Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients and Specimen Collection
2.2. Preliminary Identification and Growth Media
2.3. DNA Extraction and Molecular Identification (Internal Transcribed Spacer Region (ITS) Sequencing)
2.4. Phospholipase Activity
2.5. Esterase Activity
2.6. Antifungal Susceptibility Testing
2.7. Microsatellite Length Polymorphism Genotyping (Short Tandem Repeat Analysis)
2.8. Data Analysis
3. Results
3.1. Sequence Analysis of ITS Genes
3.2. Phospholipase and Esterase Activity
3.3. Antifungal Susceptibility Testing Profiles (Patterns)
3.4. Microsatellite Length Polymorphism Genotyping
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rodrigues, M.L.; Albuquerque, P.C. Searching for a Change: The Need for Increased Support for Public Health and Research on Fungal Diseases. PLoS Negl. Trop. Dis. 2018, 12, e0006479. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.D.; Denning, D.W.; Gow, N.A.R.; Levitz, S.M.; Netea, M.G.; White, T.C. Hidden Killers: Human Fungal Infections. Sci. Transl. Med. 2012, 4, 165rv13. [Google Scholar] [CrossRef] [PubMed]
- Mba, I.E.; Nweze, E.I. Mechanism of Candida Pathogenesis: Revisiting the Vital Drivers. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 1797–1819. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention (U.S.). Antibiotic Resistance Threats in the United States, 2019; Centers for Disease Control and Prevention (U.S.): Atlanta, GA, USA, 2019. [Google Scholar]
- WHO. Fungal Priority Pathogens List to Guide Research, Development and Public Health Action, 1st ed.; World Health Organization: Geneva, Switzerland, 2022; ISBN 978-92-4-006024-1. [Google Scholar]
- Jackson, B.R.; Chow, N.; Forsberg, K.; Litvintseva, A.P.; Lockhart, S.R.; Welsh, R.; Vallabhaneni, S.; Chiller, T. On the Origins of a Species: What Might Explain the Rise of Candida Auris? J. Fungi 2019, 5, 58. [Google Scholar] [CrossRef] [PubMed]
- Du, H.; Bing, J.; Hu, T.; Ennis, C.L.; Nobile, C.J.; Huang, G. Candida Auris: Epidemiology, Biology, Antifungal Resistance, and Virulence. PLOS Pathog. 2020, 16, e1008921. [Google Scholar] [CrossRef] [PubMed]
- Chow, N.A.; Muñoz, J.F.; Gade, L.; Berkow, E.L.; Li, X.; Welsh, R.M.; Forsberg, K.; Lockhart, S.R.; Adam, R.; Alanio, A.; et al. Tracing the Evolutionary History and Global Expansion of Candida Auris Using Population Genomic Analyses. MBio 2020, 11, 10–1128. [Google Scholar] [CrossRef]
- Muñoz, J.F.; Welsh, R.M.; Shea, T.; Batra, D.; Gade, L.; Howard, D.; Rowe, L.A.; Meis, J.F.; Litvintseva, A.P.; Cuomo, C.A. Clade-Specific Chromosomal Rearrangements and Loss of Subtelomeric Adhesins in Candida Auris. Genetics 2021, 218, iyab029. [Google Scholar] [CrossRef]
