowia bicuspidata Infection in the Oriental River Prawn (Macrobrachium nipponense, de Haan) in China. J. Fish Dis. 2024, 48, e13936. [Google Scholar] [CrossRef]
  15. Wang, X.; Chi, Z.; Yue, L.; Li, J.; Li, M.; Wu, L. A Marine Killer Yeast against the Pathogenic Yeast Strain in Crab (Portunus trituberculatus) and an Optimization of the Toxin Production. Microbiol. Res. 2007, 162, 77–85. [Google Scholar] [CrossRef]
  16. Chen, S.; Chen, Y.; Kwang, J.; Manopo, I.; Wang, P.; Chaung, H.; Liaw, L.; Chiu, S. Metschnikowia bicuspidata Dominates in Taiwanese Cold-Weather Yeast Infections of Macrobrachium rosenbergii. Dis. Aquat. Org. 2007, 75, 191–199. [Google Scholar] [CrossRef] [PubMed]
  17. Shi, W.; Zhao, R.; Hu, R.; Zhu, J.; Wan, X.; Qin, S. Proteomic Analysis of the Hepatopancreas of Exopalaemon carinicauda in Response to Metschnikowia bicuspidate Infection. Aquac. Rep. 2023, 30, 101550. [Google Scholar] [CrossRef]
  18. Zhang, H.-Q.; Chi, Z.; Liu, G.-L.; Zhang, M.; Hu, Z.; Chi, Z.-M. Metschnikowia bicuspidate Associated with a Milky Disease in Eriocheir sinensis and Its Effectitve Treatment by Massoia lactone. Microbiol. Res. 2021, 242, 126641. [Google Scholar] [CrossRef]
  19. Ma, H.; Lu, X.; Liu, J.; Guo, S.; Zhao, X.; Ye, S. Metschnikowia bicuspidata Isolated from Milky Diseased Eriocheir sinensis: Phenotypic and Genetic Characterization, Antifungal Susceptibility and Challenge Models. J. Fish Dis. 2022, 45, 41–49. [Google Scholar] [CrossRef]
  20. Zhang, J.; Li, B.; Zuo, B.; Li, X. Potential Strategies Applied by Metschnikowia bicuspidata to Survive the Immunity of Its Crustacean Hosts. Pathogens 2025, 14, 95. [Google Scholar] [CrossRef] [PubMed]
  21. Shi, X.; Sun, N.; Liu, J.; Pu, S.; Chen, Z.; Sheng, D.; Hao, K.; Li, X.; Ye, S. Dynamic Pathology and Pathogen Distribution of the Yeast Metschnikowia bicuspidata in the Chinese Mitten Crab (Eriocheir sinensis). J. Fish Dis. 2024, 47, e13993. [Google Scholar] [CrossRef] [PubMed]
  22. Hansali, K.; Zhang, Z.-R.; Liu, G.-L.; Chi, Z.; Chi, Z.-M. The Pathogenic Yeast Metschnikowia bicuspidata Var. bicuspidata in the Aquacultured Ecosystem and Its Biocontrol. J. Fungi 2023, 9, 1024. [Google Scholar] [CrossRef]
  23. Zuo, B.; Li, X.; Zhang, J.; Li, B.; Sun, N.; Liang, F. Transcriptome Analysis and CFEM Gene Overexpression in Metschnikowia bicuspidata Under Hemocyte and Iron Ion Stress. Pathogens 2025, 14, 691. [Google Scholar] [CrossRef]
  24. Bao, J.; Chen, Y.; Xing, Y.; Feng, C.; Hu, Q.; Li, X.; Jiang, H. Development of a Nested PCR Assay for Specific Detection of Metschnikowia bicuspidata Infecting Eriocheir sinensis. Front. Cell. Infect. Microbiol. 2022, 12, 930585. [Google Scholar] [CrossRef]