- Arora, P.; Singh, P.; Wang, Y.; Yadav, A.; Pawar, K.; Singh, A.; Padmavati, G.; Xu, J.; Chowdhary, A. Environmental Isolation of Candida Auris from the Coastal Wetlands of Andaman Islands, India. MBio 2021, 12, 10-1128. [Google Scholar] [CrossRef]
- Geronikou, A.; Larsen, N.; Lillevang, S.K.; Jespersen, L. Occurrence and Identification of Yeasts in Production of White-Brined Cheese. Microorganisms 2022, 10, 1079. [Google Scholar] [CrossRef] [PubMed]
- Yadav, A.; Jain, K.; Wang, Y.; Pawar, K.; Kaur, H.; Sharma, K.K.; Tripathy, V.; Singh, A.; Xu, J.; Chowdhary, A. Candida Auris on Apples: Diversity and Clinical Significance. MBio 2022, 13, e00518-22. [Google Scholar] [CrossRef] [PubMed]
- Glushakova, A.; Kachalkin, A.; Rodionova, E. The Role of Fruits as Reservoirs for Resistant and Virulent Strains of Opportunistic Yeasts. World J. Microbiol. Biotechnol. 2023, 39, 313. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, S.; Alfouzan, W. Candida Auris: Epidemiology, Diagnosis, Pathogenesis, Antifungal Susceptibility, and Infection Control Measures to Combat the Spread of Infections in Healthcare Facilities. Microorganisms 2021, 9, 807. [Google Scholar] [CrossRef] [PubMed]
- Cristina, M.L.; Spagnolo, A.M.; Sartini, M.; Carbone, A.; Oliva, M.; Schinca, E.; Boni, S.; Pontali, E. An Overview on Candida Auris in Healthcare Settings. J. Fungi 2023, 9, 913. [Google Scholar] [CrossRef] [PubMed]
- Chybowska, A.D.; Childers, D.S.; Farrer, R.A. Nine Things Genomics Can Tell Us About Candida Auris. Front. Genet. 2020, 11, 351. [Google Scholar] [CrossRef]
- Mroczyńska, M.; Brillowska-Dąbrowska, A. Virulence of Clinical Candida Isolates. Pathogens 2021, 10, 466. [Google Scholar] [CrossRef] [PubMed]
- Sardi, J.C.O.; Scorzoni, L.; Bernardi, T.; Fusco-Almeida, A.M.; Mendes Giannini, M.J.S. Candida Species: Current Epidemiology, Pathogenicity, Biofilm Formation, Natural Antifungal Products and New Therapeutic Options. J. Med. Microbiol. 2013, 62, 10–24. [Google Scholar] [CrossRef]
- Ghannoum, M.A. Potential Role of Phospholipases in Virulence and Fungal Pathogenesis. Clin. Microbiol. Rev. 2000, 13, 122–143. [Google Scholar] [CrossRef] [PubMed]
- SBasu, H.C.; Gugnani, S.; Joshi, N. Gupta, Distribution of Candida species in different clinical sources in Delhi, India, and proteinase and phospholipase activity of Candida albicans isolates. Rev. Iberoam. Micol. 2003, 20, 137–140. [Google Scholar]
- Lockhart, S.R.; Etienne, K.A.; Vallabhaneni, S.; Farooqi, J.; Chowdhary, A.; Govender, N.P.; Colombo, A.L.; Calvo, B.; Cuomo, C.A.; Desjardins, C.A.; et al. Simultaneous Emergence of Multidrug-Resistant Candida Auris on 3 Continents Confirmed by Whole-Genome Sequencing and Epidemiological Analyses. Clin. Infect. Dis. 2017, 64, 134–140. [Google Scholar] [CrossRef] [PubMed]
- Chow, N.A.; de Groot, T.; Badali, H.; Abastabar, M.; Chiller, T.M.; Meis, J.F. Potential Fifth Clade of Candida Auris, Iran, 2018. Emerg. Infect. Dis. J.—CDC 2019, 25, 1780–1781. [Google Scholar] [CrossRef] [PubMed]
- Spruijtenburg, B.; Badali, H.; Abastabar, M.; Mirhendi, H.; Khodavaisy, S.; Sharifisooraki, J.; Taghizadeh Armaki, M.; de Groot, T.; Meis, J.F. Confirmation of Fifth Candida Auris Clade by Whole Genome Sequencing. Emerg. Microbes Infect. 2022, 11, 2405–2411. [Google Scholar] [CrossRef]
- Suphavilai, C.; Ko, K.K.K.; Lim, K.M.; Tan, M.G.; Boonsimma, P.; Chu, J.J.K.; Goh, S.S.; Rajandran, P.; Lee, L.C.; Tan, K.Y.; et al. Detection and Characterisation of a Sixth Candida Auris Clade in Singapore: A Genomic and Phenotypic Study. Lancet Microbe 2024, 5, 100878. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, J.F.; Gade, L.; Chow, N.A.; Loparev, V.N.; Juieng, P.; Berkow, E.L.; Farrer, R.A.; Litvintseva, A.P.; Cuomo, C.A. Genomic Insights into Multidrug-Resistance, Mating and Virulence in Candida Auris and Related Emerging Species. Nat. Commun. 2018, 9, 5346. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, A.; Vadnala, R.N.; Ganguly, P.; Selvakumar, P.; Rudramurthy, S.M.; Prasad, R.; Chakrabarti, A.; Siddharthan, R.; Sanyal, K. Functional and Comparative Analysis of Centromeres Reveals Clade-Specific Genome Rearrangements in Candida Auris and a Chromosome Number Change in Related Species. MBio 2021, 12, 10-1128. [Google Scholar] [CrossRef]
- Spivak, E.S.; Hanson, K.E. Candida Auris: An Emerging Fungal Pathogen. J. Clin. Microbiol. 2018, 56, 10-1128. [Google Scholar] [CrossRef] [PubMed]
- Pchelin, I.M.; Azarov, D.V.; Churina, M.A.; Ryabinin, I.A.; Vibornova, I.V.; Apalko, S.V.; Kruglov, A.N.; Sarana, A.M.; Taraskina, A.E.; Vasilyeva, N.V. Whole Genome Sequence of First Candida Auris Strain, Isolated in Russia. Med. Mycol. 2020, 58, 414–416. [Google Scholar] [CrossRef] [PubMed]
- De Groot, T.; Puts, Y.; Berrio, I.; Chowdhary, A.; Meis, J.F. Development of Candida Auris Short Tandem Repeat Typing and Its Application to a Global Collection of Isolates. MBio 2020, 11, e02971. [Google Scholar] [CrossRef] [PubMed]
- Cuomo, C.A.; Alanio, A. Tracking a Global Threat: A New Genotyping Method for Candida Auris. MBio 2020, 11, e00259-20. [Google Scholar] [CrossRef]
- Vatanshenassan, M.; Boekhout, T.; Mauder, N.; Robert, V.; Maier, T.; Meis, J.F.; Berman, J.; Then, E.; Kostrzewa, M.; Hagen, F. Evaluation of Microsatellite Typing, ITS Sequencing, AFLP Fingerprinting, MALDI-TOF MS, and Fourier-Transform Infrared Spectroscopy Analysis of Candida auris. J. Fungi 2020, 6, 146. [Google Scholar] [CrossRef] [PubMed]