  25. Xing, Y.; Chen, Y.; Feng, C.; Bao, J.; Li, X.; Jiang, H. Establishment and Application of Real-Time Fluorescence Quantitative PCR Detection Technology for Metschnikowia bicuspidata Disease in Eriocheir sinensis. J. Fungi 2023, 9, 791. [Google Scholar] [CrossRef]
  26. Li, H.; Zhang, L.; Yu, Y.; Ai, T.; Zhang, Y.; Su, J. Rapid Detection of Edwardsiella ictaluri in Yellow Catfish (Pelteobagrus fulvidraco) by Real-Time RPA and RPA-LFD. Aquaculture 2022, 552, 737976. [Google Scholar] [CrossRef]
  27. Betancourt, J.L.; Rodríguez-Ramos, T.; Dixon, B. Pattern Recognition Receptors in Crustacea: Immunological Roles under Environmental Stress. Front. Immunol. 2024, 15, 1474512. [Google Scholar] [CrossRef]
  28. Shields, J.D. Climate Change Enhances Disease Processes in Crustaceans: Case Studies in Lobsters, Crabs, and Shrimps. J. Crustac. Biol. 2019, 39, 673–683. [Google Scholar] [CrossRef]
  29. Coates, C.J.; Söderhäll, K. The Stress–Immunity Axis in Shellfish. J. Invertebr. Pathol. 2021, 186, 107492. [Google Scholar] [CrossRef] [PubMed]
  30. Ling, L.; Liang, L.; Wang, H.; Lin, X.; Li, C. Real-Time Monitoring on the Chinese Giant Salamander Using RPA-LFD. Int. J. Mol. Sci. 2024, 25, 4946. [Google Scholar] [CrossRef]
  31. Lobato, I.M.; O’Sullivan, C.K. Recombinase Polymerase Amplification: Basics, Applications and Recent Advances. TrAC Trends Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef] [PubMed]
  32. Lin, L.; Luo, Q.; Li, L.; Zheng, Y.; Wei, H.; Liao, J.; Liu, Y.; Liu, M.; Wang, Z.; Lin, W.; et al. Recombinase Polymerase Amplification Combined with Pyrococcus furiosus Argonaute for Fast Salmonella spp. Testing in Food Safety. Int. J. Food Microbiol. 2024, 417, 110697. [Google Scholar] [CrossRef]
  33. Rouhi, F.; Soltani, S.; Sadeghi, S.; Nasri, E.; Hosseini, M.; Ghafel, S.; Aboutalebian, S.; Fakhim, H.; Mirhendi, H. Yeast Species in the Respiratory Samples of COVID-19 Patients; Molecular Tracking of Candida auris. Front. Cell. Infect. Microbiol. 2024, 14, 1295841. [Google Scholar] [CrossRef]
  34. Talazade, F.; Ghorbanpoor, M.; Bahadori, Y. Avian Gastric Yeast (Macrorhabdosis) in Cockatiel, Budgerigar, and Grey Parrot: A Focus on the Clinical Signs, Molecular Detection, and Phylogenetic Evaluation. Vet. Res. Forum 2023, 14, 281–287. [Google Scholar] [CrossRef]
  35. Xu, W.; Zhao, C.; Pan, X.; He, X.; Liu, X.; Hou, J.; Pang, J. Transmission Routes and a New Freshwater Crustacean Host for Infectious Precocity Virus (IPV). Transbound. Emerg. Dis. 2023, 2023, 3950107. [Google Scholar] [CrossRef] [PubMed]
  36. Govindasamy, T.; Bhassu, S.; Raju, C.S. Enterocytozoon hepatopenaei Infection in Shrimp: Diagnosis, Interventions, and Food Safety Guidelines. Microorganisms 2023, 12, 21. [Google Scholar] [CrossRef]