- Yadav, A.; Singh, A.; Wang, Y.; van Haren, M.H.; Singh, A.; de Groot, T.; Meis, J.F.; Xu, J.; Chowdhary, A. Colonisation and Transmission Dynamics of Candida Auris among Chronic Respiratory Diseases Patients Hospitalised in a Chest Hospital, Delhi, India: A Comparative Analysis of Whole Genome Sequencing and Microsatellite Typing. J. Fungi 2021, 7, 81. [Google Scholar] [CrossRef] [PubMed]
- de Almeida, J.N.; Francisco, E.C.; Hagen, F.; Brandão, I.B.; Pereira, F.M.; Presta Dias, P.H.; de Miranda Costa, M.M.; de Souza Jordão, R.T.; de Groot, T.; Colombo, A.L. Emergence of Candida Auris in Brazil in a COVID-19 Intensive Care Unit. J. Fungi 2021, 7, 220. [Google Scholar] [CrossRef] [PubMed]
- Tsai, Y.-T.; Lu, P.-L.; Tang, H.-J.; Huang, C.-H.; Hung, W.-C.; Tseng, Y.-T.; Lee, K.-M.; Lin, S.-Y. The First Invasive Candida Auris Infection in Taiwan. Emerg. Microbes Infect. 2022, 11, 1867–1875. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. ISBN 978-0-12-372180-8. [Google Scholar]
- Price, M.F.; Wilkinson, I.D.; Gentry, L.O. Plate Method for Detection of Phospholipase Activity in Candida Albicans. Sabouraudia 1982, 20, 7–14. [Google Scholar] [CrossRef] [PubMed]
- CLSI. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts, 4th ed.; CLSI standard M27; Clinical and Laboratory Standards Institute: Philadelphia, PA, USA, 2017. [Google Scholar]
- Bruvo, R.; Michiels, N.K.; D’Souza, T.G.; Schulenburg, H. A Simple Method for the Calculation of Microsatellite Genotype Distances Irrespective of Ploidy Level. Mol. Ecol. 2004, 13, 2101–2106. [Google Scholar] [CrossRef] [PubMed]
- Clark, L.V.; Jasieniuk, M. POLYSAT: An R package for polyploid microsatellite analysis. Mol. Ecol. Resour. 2011, 11, 562–566. [Google Scholar] [CrossRef]
- Carolus, H.; Jacobs, S.; Lobo Romero, C.; Deparis, Q.; Cuomo, C.A.; Meis, J.F.; Van Dijck, P. Diagnostic Allele-Specific PCR for the Identification of Candida Auris Clades. J. Fungi 2021, 7, 754. [Google Scholar] [CrossRef] [PubMed]
- de Groot, T.; Spruijtenburg, B.; Parnell, L.A.; Chow, N.A.; Meis, J.F. Optimization and Validation of Candida auris Short Tandem Repeat Analysis. Microbiol. Spectr. 2022, 10, e02645-22. [Google Scholar] [CrossRef] [PubMed]
- Mohsin, J.; Weerakoon, S.; Ahmed, S.; Puts, Y.; Al Balushi, Z.; Meis, J.F.; Al-Hatmi, A.M.S. A Cluster of Candida Auris Blood Stream Infections in a Tertiary Care Hospital in Oman from 2016 to 2019. Antibiotics 2020, 9, 638. [Google Scholar] [CrossRef] [PubMed]
- Alfouzan, W.; Ahmad, S.; Dhar, R.; Asadzadeh, M.; Almerdasi, N.; Abdo, N.M.; Joseph, L.; de Groot, T.; Alali, W.Q.; Khan, Z.; et al. Molecular Epidemiology of Candida Auris Outbreak in a Major Secondary-Care Hospital in Kuwait. J. Fungi 2020, 6, 307. [Google Scholar] [CrossRef] [PubMed]
- Steinmann, J.; Schrauzer, T.; Kirchhoff, L.; Meis, J.F.; Rath, P.-M. Two Candida Auris Cases in Germany with No Recent Contact to Foreign Healthcare—Epidemiological and Microbiological Investigations. J. Fungi 2021, 7, 380. [Google Scholar] [CrossRef]