  37. Jillwin, J.; Rudramurthy, S.M.; Singh, S.; Bal, A.; Das, A.; Radotra, B.; Prakash, H.; Dhaliwal, M.; Kaur, H.; Ghosh, A.K.; et al. Molecular Identification of Pathogenic Fungi in Formalin-Fixed and Paraffin-Embedded Tissues. J. Med. Microbiol. 2021, 70, 001282. [Google Scholar] [CrossRef] [PubMed]
  38. Morimoto, K.; Juma, K.M.; Yamagata, M.; Takita, T.; Kojima, K.; Suzuki, K.; Yanagihara, I.; Fujiwara, S.; Yasukawa, K. Increase in the Solubility of uvsY Using a Site Saturation Mutagenesis Library for Application in a Lyophilized Reagent for Recombinase Polymerase Amplification. Mol. Biol. Rep. 2024, 51, 367. [Google Scholar] [CrossRef]
  39. Wang, R.; Li, B.; Shi, M.; Zhao, Y.; Lin, J.; Chen, Q.; Liu, P. Rapid Visual Detection of Peronophythora litchii on Lychees Using Recombinase Polymerase Amplification Combined with Lateral Flow Assay Based on the Unique Target Gene Pl_101565. Plants 2024, 13, 555. [Google Scholar] [CrossRef] [PubMed]
  40. Dong, L.; Jia, T.; Yu, Y.; Wang, Y. Updating a New Semi-Nested PCR Primer Pair for the Specific Detection of GII Norovirus in Oysters. Food Environ. Virol. 2022, 14, 149–156. [Google Scholar] [CrossRef]
  41. Ma, H.; Li, L.; Gai, Y.; Zhang, X.; Chen, Y.; Zhuo, X.; Cao, Y.; Jiao, C.; Gmitter, F.G.; Li, H. Histone Acetyltransferases and Deacetylases Are Required for Virulence, Conidiation, DNA Damage Repair, and Multiple Stresses Resistance of Alternaria alternata. Front. Microbiol. 2021, 12, 783633. [Google Scholar] [CrossRef]
  42. Kwon, J.Y.; Choi, Y.-H.; Lee, M.-W.; Yu, J.-H.; Shin, K.-S. The MYST Family Histone Acetyltransferase Sas3 Governs Diverse Biological Processes in Aspergillus fumigatus. Cells 2023, 12, 2642. [Google Scholar] [CrossRef]
  43. Tscherner, M.; Kuchler, K. A Histone Acetyltransferase Inhibitor with Antifungal Activity against CTG Clade Candida Species. Microorganisms 2019, 7, 201. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, Y.; Fan, J.; Ye, J.; Lu, L. The Fungal-specific Histone Acetyltransferase Rtt109 Regulates Development, DNA Damage Response, and Virulence in Aspergillus fumigatus. Mol. Microbiol. 2021, 115, 1191–1206. [Google Scholar] [CrossRef] [PubMed]
  45. Zhou, S.; Wang, M.; Liu, M.; Jiang, K.; Wang, B.; Wang, L. Rapid Detection of Enterocytozoon hepatozpenaei in Shrimp through an Isothermal Recombinase Polymerase Amplification Assay. Aquaculture 2020, 521, 734987. [Google Scholar] [CrossRef]
Jof 12 00119 g001
Figure 1. (A) Optimization of RPA-AGE reaction temperatures. M: DL 1000 Marker; N: negative control; rows 1–5: 25 °C, 30 °C, 37 °C, 39 °C, and 42 °C, respectively. (B) Optimization of RPA-AGE reaction times. M: DL 1000 Marker; N: negative control; 1: 10 min; 2: 20 min; 3: 30 min; 4: 40 min. (C) Optimization of RPA-LFD reaction temperature. N: negative control; 1: 30 °C; 2: 35 °C; 3: 37 °C; 4: 39 °C; (D) Optimization of RPA-LFD reaction time. N: negative control; 1: 10 min; 2: 15 min; 3: 20 min.