- Satala, D.; Juszczak, M.; Wronowska, E.; Surowiec, M.; Kulig, K.; Kozik, A.; Rapala-Kozik, M.; Karkowska-Kuleta, J. Similarities and Differences among Species Closely Related to Candida albicans: C. tropicalis, C. dubliniensis, and C. auris. Cell. Microbiol. 2022, 2022, 2599136. [Google Scholar] [CrossRef]
- Larkin, E.; Hager, C.; Chandra, J.; Mukherjee, P.K.; Retuerto, M.; Salem, I.; Long, L.; Isham, N.; Kovanda, L.; Borroto-Esoda, K.; et al. The Emerging Pathogen Candida Auris: Growth Phenotype, Virulence Factors, Activity of Antifungals, and Effect of SCY-078, a Novel Glucan Synthesis Inhibitor, on Growth Morphology and Biofilm Formation. Antimicrob. Agents Chemother. 2017, 61, e02396-16. [Google Scholar] [CrossRef] [PubMed]
- Shaban, S.; Patel, M.; Ahmad, A. Improved Efficacy of Antifungal Drugs in Combination with Monoterpene Phenols against Candida Auris. Sci. Rep. 2020, 10, 1162. [Google Scholar] [CrossRef] [PubMed]
- Zarei Mahmoudabadi, A.; Zarrin, M.; Miry, S. Phospholipase activity of Candida albicans isolated from vagina and urine samples. Jundishapur. J. Microbiol. 2010, 3, 169–173. [Google Scholar]
- Chakrabarti, A.; Sood, P. On the Emergence, Spread and Resistance of Candida Auris: Host, Pathogen and Environmental Tipping Points. J. Med. Microbiol. 2021, 70, 001318. [Google Scholar] [CrossRef]
- Pappas, P.G.; Kauffman, C.A.; Andes, D.R.; Clancy, C.J.; Marr, K.A.; Ostrosky-Zeichner, L.; Reboli, A.C.; Schuster, M.G.; Vazquez, J.A.; Walsh, T.J.; et al. Clinical Practice Guideline for the Management of Candidiasis: 2016 Update by the Infectious Diseases Society of America. Clin. Infect. Dis. 2016, 62, e1–e50. [Google Scholar] [CrossRef]
- Kilburn, S.; Innes, G.; Quinn, M.; Southwick, K.; Ostrowsky, B.; Greenko, J.A.; Lutterloh, E.; Greeley, R.; Magleby, R.; Chaturvedi, V.; et al. Antifungal Resistance Trends of Candida Auris Clinical Isolates in New York and New Jersey from 2016 to 2020. Antimicrob. Agents Chemother. 2022, 66, e02242-21. [Google Scholar] [CrossRef]
- Chowdhary, A.; Prakash, A.; Sharma, C.; Kordalewska, M.; Kumar, A.; Sarma, S.; Tarai, B.; Singh, A.; Upadhyaya, G.; Upadhyay, S.; et al. A Multicentre Study of Antifungal Susceptibility Patterns among 350 Candida Auris Isolates (2009–17) in India: Role of the ERG11 and FKS1 Genes in Azole and Echinocandin Resistance. J. Antimicrob. Chemother. 2018, 73, 891–899. [Google Scholar] [CrossRef] [PubMed]
- Calvo, B.; Melo, A.S.A.; Perozo-Mena, A.; Hernandez, M.; Francisco, E.C.; Hagen, F.; Meis, J.F.; Colombo, A.L. First Report of Candida Auris in America: Clinical and Microbiological Aspects of 18 Episodes of Candidemia. J. Infect. 2016, 73, 369–374. [Google Scholar] [CrossRef] [PubMed]
Characteristic | No. (%) |
---|---|
Localization | |
Blood | 60 (53.57%) |
Central venous catheter | 13 (11.60%) |
Urine | 25 (22.30%) |
Urine catheter | 7 (6.25%) |
BAL | 1 (0.90%) |
Sputum | 3 (2.68%) |
Pus | 1 (0.90%) |
Throat swab | 1 (0.90%) |
Environmental object | 1 (0.90%) |
Isolation year | |
2017 | 1 (0.90%) |
2018 | 3 (2.68%) |
2019 | 4 (3.57%) |
2020 | 18 (16.07%) |
2021 | 49 (43.75%) |
2022 | 35 (31.25%) |
2023 | 2 (1.78%) |
Marker | Primer Sequence (5′–3′) | Repeat Unit | |
---|---|---|---|
Forward Primer | Reverse Primer | ||
M2a | FAM-GCAACATCCTGAGCAGTATCAC | GGTGTTGACGTGCCCAAATATGC | AG |
M2b | HEX-CCACTCCGTTTTGGGTCTG | AGAGAATCTACAAATGTGTCGC | AG |
M2c | ROX-CTGTTTCTGTGGCAGGCTTCC | GCCACGTTTCACYGCYACCAT | AG |
M3-Ia | FAM-GCATGGATCAACAGCTAACAG | AGTGCCAGGCTGTGTACTTTTG | CAA |
M3-Ib | HEX-CATCCTAACGCTGGCTCTTC | GGYTTTGAGGYTGCCCTAGC | CAA |
M3-Ic | ROX-GCAACTACGCATTGTGTATTC | CTAACAGAGGATTTCAATTGCC | TTA |
M3-IIa | FAM-GTTCAAAATCGCTGACGGTC | GAGATGATGATGGCACTTGC | CTA |
M3-IIb | HEX-GTGAATGGAGCACCACAACCAG | GCGCAAATGACTGGCCCATG | GTA |
M3-IIc | ROX-GTGATGAGCGCACTACACAGG | GGCGAAGAAACGGTGAGTAC | CTA |
M9a | FAM-CTTGTCTAGTTTGCGATCTACGC | GAGACTGCCAAGCCAAGC | GATGATGAA |
M9b | HEX-CTGCTTACTGGAGACTCTTCC | GATGAGGAGGACGAGGACG | TCATCGTCA |
M9c | ROX-GTACGAAATGGGGATAATTGGG | ACCAACCGTGCTATTCTC | TCCTTCTTC |
Sample Type | Phospholipase Activity, Pz | ||||
---|---|---|---|---|---|
<0.69 (++++) | 0.70–0.79 (+++) | 0.80–0.89 (++) | 0.90–0.99 (+) | 1.00 (−) | |
Urine (n = 32) | 25 (78.12%) | 3 (9.38%) | 3 (9.38%) | 1 (3.16%) | 0 (0%) |
Blood (n = 73) | 37 (50.68%) | 11 (15.07%) | 17 (23.29%) | 4 (5.48%) | 4 (5.48%) |
Other localization (n = 7) | 6 (85.71%) | 1 (14.29%) | 0 (0%) | 0 (0%) | 0 (0%) |
All (n = 112) | 68 (60.71%) | 15 (13.40%) | 20 (17.86) | 5 (4.46%) | 4 (3.57%) |
Antifungal Drugs | MIC Range (μg/mL) | MIC50 | MIC90 | MIC (μg/mL) | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
(μg/mL) | (μg/mL) | ≥256 | 128 | 64 | 32 | 8 | 4 | 2 | 1 | 0.5 | 0.25 | 0.125 | ≤0.06 | 0.03 | 0.015 | ||
AmB | 0.25–2 | 1 | 2 | 19 | 57 | 32 | 4 | ||||||||||
VOR | 0.015–8 | 4 | 8 | 33 | 37 | 18 | 6 | 5 | 4 | 4 | 4 | 1 | |||||
ITR | 0.015–2 | 0.5 | 1 | 1 | 21 | 49 | 17 | 8 | 13 | 1 | 2 | ||||||
PZ | 0.015–1 | 0.25 | 0.5 | 5 | 31 | 40 | 18 | 4 | 11 | 3 | |||||||
FCZ | 8–≥256 | 256 | 256 | 93 | 6 | 5 | 7 | 1 | |||||||||
AND | 0.015–0.5 | 0.12 | 0.25 | 1 | 20 | 65 | 19 | 4 | 3 | ||||||||
CAS | 0.06–0.5 | 0.25 | 0.25 | 8 | 49 | 47 | 8 | ||||||||||
MCF | 0.015–1 | 0.12 | 0.25 | 1 | 4 | 10 | 55 | 35 | 6 | 1 | |||||||
FC-5 | ≤0.06–≥64 | 0.06 | 0.12 | 2 | 2 | 1 | 25 | 80 |
Antifungal Drugs | Virulence Factors (p-Value) | |
---|---|---|
Esterase | Phospholipase | |
AmB | −0.002 (0.986) | 0.070 (0.462) |
VOR | −0.001 (0.992) | −0.220 (0.200) |
ITR | 0.085 (0.375) | −0.162 (0.087) |
PZ | 0.096 (0.312) | −0.225 (0.017) |
FCZ | 0.025 (0.795) | −0.033 (0.726) |
AND | 0.052 (0.584) | 0.018 (0.849) |
CAS | −0.075 (0.432) | −0.006 (0.949) |
MCF | 0.092 (0.332) | 0.045 (0.635) |
FC-5 | −0.086 (0.367) | −0.077 (0.419) |
Genotype | M2a | M2b | M2c | M3-1a | M3-1b | M3-1c | M3-2a | M3-2b | M3-2c | M9a | M9b | M9c | No. of Isolates | No. of Hospitals |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
GI | 66 | 19 | 9 | 62 | 10 | 18 | 36 | 29 | 22 | 19 | 11 | 9 | 53 | 14 |
GII | 66 | 19 | 9 | 62 | 10 | 18 | 37 | 29 | 22 | 19 | 11 | 9 | 9 | 2 |
GIII | 66 | 19 | 9 | 62 | 10 | 18 | 36 | 29 | 23 | 19 | 11 | 9 | 1 | 1 |
GIV | 66 | 19 | 9 | 62 | 10 | 18 | 36 | 30 | 22 | 19 | 11 | 9 | 23 | 9 |
GV | 66 | 19 | 9 | 62 | 10 | 19 | 37 | 30 | 22 | 19 | 11 | 9 | 1 | 1 |
GVI | 66 | 19 | 9 | 62 | 10 | 18 | 37 | 30 | 22 | 19 | 11 | 9 | 6 | 1 |
GVII | 66 | 19 | 9 | 63 | 10 | 18 | 36 | 29 | 22 | 19 | 11 | 9 | 7 | 2 |
GVIII | 66 | 19 | 9 | 64 | 10 | 18 | 36 | 29 | 22 | 19 | 11 | 9 | 2 | 2 |
GIX | 66 | 19 | 9 | 70 | 10 | 18 | 36 | 29 | 22 | 19 | 11 | 9 | 2 | 2 |
GX | 66 | 19 | 9 | 69 | 10 | 18 | 37 | 29 | 22 | 19 | 11 | 9 | 1 | 1 |
GXI | 66 | 19 | 9 | 55 | 10 | 18 | 36 | 29 | 23 | 19 | 11 | 9 | 1 | 1 |
GXII | 66 | 19 | 9 | 54 | 10 | 18 | 36 | 29 | 22 | 19 | 11 | 9 | 1 | 1 |
GXIII | 66 | 19 | 9 | 53 | 10 | 18 | 36 | 29 | 22 | 19 | 11 | 9 | 1 | 1 |
GXIV | 66 | 19 | 9 | 49 | 10 | 18 | 36 | 29 | 22 | 19 | 11 | 9 | 3 | 1 |
GXV | 66 | 19 | 9 | 54 | 10 | 18 | 36 | 29 | 29 | 19 | 11 | 9 | 1 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oganesyan, E.; Klimenteva, V.; Vybornova, I.; Venchakova, V.; Parshikova, E.; Kovyrshin, S.; Orlova, O.; Kruglov, A.; Gordeeva, S.; Vasilyeva, N.; et al. Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia. J. Fungi 2025, 11, 35. https://doi.org/10.3390/jof11010035
Oganesyan E, Klimenteva V, Vybornova I, Venchakova V, Parshikova E, Kovyrshin S, Orlova O, Kruglov A, Gordeeva S, Vasilyeva N, et al. Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia. Journal of Fungi. 2025; 11(1):35. https://doi.org/10.3390/jof11010035
Chicago/Turabian StyleOganesyan, Ellina, Victoria Klimenteva, Irina Vybornova, Valentina Venchakova, Ekaterina Parshikova, Sergey Kovyrshin, Olga Orlova, Alexander Kruglov, Svetlana Gordeeva, Natalya Vasilyeva, and et al. 2025. "Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia" Journal of Fungi 11, no. 1: 35. https://doi.org/10.3390/jof11010035
APA StyleOganesyan, E., Klimenteva, V., Vybornova, I., Venchakova, V., Parshikova, E., Kovyrshin, S., Orlova, O., Kruglov, A., Gordeeva, S., Vasilyeva, N., & Taraskina, A. (2025). Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia. Journal of Fungi, 11(1), 35. https://doi.org/10.3390/jof11010035