Figure 1. (A) Optimization of RPA-AGE reaction temperatures. M: DL 1000 Marker; N: negative control; rows 1–5: 25 °C, 30 °C, 37 °C, 39 °C, and 42 °C, respectively. (B) Optimization of RPA-AGE reaction times. M: DL 1000 Marker; N: negative control; 1: 10 min; 2: 20 min; 3: 30 min; 4: 40 min. (C) Optimization of RPA-LFD reaction temperature. N: negative control; 1: 30 °C; 2: 35 °C; 3: 37 °C; 4: 39 °C; (D) Optimization of RPA-LFD reaction time. N: negative control; 1: 10 min; 2: 15 min; 3: 20 min.
Jof 12 00119 g001
Jof 12 00119 g002
Figure 2. (A) Specificity of RPA-AGE assay. M: DL 1000 Marker; 1: Metschnikowia bicuspidata DNA; 2: Escherichia coli DNA; 3: Staphylococcus aureus DNA; 4: Aeromonas hydrophila DNA; 5: Candida albicans DNA; 6: Saccharomyces cerevisiae DNA; 7: Microsporidia spp. DNA; N: negative control. (B) Specificity of the RPA-LFD assay. (“正” is equivalent to positive: positive control; N: negative control; 1: Escherichia coli DNA; 2: Staphylococcus aureus DNA; 3: Aeromonas hydrophila DNA; 4: Candida albicans DNA; 5: Saccharomyces cerevisiae DNA; 6: Microsporidia spp. DNA; 7: Metschnikowia bicuspidata DNA); (C) Sensitivity of RPA-AGE to recombinant plasmid gradient dilution. (M: DL 1000 Marker; N: negative control; 1: 4.8 × 105 copies/μL; 2: 4.8 × 104 copies/μL; 3: 4.8 × 103 copies/μL; 4: 4.8 × 102 copies/μL; 5: 4.8 × 101 copies/μL; 6: 4.8 × 100 copies/μL); (D) Sensitivity of RPA-LFD to gradient dilution of recombinant plasmids. N: negative control; 1: 4.8 × 105 copies/μL; 2: 4.8 × 104 copies/μL; 3: 4.8 × 103 copies/μL; 4: 4.8 × 102 copies/μL; 5: 4.8 × 101 copies/μL; 6: 4.8 × 100 copies/μL.
Figure 2. (A) Specificity of RPA-AGE assay. M: DL 1000 Marker; 1: Metschnikowia bicuspidata DNA; 2: Escherichia coli DNA; 3: Staphylococcus aureus DNA; 4: Aeromonas hydrophila DNA; 5: Candida albicans DNA; 6: Saccharomyces cerevisiae DNA; 7: Microsporidia spp. DNA; N: negative control. (B) Specificity of the RPA-LFD assay. (“正” is equivalent to positive: positive control; N: negative control; 1: Escherichia coli DNA; 2: Staphylococcus aureus DNA; 3: Aeromonas hydrophila DNA; 4: Candida albicans DNA; 5: Saccharomyces cerevisiae DNA; 6: Microsporidia spp. DNA; 7: Metschnikowia bicuspidata DNA); (C) Sensitivity of RPA-AGE to recombinant plasmid gradient dilution. (M: DL 1000 Marker; N: negative control; 1: 4.8 × 105 copies/μL; 2: 4.8 × 104 copies/μL; 3: 4.8 × 103 copies/μL; 4: 4.8 × 102 copies/μL; 5: 4.8 × 101 copies/μL; 6: 4.8 × 100 copies/μL); (D) Sensitivity of RPA-LFD to gradient dilution of recombinant plasmids. N: negative control; 1: 4.8 × 105 copies/μL; 2: 4.8 × 104 copies/μL; 3: 4.8 × 103 copies/μL; 4: 4.8 × 102 copies/μL; 5: 4.8 × 101 copies/μL; 6: 4.8 × 100 copies/μL.
Jof 12 00119 g002
Table 1. Primer sequences and the corresponding product lengths for the various assays.
Table 1. Primer sequences and the corresponding product lengths for the various assays.
Assay/ReferencePrimer Sequence (5′–3′)Product Length (bp)Amplification Target on Gene
RPA-Colloidal Gold Type
(RPA-LFD).
This study		F1: ATGGAAGAAATGGCCGTTGAAACCTCGCTGGAA
R1: [biotin]-GGACGTTAGAATTCGGGTCGATTTGGGTGAAAG		292HAT-B2
RPA-LFD Probe
This study		[FAM]-ATTTCTCCGAGTTCATTCAGAGCTCTACCGC[THF]CAGCACAGTAAACCCA-[C3-spacer]
RPA-Basic (RPA-AGE)
This study		F2: ATGGAAGAAATGGCCGTTGAAACCTCGCTGGAA
R2: GGACGTTAGAATTCGGGTCGATTTGGGTGAAAG		292HAT-B2
qPCR and PCRF4: ATTCAACTCGCACGGTCAC
R4: TCCACAACTCGGTGATGC		140COX6A
RPA-plasmid-based researchF3: GCCGCAAAGAAAATTCCAACC
R3: CATCCTGCATTAGCC		1005pMD19T-HAT-B2
Table 2. Results of PCR, RPA-AGE, RPA-LFD, and qPCR assays.
Table 2. Results of PCR, RPA-AGE, RPA-LFD, and qPCR assays.
SampleTesting TechnologyCopies/μL
PCRRPA-AGERPA-LFDqPCR
S1++++2.8 × 102
S2++++3.6 × 102
S3−−−−-
S4−−−−-
S5++++2.0 × 102
S6++++1.1 × 102
S7++++3.4 × 101
S8−+++2.2 × 102
S9++++1.6 × 105
S10−−−+3.5 × 102
S11−−−+1.7 × 101
S12−−−+1.5 × 103
S13++++2.3 × 103
S14++++1.9 × 102
S15++++1.4 × 103
S16−+++5.5 × 104
S17++++1.2 × 102
S18−+++1.0 × 102
S19++++1.6 × 105
S20++++8.3 × 101
S21−−−−-
S22++++1.5 × 102
S23−−−−-
S24++++7.6 × 101
S25++++2.0 × 102
S26−+++8.7 × 103
S27−−−−-
S28−−−+8.4 × 103
S29−+++5.0 × 104
S30++++6.2 × 103
positivity rate (%)53.3707083.3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, L.; Zhao, Y.; Zhang, X.; Feng, C.; Liu, C.; Bao, J.; Jiang, H. Detection of Metschnikowia bicuspidata in Chinese Mitten Crabs (Eriocheir sinensis) Using Recombinase Polymerase Amplification. J. Fungi 2026, 12, 119. https://doi.org/10.3390/jof12020119

AMA Style

Liu L, Zhao Y, Zhang X, Feng C, Liu C, Bao J, Jiang H. Detection of Metschnikowia bicuspidata in Chinese Mitten Crabs (Eriocheir sinensis) Using Recombinase Polymerase Amplification. Journal of Fungi. 2026; 12(2):119. https://doi.org/10.3390/jof12020119

Chicago/Turabian Style

Liu, Lu, Ye Zhao, Xiaoyu Zhang, Chengcheng Feng, Cangshuo Liu, Jie Bao, and Hongbo Jiang. 2026. "Detection of Metschnikowia bicuspidata in Chinese Mitten Crabs (Eriocheir sinensis) Using Recombinase Polymerase Amplification" Journal of Fungi 12, no. 2: 119. https://doi.org/10.3390/jof12020119

APA Style

Liu, L., Zhao, Y., Zhang, X., Feng, C., Liu, C., Bao, J., & Jiang, H. (2026). Detection of Metschnikowia bicuspidata in Chinese Mitten Crabs (Eriocheir sinensis) Using Recombinase Polymerase Amplification. Journal of Fungi, 12(2), 119. https://doi.org/10.3390/jof12020119

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop