Next Article in Journal
The Mechanosensitive Pkd2 Channel Modulates the Recruitment of Myosin II and Actin to the Cytokinetic Contractile Ring
Next Article in Special Issue
Fungal Diversity in an Undisturbed Andean Páramo Soil in Quimsacocha (Ecuador)
Previous Article in Journal
Three New Species of Tuber Discovered in Alpine Fir Forests in Yunnan, China
Previous Article in Special Issue
Phylogenetic and Morphological Evidence for Three New Species of Diaporthales (Ascomycota) from Fujian Province, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Diversity and New Species of Ascomycota from Bamboo in China

1
State Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops, College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Department of Biological Sciences, University of Illinois, Chicago, IL 60607, USA
3
Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China
4
Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences, Urumqi 830091, China
5
Landscape Management Department, Xiamen Botanical Garden, Xiamen 361004, China
6
School of Ecology and Environment, Tibet University, Lasa 850000, China
7
Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Authors to whom correspondence should be addressed.
J. Fungi 2024, 10(7), 454; https://doi.org/10.3390/jof10070454
Submission received: 8 May 2024 / Revised: 21 June 2024 / Accepted: 25 June 2024 / Published: 28 June 2024
(This article belongs to the Special Issue Fungal Diversity in Various Environments, 3rd Edition)

Abstract

Bamboo is an economically important crop that has gained prominence as an alternative to wood to reduce deforestation and ecosystem destruction. Diseases of bamboo that typically occur on leaves and stems can cause significant loss, reducing the quality and yield of the bamboo. However, there are few reports identifying the fungal species diversity and potential pathogens of bamboo. Here, we describe four new species of plant fungi from the leaves of bamboo within Fujian provinces, China. Fungi were isolated from diseased leaves collected within Fujian province and identified based on their morphological characteristics and multilocus phylogenies using nucleotide sequences derived from combined datasets of the intervening 5.8S nrRNA gene (ITS), the 28S large subunit of nuclear ribosomal RNA gene (LSU), the large subunit of RNA polymerase I (rpb1), the translation elongation factor 1-α gene (tef1-α), and the partial beta-tubulin gene (tub2). These analyses helped reveal and clarify taxonomic relationships in the family Magnaporthaceae. The new species of bambusicolous fungi identified include two species of Bifusisporella, described as B. fujianensis sp. nov. and B. bambooensis sp. nov., and two species of Apiospora, described as A. fujianensis sp. nov. and A. fuzhouensis sp. nov. This study further expands the characterization and distribution of fungi associated with bamboo.

1. Introduction

The bamboo plant (Poales, Bambusoideae) family includes over 1400 different species of monocotyledon, mostly evergreen perennials. Bamboo encompasses the largest members of the grass family, occur naturally in a wide range of different ecosystems, and are cultivated as a highly versatile crop [1]. Bamboos are well known to confer a number of beneficial ecological effects including carbon sequestration and erosion control, include some of the fastest growing plants known, have widespread ornamental use, and represent an important economic crop in regions where they are cultivated. Commercial applications of bamboo as a material for use in building/construction and fabrication of furniture, fabric, paper, cookware, cooking utensils, and many other items stems from its high strength-to-weight ratio and ease of cultivation that includes rapid plant growth. In addition, the plant is a food source for humans and other animals, notably giant and red pandas, as well as bamboo lemurs [2]. Currently, approximately 80% of the world’s bamboo species are found in the eastern and/or southern areas of Asia, with China having the richest bamboo resources in terms of highest diversity and overall cultivated area, accounting for more than 50% of the worldwide bamboo species [3,4]. Bamboos plants show high resistance to microbial diseases, with fungal ascomycetes as the major microorganisms that limit the health and productivity of bamboo forests. Different bamboo fungi can infect various parts of the plant, resulting in nevus (gall-like “tumors”), spotted wilt, leaf damage/necrosis, and other symptoms and diseases that can lead to reduced quality and yield of the bamboo. Deleterious effects of Bambusicolous Ascomycota can impact economic development, and methods for the biological control of some bamboo fungi can reduce losses in bamboo forests and the cultivation industry, helping to maintain diversity, plant populations, and the varied beneficial ecological functions of bamboo forests [5]. Over 1150 different species of ascomycetes may have some association (including pathogens, mutualists, and commensals) with bamboo, of which 350 asexual morphs, 240 hyphomycelia, and 110 coelomycetes have been tentatively identified [6]. These fungi are mainly distributed in the Sordariomycetes, Dothideomycetes, and Eurotiomycetes, with the more representative families of bamboo fungi found in the Magnaporthaceae and Apiosporaceae families within the Sordariomycetes.
Magnaporthaceae classification was proposed by Cannon [7] and included the genus Magnaporthe and its related genera Buergenerula, Clasterosphaeria, Gaeumannomyces, Herbampulla, and Omnidemptus. More recently, additional taxa classified within Magnaporthaceae include Magnaporthiopsis [8], Bussabanomyces, Kohlmeyeriopsis and Slopeiomyces [9], Pseudophhialophora [10], Falciphora [11], Neogaeumanyces [12], Budhanggurabania [13], Falciphoriella and Gaemannomycella [14], and Bifusisporella. Currently, Magnaporthaceae consists of 25 genera and more than 100 species. The genus Bifusisporella was erected by Rejane [15], with B. sorghi designated as the type species. The morphology of Bifusisporella is characterized by septate, branched mycelium with a smooth, hyaline to light brown surface, conidiophores reduced to conidiogenous cells, which can be solitary or aggregated, curved and elongated cylindrical or clavate, and are typically light brown. Conidia are described as dimorphic, with macroconidia slightly more curved than microconidia, and both sickle-shaped, hyaline, and smooth [15].
The Apiosporaceae fungal family belongs to the Ascomycota (Sordariomycetes Amphisphaeriales), with the type genus being Apiospora Sacc. introduced by Saccardo [16] and the type species being A. montagnei Sacc. The sexual morphology of Apiospora is characterized by hyaline ascospores surrounded by thick gelatinous sheaths [17,18,19]. The asexual form of Apiospora is characterized by lenticular conidia that are spherical or subglobose and usually light brown to brown in color [20,21]. Most Apiospora species are associated with plants as endophytes, with some species being economically important plant pathogens [22,23].
In this study, four fungal species, two of which represent new species, found growing on bamboo plants were identified and placed within the Magnaporthaceae, with their taxonomic placement determined based on morphological characteristics and molecular identification. The latter involved multilocus phylogenetic reconstructions using a combined dataset of the intervening 5.8S nrRNA gene (ITS), the 28S large subunit of nuclear ribosomal RNA gene (LSU), the large subunit of RNA polymerase I (rpb1), and the translation elongation factor 1-α gene (tef1-α) nucleotide sequences. Similarly, four additional fungal isolates (again, with two representing new species) were identified and placed within the Apiosporaceae based upon morphological characteristics and molecular taxonomic and phylogenetic analyses using the combined marker loci sequence dataset (ITS + LSU + tef1-α + tub2). Our results identify two new species of Bifusisporella, Bifusisporella fujianensis sp. nov. and Bifusisporella bambooensis sp. nov. (Magnaporthaceae), and two new species of Apiospora, Apiospora fujianensis sp. nov., Apiospora fuzhouensis sp. nov. (Apiosporaceae), which are illustrated and described. This study expands the diversity of fungi infecting the economically and environmentally important bamboo plant.

2. Materials and Methods

2.1. Fungal Isolates and Morphology

Specimens were collected from diseased bamboo leaves in groves located in Fujian province, China. Tissue fragments with a total area of about 25 mm2 were removed from the edges of the bamboo leaves in which disease spots, e.g., necrosis, wilting, and/or discoloration/blackening, were apparent. Samples were soaked in 75% ethanol for 45–60 s, then soaked in sterile deionized water for 45 s and washed with sterile water. Tissue fragments were then transferred to a 5% sodium hypochlorite solution for 30 s, followed by three washes in sterile deionized water for 60 s. The fragments were dried with sterilized filter paper and then transferred to the PDA plates which were incubated at 25 °C for 5–7 days following previously established procedures [24]. Growing edges of fungal mycelia were transferred to new PDA plates and plates were incubated for 5–7 d. The procedure was continued until the fungal culture was pure (typically 2–4 times). To promote sporulation and observe the colony morphology, purified isolates were inoculated in the center of PDA and synthetic low-nutrient agar (SNA) plates and cultured at 25 °C under alternating conditions of 12 h near-ultraviolet light and 12 h dark [25]. At 7 and 14 d of growth on PDA, photos of the colonies were taken with a digital camera, and the morphology of conidiomata, conidiophores, and conidiogenous cells was observed using a stereomicroscope (Nikon SMZ74, Tokyo, Japan). Samples were also prepared for analyses by scanning electron microscope (SEM, Nikon Ni-U; HITACHI SU3500) as described [26]. Fungal micromorphology and structure were measured by Digimizer 5.4.4 software. Single colony purified cultures were cut and stored in 10% sterilized glycerin and sterile water at 4 °C for future detailed study.

2.2. DNA Extraction, PCR Amplification, and Sequencing

Genomic DNA was isolated from fresh mycelia using a fungal DNA extraction mini ki, from cells cultured at 25 °C on PDA for 15–30 days as described [27]. Primers ITS5/ITS4 [28], LROR/LR5 [29], RPB1-Ac/RPB1-Cr [30,31], EF1-983F/EF1-2218R [32], EF1-728F/EF-2 [33], and Bt2a/Bt2b [34] were used for amplification of the intervening 5.8S nrRNA gene (ITS), the 28S large subunit of nuclear ribosomal RNA gene (LSU), the large subunit of RNA polymerase I (rpb1), the translation elongation factor 1-α gene (tef1-α),and the partial beta-tubulin gene (tub2) by polymerase chain reactions (PCR) as described [27]. Primer sequences are given in Table 1.
PCR amplification of target loci was performed using a Bio-Rad thermal cycler (Hercules, CA, USA) with a 25 μL reaction volume of 12.5 μL 2×Rapid Taq Master Mix (Vazyme, Nanjing, China), with 1 μL (10 μM) for the forward and reverse primers (Sangon, Shanghai, China) and 1 μL for the template genomic DNA in the amplifier, and adjusted with distilled deionized water to a total volume of 25 μL. PCR products were visualized on 1% agarose gel electrophoresis. Bidirectional (both strand) sequencing of PCR products was conducted by the Tsingke Company Limited (Fuzhou, China). Consensus sequences were assembled using MEGA 7.0 [35]. New sequences generated in this study were uploaded to GenBank (https://www.ncbi.nlm.nih.gov, accessed on 19 March 2024, Table 2).

2.3. Phylogenetic Analyses

Based on maximum likelihood (ML) and Bayesian inference (BI) analyses, phylogenetic trees were constructed to explore the phylogeny relationships of the fungal strains, grouping them into either the Magnaporthaceae or Apiosporaceae families. Corresponding gene loci of the reference sequences were downloaded from GenBank. Ophioceras dolichostomum (CBS 114926) was selected as an outgroup taxonomic unit for the phylogeny of Magnaporthaceae, and Sporocadus trimorphus (CBS 114203) was selected as an outgroup taxonomic unit for the phylogeny of Apiosporaceae. All sequences were aligned using the MAFFT v. 7 online service (http://mafft.cbrc.jp/alignment/server/, accessed on 2 February 2024) [36] and manually adjusted in BioEdit v.7.2.6.1 [37] and MEGA 7.0 [35].
In addition, four simultaneous Markov Chain Monte Carlo (MCMC) chains, starting with 2,000,000 generations of random trees, were sampled every 100th generation, resulting in a total of 20,000 trees. The first 25% of trees were discarded as burn-in of each analysis. Branches with significant Bayesian Posterior Probabilities (BYPP > 0.90) were estimated in the remaining 15,000 trees [38]. Phylogenetic trees were plotted with FigTree v.1.4.4 [39] and embellished with Adobe Illustrator CS6. New sequences generated in this study have been deposited in GenBank (https://www.ncbi.nlm.nih.gov, accessed on 19 March 2024).

3. Results

3.1. Phylogenetic Analyses

Samples of bamboo plants showing obvious fungal growth were collected from the Baizhu Garden of Fujian Agriculture and Forestry University and West Lake Park of Fuzhou City, Fujian Province, China. A total of eight fungal isolates with different morphological appearances were single-colony purified. For each fungal isolate, ~2637 bp of nucleotide sequences corresponding to portions of the ITS, LSU, rpb1, and tef1-αloci (ITS: 1–369; LSU: 370–1146; rpb1: 1147–1893; tef1-α: 1894–2775) were isolated. Based upon initial BLAST results, four of these sequences were isolated, combined with sequences from 68 closely related species as determined by BLAST searches, as well as homologous regions from Ophioceras dolichostomum (CBS 114926) and Ophioceras leptosporum (CBS 894.70) (Ophioceraceae, Magnaporthales) used as the outgroup for phylogenetic analyses. These analyses showed 1297 distinct patterns, with 1349 bp identical, 614 variable, including gaps, and 812 bp which were parsimony-informative. Maximum likelihood phylogenies were inferred using IQ-TREE under the TIM2 + R4 + F model for 5000 ultrafast bootstraps, as well as the Shimodaira–Hasegawa-like approximate likelihood-ratio test [nst = 6, rates = invgamma], with an average standard deviation of split frequencies = 0.005812. The topological results obtained from the ML analysis were consistent with the results of the BI analysis connecting the combined datasets. As a result, the ML tree is shown, and the BI posterior probabilities are placed on it (Figure 1). Based on phylogenetic resolution and morphological analysis (given below), we report two of the four isolates as new species of Magnaporthaceae: Bifusisporella fujianensis and Bifusisporella bambooensis. The new species B. fujianensis was most closely related to B. sichuanensis (SICAUCC 22-0073) (ML-BS: 96%, BYPP: 0.76), and B. bambooensis to B. sorghi (URM 7442, URM 7864) (ML-BS: 100%, BYPP: 1).
Initial BLAST results of sequences derived from the remaining four isolates indicated placement of these within the Apiosporaceae family. Analyses using sequences derived from the four genetic loci examined, namely the ITS + LSU + tef1-α + tub2 concatenated sequence dataset which had an aligned length of 1941 total characters (ITS: 1–507, LSU: 508–1341, tub2: 1342–1830, tef1-α: 1831–1941), supported the classification of two of the isolates as new species. Based on these and morphological data (below), a new species, Apiospora fujianensis, was identified, related to A. garethjonesii (SICAUCC 22-0028), with good support (ML-BS: 93% and BYPP: 0.98). Designation of the other new species, A. fuzhouensis, was similarly strongly supported (100% ML/1 PP), with the species forming a separate branch within Apiospora. For A. fuzhouensis loci analyses, 924 distinct patterns were identified, with 1186 bp constant, 157 variable and included gaps, and 598 bp which were parsimony-informative. Maximum likelihood phylogenies were inferred using IQ-TREE [40], under the GTR + R3 + F model for 5000 ultrafast bootstraps [41], as well as the Shimodaira–Hasegawa-like approximate likelihood-ratio test [nst = 1, rates = invgamma] (Figure 2).

3.2. Taxonomy

Bifusisporella fujianensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 3).
MycoBank: MB852815.
Etymology: Named after Fujian Province where the fungus was collected.
Holotype: China, Fujian Province, Fujian University of Agriculture and Forestry (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo in China, March 2023, Z. Y. Zhao (holotype HMAS352712; ex-type living culture CGMCC3.25651).
Description: Leaf spots irregularly shaped, sunken in the center, brown or tan in color. Conidiomata elevated on agar, solitary, spherical, gradually transitioning from white hyaline to black, conidiophores reduced to conidiophores cells. Conidiogenous cells were phialidic, solitary or aggregated, curved, elongated, cylindrical or rod-shaped, light brown, 8.9–14.3 × 5.8–8.1 µm. Conidia were dimorphic, falcate or curved moon-shaped, smooth or cracked surface, transparent in color, 0–3 septa, 37.3–56.3 × 3.6–5.7 µm, mean = 45.1 × 4.4 µm. No sexual morphology was observed.
Culture characteristics: Colonies flattened on PDA with feathery margins, white, on SNA surface and reverse, white. The calculated growth rate was 0.6 cm/day at 25 °C.
Material examined: China, Fujian Province, Fujian University of Agriculture and Forestry (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo in China, March 2023, Z. Y. Zhao (paratype HMAS352713; ex-paratype living culture CGMCC3.27206).
Notes: The strain of the genus Bifusisporella was identified as a new species; nucleotide comparison of ITS, LSU, tef1-α, and rpb1 (CGMCC3.25651) showed differences with the sequences of B. sichuanensis (SICAUCC 22-0071), similarities are 12.3% (64/522), 4.1% (33/797), 4.1% (36/884), and 8.5% (58/684). In addition, the asexual morph of B. sichuanensis was not observed and the sexual morph of B. fujianensis was not observed.
Bifusisporella bambooensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 4).
MycoBank: MB852816.
Etymology: The epithet “bambooensis” refers to the host, which is bamboo.
Holotype: China, Fujian Province, Fujian University of Agriculture and Forestry, (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo. March 2023, Z.Y. Zhao (holotype HMAS352714; ex-type living culture CGMCC3.25653).
Description: Leaf spots were pike-shaped, color gradually changing from blackish brown to white from outside to inside, Conidiomata bulging on agar, black to hyaline, aggregated and spherical, conidiophores reduced to conidiophores cells. Conidiogenous cells were phialidic, singly or in groups, curved, elongated, cylindrical, 7.2–21.0 × 4.2–6.4 µm, conidia were dimorphic, falcate or curved moon-shaped, smooth or cracked surface, hyaline, 0–3 septa, 10.8–45.0 × 2.8–4.9 µm, mean = 25.0 × 3.7 µm. No sexual morphology was observed.
Culture characteristics: Colonies flattened on PDA, irregular black center, fading to white with white feathery margins, on SNA surface and reverse, white. Calculated growth rate was 1.0–1.4 cm/day at 25 °C. The growth rate was 0.5 cm/day.
Material examined: China, Fujian Province, Fujian University of Agriculture and Forestry (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo in China, March 2023, Z.Y. Zhao (paratype HMAS352715; ex-paratype living culture CGMCC3.27207).
Notes: Bifusisporella bambooensis is phylogenetically close (100% ML and 1BYPP), but distinct from B. sorghi (URM 7442). Compared to Bifusisporella sorghi, Bifusisporella bambooensis sp. nov. has larger conidiogenous cells and conidia (7.2–21.0 × 4.2–6.4 vs. 5.0–19.5 × 3.0–4.0 μm; 10.8–45.0 × 2.8–4.9 vs. 19.0–34.0 × 3.0–4.0 μm); nucleotide comparison of ITS, tef1-α and rpb1 (CGMCC3.25653) showed separation from B. sorghi (URM 7442), with differences of 6% (29/487), 5.3% (23/437), and 9.4% (65/693), respectively.
Apiospora fujianensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 5).
MycoBank: MB852818.
Etymology: Named after Fujian Province where the fungus was collected.
Holotype: China, Fujian Province, West Lake Park,119°17′47.09″ E,26°5′57.90″ N, from diseased leaves of bamboo in China, October 2022, J.H. Chen (holotype HMAS352716; ex-type living culture CGMCC3.25647).
Description: Leaf spots irregularly shaped, brown or tan in color. Conidiomata on agar were elevated, solitary or aggregated, spherical, black, conidiophores cells were solitary or aggregated, hyaline rounded, 3.5–5.8 × 3.5–5.2 µm. Conidia were rounded or ellipsoidal, contained globular contents, brown, 7.5–17.0 × 5.6–18.2 µm, mean = 14.0 × 11.6 µm. No sexual morphology was observed.
Culture characteristics: Colonies flattened on PDA, fluffy mycelium, black center with white margins over time; calculated growth rate of 1.3 cm/day at 25 °C.
Material examined: China, Fujian Province, West Lake Park, 119°17′47.09″ E, 26°5′57.90″ N, from diseased leaves of bamboo in China, October 2022, J.H. Chen (paratype HMAS352717; ex-paratype living culture CGMCC3.25648).
Notes: In the present study, two strains were obtained from diseased leaves of bamboo and differed from each other with a high degree of statistical support (BYPP = 0.98 and ML-BS = 93%), although overall analyses indicated that both isolates represented different strains of the same species.
Apiospora fuzhouensis sp. nov. Z.Y. Zhao and J.Z. Qiu, (Figure 6).
MycoBank: MB852820.
Etymology: Named after Fuzhou, Fujian Province, where the fungus was collected.
Holotype: China, Fujian Province, Fujian University of Agriculture and Forestry, (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo. March 2023, Z.Y. Zhao (holotype HMAS352718; ex-type living culture CGMCC3.25649).
Description: Leaf spots irregular in shape, brown or tan in color. Conidiomata on agar are elevated, solitary or aggregated, spherical, black, Conidiophores hyaline to light brown, smooth, fusiform, subcylindrical, conidiophore cells were solitary or aggregated, hyaline rounded, 1.5–9.1 × 2.4–7.2 µm. Conidia were rounded or ellipsoidal, brownish, 11.3–19.3 × 8.7–19.5 µm, mean = 14.8 × 14.4 µm. No sexual forms were observed.
Culture characteristics: Colonies flattened on PDA; mycelium fluffy, black; calculated growth rate 1.2 cm/day.
Material examined: China, Fujian Province, Fujian University of Agriculture and Forestry, (119°14′35.14″ E, 26°5′2.55″ N), from diseased leaves of bamboo. March 2023, Z.Y. Zhao (paratype HMAS352719; ex-paratype living culture CGMCC3.25650).
Notes: Two strains were obtained from diseased leaves of bamboo and differed from each other with a high degree of statistical support (100% ML/1 PP, Figure 2), although overall analyses indicated that both isolates represented different strains of the same species. The nucleotide comparison of ITS sequences of A. garethjonesii (SICAUCC 22-0028) revealed 39 bp (39/542 bp, 7.2%) nucleotide differences. The nucleotide comparison of tub2 sequences of A. garethjonesii (SICAUCC 22-0028) revealed 20 bp (20/524 bp, 3.8%) nucleotide differences. Morphologically, the conidia of A. fuzhouensis were slightly smaller than those of A. garethjonesii (SICAUCC 22-0028). Therefore, the two strains are proposed as a new species.

4. Discussion

As interest in bamboo has intensified due to its wide range of beneficial environmental effects as well as agricultural, industrial, and even foodstuff uses, identification of pathogens, that can decrease quality and/or yield of the plant has also gained interest. Here, we have identified four new species of fungi from diseased bamboo leaves found in Fujian Province, China. Identification was conducted using morphological and molecular phylogenetic analyses, with the former, i.e., characterization of the conidiomata, conidiophores, and conidiogenous cells used as important lines of evidence supporting species identification [42] and the latter (molecular approaches) allowing for phylogenetic placement and confirmation of new species designations.
Two of new species were identified as belonging to the Bifusisporella genus. Previously, Silva et al. isolated an endophyte, Bifusisporella sorgh, from healthy sorghum leaves in Brazil [15], and another endophyte, B. sichuanensis, has been reported from leaves of Sichuan poplar [43]. Most Bifusisporella species have sickle-shaped ditype conidia and are commonly found in Poaceae. The newly described species in this report, B. fujianensis, grouped with B. sichuanensis, but was distinct from the latter in both morphology and multilocus sequence analyses, whereas B. bambooensis potentially represents a separate clade. Morphological differences between the species were evident, particularly concerning the conidia (Table 3).
The remaining two new species identified in this report were found to belong to the Apiospora genus. Crous and Groenewald synonymized Apiospora with Arthrinium [44]; however, with additional genetic data from the Arthrinium type species, A. caricicola, Apiospora and Arthrinium were separated into two distinct genera [19]. Biogeographically, most specimen of Arthrinium have been found in temperate and boreal zones, whereas those of Apiospora have been mainly collected in tropical and subtropical regions, with the latter genus displaying a relatively wider distribution area. Currently, therefore, based on the molecular phylogenetic analysis of multigene loci (ITS, LSU, and exon sequences of tef1-α and tub2), Arthrinium and Apiospora are considered to represent independent lineages within the Apiosporaceae [19], confirming that the overall genetic, morphological, and ecological differences between Apiospora and Arthrinium are sufficient to support the taxonomic separation of the two genera. Apiospora are characterized by round/lenticular conidia, which are mainly found in Poaceae. Based on morphology and molecular analyses, Apiospora fujianensis sp. nov. and Apiospora fuzhouensis sp. nov. were described as two new species within Apiospora.
As a neo-tropical region, fungal species diversity in Fujian and surrounding areas appears particularly robust [26,27]. However, thus far, only a few species of fungi have been found in bamboo leaves, with our understanding of the diversity of fungal parasitism on bamboo incomplete. This is likely due to bamboo being particularly hardy and resistant to many microorganisms combined with a lack of specimen and data support [45]. These factors necessitate the collection of diverse specimens [5], as well as exploring the reaction/defense by the plant. Here, we provide candidate fungi, with further genomic and physiological studies aimed towards understanding the nature of these fungi on bamboo warranted.

Author Contributions

Conceptualization, Z.Z., X.G. and J.Q.; methodology, Z.Z. and T.M.; software, H.P. and Y.L.; validation, Z.L., J.X. and X.C.; formal analysis, X.Z.; investigation, H.L.; resources, P.J.; data curation, Z.Z., T.M., N.O.K., H.P., Y.L., Z.L., J.X., X.C., X.Z., H.L., M.Y.J.-S., P.J. and S.H.; writing—original draft preparation, Z.Z., T.M. and M.Y.J.-S.; writing—review and editing, Z.Z., N.O.K. and J.Q.; visualization, S.H.; supervision, X.G. and J.Q.; project administration, X.G. and J.Q.; funding acquisition, J.W., X.G. and J.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32270029, U1803232, 31670026), the National Key R & D Program of China (No. 2017YFE0122000), a Social Service Team Support Program Project (No. 11899170165), Science and Technology Innovation Special Fund (Nos. KFB23084, CXZX2019059S, CXZX2019060G) of Fujian Agriculture and Forestry University, a Fujian Provincial Major Science and Technology Project (No. 2022NZ029017), an Investigation and evaluation of biodiversity in the Jiulong River Basin (No. 082·23259-15), and Macrofungal and microbial resource investigation project in Longqishan Nature Reserve (No. SMLH2024(TP)-JL003#).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All newly generated sequences were deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 19 March 2024). All new taxa were linked with MycoBank (https://www.mycobank.org/ (accessed on 13 March 2024)).

Acknowledgments

We would like to thank Sen Liu, Chengjie Xiong, Longbin Lin, Weibin Zhang, Jinhui Chen, Pengyu Lai, Zhiang Heng, Ziyi Wu, Ruiya Chen, Chenjie Yang, and Mengjia Zhu for their help with sample collection.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Manandhar, R.; Kim, J.H.; Kim, J.T. Environmental, social and economic sustainability of bamboo and bamboo-based construction materials in buildings. J. Asian Archit. Build. Eng. 2019, 18, 49–59. [Google Scholar] [CrossRef]
  2. Binfield, L.; Britton, T.L.; Dai, C.; Innes, J. Evidence on the social, economic, and environmental impact of interventions that facilitate bamboo industry development for sustainable livelihoods: A systematic map protocol. Environ. Evid. 2022, 11, 33. [Google Scholar] [CrossRef]
  3. Liu, W.Y.; Hui, C.M.; Wang, F.; Wang, M.; Liu, G.L. Review of the Resources and Utilization of Bamboo in China. Bamboo Curr. Future Prospect. 2018, 8, 133–142. [Google Scholar] [CrossRef]
  4. Dlamini, L.C.; Fakudze, S.; Makombe, G.G.; Muse, S.; Zhu, J. Bamboo as a valuable resource and its utilization in historical and modern-day China. BioResources 2022, 17, 1926–1938. [Google Scholar] [CrossRef]
  5. Jiang, H.B.; Phookamsak, R.; Hongsanan, S.; Bhat, D.J.; Mortimer, P.E.; Suwannarach, N.; Kakumyan, P.; Xu, J. A review of bambusicolous Ascomycota in China with an emphasis on species richness in southwest China. Stud. Fungi 2022, 7, 20. [Google Scholar] [CrossRef]
  6. Yu, X.D.; Zhang, S.N.; Liu, J.K. Additions to Bambusicolous Fungi of Savoryellaceae from Southwest China. J. Fungi 2023, 9, 571. [Google Scholar] [CrossRef]
  7. Thongkantha, S.; Jeewon, R.; Dhanasekaran, V.; Lumyong, S.; McKenzie, E.; Hyde, K. Molecular phylogeny of Magnaporthaceae (Sordariomycetes) with a new species, Ophioceras chiangdaoense from Dracaena loureiroi in Thailand. Fungal Divers. 2009, 34, 157–173. [Google Scholar]
  8. Luo, J.; Zhang, N. Magnaporthiopsis, a new genus in Magnaporthaceae (Ascomycota). Mycologia 2013, 105, 1019–1029. [Google Scholar] [CrossRef] [PubMed]
  9. Klaubauf, S.; Tharreau, D.; Fournier, E.; Groenewald, J.Z.; Crous, P.W.; Vries, R.P.; Lebrun, M. Resolving the polyphyletic nature of Pyricularia (Pyriculariaceae). Stud. Mycol. 2014, 79, 85–120. [Google Scholar] [CrossRef]
  10. Luo, J.; Walsh, E.; Zhang, N. Four new species in Magnaporthaceae from grass roots in New Jersey Pine Barrens. Mycologia 2014, 106, 580–588. [Google Scholar] [CrossRef]
  11. Luo, J.; Walsh, E.; Zhang, N. Toward monophyletic generic concepts in Magnaporthales: Species with Harpophora asexual states. Mycologia 2015, 107, 641–646. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, J.K.; Hyde, K.D.; Jones, E.B.G.; Ariyawansa, H.A.; Bhat, D.J.; Boonmee, S.; Maharachchikumbura, S.S.N.; McKenzie, E.H.C.; Phookamsak, R.; Phukhamsakda, C.; et al. Fungal diversity notes 1–110: Taxonomic and phylogenetic contributions to fungal species. Fungal Divers. 2015, 72, 1–197. [Google Scholar] [CrossRef]
  13. Crous, P.W.; Wingfield, M.; Guarro, J.; Hernández-Restrepo, M.; Sutton, D.; Acharya, K.; Barber, P.; Boekhout, T.; Dimitrov, R.; Dueñas, M.; et al. Fungal Planet description sheets: 320–370. Persoonia 2015, 34, 167–266. [Google Scholar] [CrossRef] [PubMed]
  14. Hernández-Restrepo, M.; Groenewald, M.; Elliott, M.L.; Canning, G.; McMillan, V.; Crous, P.W. Take-all or nothing. Stud. Mycol. 2016, 83, 19–48. [Google Scholar] [CrossRef] [PubMed]
  15. Silva, R.M.F.; Oliveira, R.J.V.; Bezerra, J.D.P.; Bezerra, J.L.; Souza-Motta, C.M.; Silva, G.A. Bifusisporella sorghi gen. et sp. nov. (Magnaporthaceae) to accommodate an endophytic fungus from Brazil. Mycol. Prog. 2019, 18, 847–854. [Google Scholar] [CrossRef]
  16. Pintos, Á.; Alvarado, P. New studies on Apiospora (Amphisphaeriales, Apiosporaceae): Epitypification of Sphaeria apiospora, proposal of Ap. marianiae sp. nov. and description of the asexual morph of Ap. sichuanensis. MycoKeys 2022, 92, 63–78. [Google Scholar] [CrossRef] [PubMed]
  17. Liao, C.F.; Senanayake, I.C.; Dong, W.; Thilini Chethana, K.W.; Tangtrakulwanich, K.; Zhang, Y.X.; Doilom, M.K. Taxonomic and Phylogenetic Updates on Apiospora: Introducing Four New Species from Wurfbainia villosa and Grasses in China. J. Fungi 2023, 9, 1087. [Google Scholar] [CrossRef] [PubMed]
  18. Liu, R.Y.; Li, D.H.; Zhang, Z.X.; Liu, S.B.; Liu, X.Y.; Wang, Y.X.; Zhao, H.; Liu, X.Y.; Zhang, X.G.; Xia, J.W.; et al. Morphological and phylogenetic analyses reveal two new species and a new record of Apiospora (Amphisphaeriales, Apiosporaceae) in China. MycoKeys 2023, 95, 27–45. [Google Scholar] [CrossRef] [PubMed]
  19. Pintos, Á.; Alvarado, P. Phylogenetic delimitation of Apiospora and Arthrinium. Fungal Syst. Evol. 2021, 7, 197–221. [Google Scholar] [CrossRef]
  20. Kwon, S.L.; Cho, M.; Lee, Y.M.; Lee, H.; Kim, C.; Kim, G.H.; Kim, J.J. Diversity of the Bambusicolous Fungus Apiospora in Korea: Discovery of New Apiospora Species. Mycobiology 2022, 50, 302–316. [Google Scholar] [CrossRef]
  21. Hyde, K.D.; Frohlich, J.; Taylor, J.E. Fungi from palms. XXXVI. Reflections on unitunicate ascomycetes with apiospores. Sydowia 1998, 50, 21–80. [Google Scholar]
  22. Zhang, J.Y.; Chen, M.L.; Boonmee, S.; Wang, Y.X.; Lu, Y.Z. Four New Endophytic Apiospora Species Isolated from Three Dicranopteris Species in Guizhou, China. Fungal Divers. 2023, 9, 1096. [Google Scholar] [CrossRef] [PubMed]
  23. Tian, X.G.; Karunarathna, S.C.; Mapook, A.; Promputtha, I.; Xu, J.C.; Bao, D.F.; Tibpromma, S. One New Species and Two New Host Records of Apiospora from Bamboo and Maize in Northern Thailand with Thirteen New Combinations. Life 2021, 11, 1071. [Google Scholar] [CrossRef] [PubMed]
  24. Su, D.; Zhang, W.H.; Sun, R.; Zhang, Z.T.; Lyu, G. First Report of Botryosphaeria dothidea Causing Leaf Spot on Kadsura coccinea in China. Plant Dis. 2021, 105, 2714. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, Z.X.; Liu, X.Y.; Tao, M.F.; Liu, X.Y.; Xia, J.W.; Zhang, X.G.; Meng, Z. Taxonomy, Phylogeny, Divergence Time Estimation, and Biogeography of the Family Pseudoplagiostomataceae (Ascomycota, Diaporthales). J. Fungi 2023, 9, 82. [Google Scholar] [CrossRef] [PubMed]
  26. Liu, S.; Zhu, M.; Keyhani, N.O.; Wu, Z.; Lv, H.; Heng, Z.; Chen, R.; Dang, Y.; Yang, C.; Chen, J.; et al. Three New Species of Russulaceae (Russulales, Basidiomycota) from Southern China. J. Fungi 2024, 10, 70. [Google Scholar] [CrossRef] [PubMed]
  27. Mu, T.; Chen, J.; Zhao, Z.; Zhang, W.; Stephenson, S.L.; Yang, C.; Zhu, M.; Su, H.; Liu, P.; Guan, X.; et al. Morphological and phylogenetic analyzes reveal two new species of Melanconiella from Fujian Province, China. Front. Microbiol. 2023, 14, 1229705. [Google Scholar] [CrossRef] [PubMed]
  28. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing offungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
  29. Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef]
  30. Matheny, P.B.; Liu, Y.J.; Ammirati, J.F.; Hall, B.D. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). Am. J. Bot. 2002, 89, 688–698. [Google Scholar] [CrossRef]
  31. Castlebury, L.; Rossman, A.; Sung, G.; Hyten, A.; Spatafora, J. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol. Res. 2004, 108, 864–872. [Google Scholar] [CrossRef]
  32. Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef] [PubMed]
  33. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
  34. Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
  35. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  36. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
  37. He, J.; Han, X.; Luo, Z.L.; Xian, L.; Tang, S.M.; Luo, H.M.; Niu, K.Y.; Su, X.J.; Li, S.H. Species diversity of Ganoderma (Ganodermataceae, Polyporales) with three new species and a key to Ganoderma in Yunnan Province, China. Front. Microbiol. 2022, 13, 1035434. [Google Scholar] [CrossRef] [PubMed]
  38. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
  39. Rani, A.K.; Hina, S.; Iqbal, H.; Shabbir, Z.; Izhar, A.; Usman, M.; Khalid, A.N. Identification and taxonomic position of a new Pseudoomphalina species from Pakistan based on light, scanning electron microscopy, and molecular analysis. Microsc. Res. Tech. 2023, 86, 1144–1153. [Google Scholar] [CrossRef]
  40. Nguyen, L.T.; Schmidt, H.; von Haeseler, A.; Minh, B. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2014, 32, 268–274. [Google Scholar] [CrossRef]
  41. Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast Approximation for Phylogenetic Bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
  42. Hughes, S.J. Conidiophores, conidia, and classification. Can. J. Bot. 2011, 31, 577–659. [Google Scholar] [CrossRef]
  43. Zeng, Q.; Lv, Y.C.; Xu, X.L.; Deng, Y.; Wang, F.H.; Liu, S.Y.; Liu, L.J.; Yang, C.J.; Liu, Y.G. Morpho-Molecular Characterization of Microfungi Associated with Phyllostachys (Poaceae) in Sichuan, China. J. Fungi 2022, 8, 702. [Google Scholar] [CrossRef] [PubMed]
  44. Crous, P.W.; Groenewald, J.Z. A phylogenetic re-evaluation of Athrinium. IMA Fungus 2013, 4, 133–154. [Google Scholar] [CrossRef] [PubMed]
  45. Alves-Silva, G.; Drechsler-Santos, E.R.; da Silveira, R.M. Bambusicolous Fomitiporia revisited: Multilocus phylogeny reveals a clade of host-exclusive species. Mycologia 2020, 112, 633–648. [Google Scholar] [CrossRef] [PubMed]
Figure 1. ML tree generated from combined ITS, LSU, rpb1, and tef1-α sequence data of Magnaporthaceae and Pyriculariaceae. The maximum likelihood (ML) bootstrap support values and Bayesian posterior probabilities (BYPP) bootstrap support values above 70% and 0.90 are shown at the first and second position. Species with sequences obtained in this study are in boldface and newly generated sequences were indicated in red. Ophioceras dolichostomum (CBS 114926) and O.leptosporum (CBS894.70) (Ophioceraceae) were used as the outgroup. Yellow-green strips represent different neighboring species.
Figure 1. ML tree generated from combined ITS, LSU, rpb1, and tef1-α sequence data of Magnaporthaceae and Pyriculariaceae. The maximum likelihood (ML) bootstrap support values and Bayesian posterior probabilities (BYPP) bootstrap support values above 70% and 0.90 are shown at the first and second position. Species with sequences obtained in this study are in boldface and newly generated sequences were indicated in red. Ophioceras dolichostomum (CBS 114926) and O.leptosporum (CBS894.70) (Ophioceraceae) were used as the outgroup. Yellow-green strips represent different neighboring species.
Jof 10 00454 g001
Figure 2. Phylogram of Apiospora based on combined ITS, LSU, tef1-α, and tub2 genes. ML bootstrap support values (ML-BS ≥ 70%) and Bayesian posterior probability (BYPP ≥ 0.90) are shown as first and second position above nodes, respectively. Strains from this study are shown in red. Some branches were shortened according to the indicated multipliers.
Figure 2. Phylogram of Apiospora based on combined ITS, LSU, tef1-α, and tub2 genes. ML bootstrap support values (ML-BS ≥ 70%) and Bayesian posterior probability (BYPP ≥ 0.90) are shown as first and second position above nodes, respectively. Strains from this study are shown in red. Some branches were shortened according to the indicated multipliers.
Jof 10 00454 g002
Figure 3. Bifusisporella fujianensis (HMAS 352712). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d) Upper and reverse view of colony after incubation for 14 days on SNA (containing pine needle). (e,f) Conidiomata sporulating on PDA. (g,h) Conidiogenous cells and conidia. (ik) Conidia. Scalebar = 10 µm (gk).
Figure 3. Bifusisporella fujianensis (HMAS 352712). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d) Upper and reverse view of colony after incubation for 14 days on SNA (containing pine needle). (e,f) Conidiomata sporulating on PDA. (g,h) Conidiogenous cells and conidia. (ik) Conidia. Scalebar = 10 µm (gk).
Jof 10 00454 g003
Figure 4. Bifusisporella bambooensis (HMAS 352714). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d) Upper and reverse view of colony after incubation for 14 days on SNA (containing pine needle). (e,f) Conidiomata sporulating on PDA. (g,h) Conidiogenous cells and conidia.(i,j) Conidia. Scalebar = 10 µm (gj).
Figure 4. Bifusisporella bambooensis (HMAS 352714). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d) Upper and reverse view of colony after incubation for 14 days on SNA (containing pine needle). (e,f) Conidiomata sporulating on PDA. (g,h) Conidiogenous cells and conidia.(i,j) Conidia. Scalebar = 10 µm (gj).
Jof 10 00454 g004
Figure 5. Apiospora fujianensis (HMAS 352716). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d,e) Conidiomata sporulating on PDA. (fj) Conidiogenous cells and conidia. (k) Conidia. Scale bars = 10 µm (fk).
Figure 5. Apiospora fujianensis (HMAS 352716). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d,e) Conidiomata sporulating on PDA. (fj) Conidiogenous cells and conidia. (k) Conidia. Scale bars = 10 µm (fk).
Jof 10 00454 g005
Figure 6. Apiospora fuzhouensis (HMAS 352718). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d,e) Conidiomata sporulating on PDA. (fi) Conidiogenous cells and conidia. (j,k) Conidia. Scale bars = 10 µm (fk).
Figure 6. Apiospora fuzhouensis (HMAS 352718). (a) Leaves of host plant. (b,c) Upper and reverse view of colony after incubation for 7 days on PDA and 14 days. (d,e) Conidiomata sporulating on PDA. (fi) Conidiogenous cells and conidia. (j,k) Conidia. Scale bars = 10 µm (fk).
Jof 10 00454 g006
Table 1. The primer sequences and programs in this study.
Table 1. The primer sequences and programs in this study.
LocusPrimersSequence (5′–3′)PCR CyclesReferences
ITSITS5GGA AGT AAA AGT CGT AAC AAG G(95 °C: 30 s, 55 °C: 30 s, 72 °C: 1 min) × 35 cycles[28]
ITS4TCCTCCGCTTATTGATATGC
LSULRORGTACCC GCTGAACTTAAGC(95 °C: 30 s, 52 °C: 30 s, 72 °C: 1 min) × 35 cycles[29]
LR5TCCTGAGGGAAACTTCG
rpb1fRPB1-AcGAR TGY CCD GGD CAY TTY GG(95 °C: 30 s, From 57 °C to 72 °C at 0.2 °C/s:30 s, 72 °C: 1 min) × 35 cycles[30,31]
fRPB1-CrCCNGCDATNTCRTTRTCCATRTA
tef1-αEF1-983FGCYCCYGGHCAYCGTGAYTT(95 °C: 30 s, 57/52 °C: 30 s, 72 °C: 1 min) × 35 cycles[32]
EF1-2218RATGACACCRACRGCRACRGTYTGYAT
EF1-728FCATCGAGAAGTTCGAGAAGG(95°C: 30 s, 51 °C: 30 s, 72 °C: 1 min) × 35 cycles[33]
EF-2GGARGTACCAGTSATCATGTT
tub2Bt2aGGTAACCAAATCGGT GCTGCT TTC(95 °C: 30 s, 56 °C: 30 s, 72 °C: 1 min) × 35 cycles[34]
Bt2bACCCTCAGTGTAGTGACCCTTGGC
Table 2. Species names, voucher or culture codes, hosts or substrate, locations, and corresponding GenBank accession numbers of DNA sequences used in this study.
Table 2. Species names, voucher or culture codes, hosts or substrate, locations, and corresponding GenBank accession numbers of DNA sequences used in this study.
SpeciesCulture/VoucherHost/SubstrateCountryGenBank Accession Number
ITSLSUtef1-atub2rpb1
Barretomyces calatheaeCBS 129274 = CPC 18464Calathea longifoliaBrazilKM484831KM484950--KM485045
Bambusicularia brunneaCBS 133599Sasa sp.JapanKM484830KM484948--KM485043
Bambusicularia brunneaCBS 133600Phyllostachys bambusoidesJapanAB274436KM484949--KM485044
Bifusisporella bambooensisCGMCC3.25653Bambusoideae sp.ChinaPP159031PP159039PP488459-PP488463
Bifusisporella bambooensisCGMCC3.27207Bambusoideae sp.ChinaPP477445PP477439PP488461-PP488465
Bifusisporella fujianensisCGMCC3.25651Bambusoideae sp.ChinaPP159030PP159038PP488458-PP488462
Bifusisporella fujianensisCGMCC3.27206Bambusoideae sp.ChinaPP477444PP477438PP488460-PP488464
Bifusisporella sorghiURM 7442Sorghum bicolorendophyteBrazilMK060155MK060153MK060157-MK060159
Bifusisporella sorghiURM 7864Sorghum bicolorendophyteBrazilMK060156MK060154MK060158-MK060160
Bifusisporella sichuanensisSICAUCC 22-0073Phyllostachys edulisChinaON227097ON227101ON244427-ON244428
Bussabanomyces longisporusCBS 125232Amomum siamense, leavesThailandKM484832KM484951KM009202-KM485046
Buergenerula spartinaeATCC 22848Spartina alterniflora, leavesUSAJX134666DQ341492JX134692-JX134720
Falciphora oryzaeCBS 125863= R5-6-lOryza sativa, root, endophyteChinaEU636699KJ026705JN857963-KJ026706
Falciphoriella solaniterrestrisCBS 117.83Soil in potato fieldNetherlandsKM484842KM484959--KM485058
Gaeumannomycella graminisCPC 26020 = CBS 141384Cynodon dactylon × C. transvaalensisUSAKX306498KX306568KX306701-KX306633
Gaeumannomycella graminicolaCPC 26025 = CBS 141381Stenotaphrum secundatumUSAKX306495KX306565KX306698-KX306630
Gaeumannomycella caricisCPC 26262 = CBS 141374Carex rostrataUKKX306478KX306548KX306675-KX306671
Gaeumannomycella caricisCBS 388.81Carex rostrataUKKM484843KM484960KX306674--
Gaeumannomyces floridanusCPC 26037 Stenotaphrum secundatumUSAKX306491KX306561KX306693-KX306626
Gaeumannomyces fusiformisCPC 26068 Oryza sativaUSAKX306492KX306562KX306694-KX306627
Gaeumannomyces glycinicolaCPC 26266Glycine maxUSAKX306494KX306564KX306696-KX306629
Gaeumannomyces glycinicolaCPC 26057Glycine maxUSAKX306493KX306563KX306695-KX306628
Gaeumannomyces graminicolaCBS 352.93 --KM484834DQ341496KX306697-KM485050
Gaeumannomyces graminisCPC 26045Cynodon dactylon × C. transvaalensis-KX306505KX306575KX306708-KX306640
Gaeumannomyces graminis var. graminisM33--JF710374JF414896JF710411-JF710442
Gaeumannomyces graminis var. graminisM54--JF414848JF414898JF710419-JF710444
Gaeumannomyces hyphopodioidesCBS 350.77Zea mays, rootUKKX306506KX306576---
Gaeumannomyces hyphopodioidesCBS 541.86Triticum aestivum, seedlingGermanyKX306507KX306577KX306709--
Gaeumannomyces oryzicolaCPC 26063Oryza sativaUSAKX306516KX306586KX306717-KX306646
Gaeumannomyces oryzinusCPC 26030Cynodon dactylon × C. transvaalensisBahamasKX306517KX306587KX306718-KX306647
Gaeumannomyces radicicolaCBS 296.53-CanadaKM009170KM009158KM009206-KM009194
Gaeumannomyces setariicolaCPC 26059Setaria italicaSouth AfricaKX306524KX306594KX306725-KX306654
Gaeumannomyces triticiCBS 273.36Triticum aestivumArgentinaKX306525KX306595KX306729-KX306655
Gaeumannomyces walkeriCPC 26028 Stenotaphrum secundatumUSAKX306543KX306613KX306746-KX306670
Gaeumannomyces wongoonooBRIP:60376Stenotaphrum secundatumAustraliaKP162137KP162146---
Kohlmeyeriopsis medullarisCBS 117849 = JK5528SJuncus roemerianusUSAKM484852KM484968--KM485068
Macgarvieomyces borealisCBS 461.65Juncus effiisus, leaf spotsUKMH858669DQ341511KM009198-KM485070
Macgarvieomyces juncicolaCBS 610.82Juncus effiisus, stem baseThe NetherlandsKM484855KM484970KM009201-KM485071
Magnaporthaceae, incertaesedisCPC 26284 = GP57Triticum aestivumUKKX306546KX306616KX306677--
Magnaporthiopsissp.CPC 26038Cynodon dactylon × C. transvaalensisUSAKX306545-KX306676-KX306672
Magnaporthiopsis incrustansM35--JF414843JF414892--JF710437
Magnaporthiopsis maydisCBS 133165 = ATCC MYA-3356ZeamaysIsraelKX306544KX306614---
Magnaporthiopsis maydisCBS 662.82AZeamaysEgyptKM484856KM484971--KM485072
Magnaporthiopsis cynodontisRS7-2 = CBS 141700ultradwarf bermudagrass rootsUSAKJ855508KM401648KP282714-KP268930
Magnaporthiopsis cynodontisRS5-5rootsUSAKJ855506KM401646KP282712-KP268928
Magnaporthiopsis cynodontisRS3-1rootsUSAKJ855505KM401645KP282711-KP268927
Magnaporthiopsis meyeri-festucaeFF2--MF178146MF178151MF178167-MF178162
Magnaporthiopsis meyeri-festucaeSCR11--MF178150MF178155MF178171-MF178166
Magnaporthiopsis panicorumCM2S8--KF689643KF689633KF689623-KF689613
Magnaporthiopsis panicorumCM10s2--KF689644KF689634KF689624-KF689614
Magnaporthiopsis rhizophilaM22--JF414833JF414882JF710407-JF710431
Nakataeasp.CBS 332.53Oryza sativaUSAKM484867KM484981--KM485083
Nakataea oryzaeCBS 252.34Oryza sativaBurmaKM484862KM484976--KM485078
Nakataea oryzaeCBS 288.52Oryza sativa, stemJapanKM484864KM484978--KM485080
Neogaeumannomyces bambusicolaMFLUCC11-0390Dead culm of bamboo (Bambusae)ThailandKP744449KP744492---
Neopyricularia commelinicolaCBS 128307 = KACC 44083Commelina communis, leavesKoreaFJ850125KM484984KM009199-KM485086
Neopyricularia commelinicolaCBS 128308Commelina communis, leavesKoreaFJ850122KM484985--KM485087
Omnidemptus affinisATCC 200212Panicum effiisum var. effiisum grass leavesAustraliaJX134674KX134686JX134700-JX134728
Ophioceras dolichostomumCBS 114926 = HKUCC 3936 = KM 8WoodChinaJX134677JX134689JX134703-JX134731
Ophioceras leptosporumCBS 894.70 = ATCC 24161 = HME 2955Dead stem of dicot plant (probably Urtica dioicd)UKJX134678JX134690JX134704-JX134732
Proxipyricularia zingiberisCBS 132355Zingiber miogaJapanAB274433KM484987--KM485090
Proxipyricularia zingiberisCBS 133594Zingiber miogaJapanAB274434KM484988--KM485091
Pseudoph ialophora eragrostisCM12m9Eragrostis sp.USAKF689648KF689638KF689628-KF689618
Pseudopyricularia cyperiCBS 133595Cyperus iriaJapanKM484872KM484990--AB818013
Pseudopyricularia kyllingaeCBS 133597Kyllinga brevifoliaJapanKM484876KM484992KT950880-KM485096
Pyricularia griseaBR0029Digitaria sanguinalisBrazilKM484880KM484995--KM485100
Pyricularia griseaCR0024Lolium perenneKoreaKM484882KM484997--KM485102
Pyricularia ctenantheicolaGR0001 = Ct-4 = ATCC 200218Ctenanthe oppenheimianaGreeceKM484878KM484994 -KM485098
Pyricularia oryzaeCBS 365.52 = MUCL 9451-JapanKM484890KM485000--KM485110
Slopeiomyces cylindrosporusCBS 609.75Grass root, associated with Phialophora graminicolaUKKM484944KM485040JX134693-KM485158
Utrechtiana cibiessiaCBS 128780 = CPC 18916Phragmites australis, leavesNetherlandsJF951153JF951176--KM485047
Xenopyricularia zizaniicolaCBS 132356Zizania latifoliaJapanKM484946KM485042KM009203-KM485160
Apiospora acutiapicaKUMCC 20-0209--MT946342MT946338MT947359MT947365-
Apiospora acutiapicaKUMCC 20-0210Bambusa bambosChina-MT946339MT947360MT947366-
Apiospora agariKUC 21333Agarum cribrosumKorea-MH498440MH544663MH498478-
Apiospora aquaticaMFLU 18-1628Submerged woodChinaMK828608MK835806---
Apiospora arctoscopiKUC 21331Egg of Arctoscopus japonicusKorea-MH498449MN868918MH498487-
Apiospora arctoscopiKUC 21344--MH498528-MN868919MH498486-
Apiospora arctoscopiKUC 21347--MH498525-MN868922MH498483-
Apiospora arundinisCBS 114316Hordeum vulgareIranKF144884KF144928KF145016KF144974-
Apiospora arundinisCBS 106.12--KF144883KF144927KF145015KF144973-
Apiospora arundinisCBS 732.71--KF144889KF144934KF145022KF144980-
Apiospora aureaCBS 244.83AirSpainAB220251KF144935KF145023KF144981-
Apiospora balearicaCBS 145129PoaceaeSpainMK014869MK014836MK017946MK017975-
Apiospora neobambusaeHMAS LC7106--KY494718KY494794KY806204KY705186-
Apiospora bambusicolaMFLUCC20-0144Schizostachyum brachycladumThailandMW173030MW173087MW183262--
Apiospora biserialisCGMCC 3.20135Bambusoideae sp.ChinaMW481708MW478885MW522938MW522955-
Apiospora camelliae-sinensisLC5007Camellia sinensisChinaKY494704KY494780KY705103KY705173-
Apiospora camelliae-sinensisLC8181--KY494761KY494837KY705157KY705229-
Apiospora chiangraienseMFLU 21-0046--MZ542520MZ542524-MZ546409-
Apiospora chromolaenaeMFLUCC 17-1505Chromolaena odorataThailandMT214342MT214436MT235802--
Apiospora cordylinesGUCC 10027--MT040106-MT040127MT040148-
Apiospora cyclobalanopsidisCGMCC 3.20136Cyclobalanopsis glaucaChinaMW481713MW478892MW522945MW522962-
Apiospora cyclobalanopsidisGZCC:20-0103--MW481714-MW522946MW522963-
Apiospora descalsiiCBS 145130Ampelodesmos mauritanicusSpainMK014870MK014837MK017947MK017976-
Apiospora dichotomanthiCGMCC 3.18332Dichotomanthes tristaniiaecarpaChinaKY494697KY494773KY705096KY705167-
Apiospora esporlensisCBS 145136Phyllostachys aureaSpainMK014878MK014845MK017954MK017983-
Apiospora esporlensis18TJAM004--MT856406-MT881953MT881991-
Apiospora euphorbiaeIMI 285638bBambusoideae sp.BangladeshAB220241AB220335-AB220288-
Apiospora euphorbiaeZHKUCC 22-0001--OM728647OM486971OM543543OM543544-
Apiospora fermentiKUC 21289--MF615226-MH544667MF615231-
Apiospora fermentiKUC 21288--MF615230-MH544668MF615235-
Apiospora fujianensisCGMCC3.25647Bambusoideae sp.ChinaPP159026PP159034PP488454PP488470-
Apiospora fujianensisCGMCC3.25648Bambusoideae sp.ChinaPP159027PP159035PP488455PP488471-
Apiospora fuzhouensisCGMCC3.25649Bambusoideae sp.ChinaPP159028PP159036PP488456PP488468-
Apiospora fuzhouensisCGMCC3.25650Bambusoideae sp.ChinaPP159029PP159037PP488457PP488469-
Apiospora gaoyouensisCFCC52301Phragmites australisChinaMH197124-MH236793MH236789-
Apiospora garethjonesiiJHB004Culms of dead bambooChinaKY356086KY356091---
Apiospora garethjonesiiSICAUCC 22-0028--ON228606ON228662-ON237654-
Apiospora garethjonesiiSICAUCC 22-0027--ON228603ON228659-ON237651-
Apiospora gelatinosaHKAS 111962Culms of dead bambooChinaMW481706MW478888MW522941MW522958-
Apiospora guiyangensisHKAS 102403Dead culms of PoaceaeChinaMW240647MW240577MW759535MW775604-
Apiospora guizhouensisCGMCC 3.18334Air in karst caveChinaKY494709KY494785KY705108KY705178-
Apiospora guizhouensisKUMCC 20-0206--MT946347MT946341MT947364MT947370-
Apiospora hainanensisSAUCC 1681Leaf of bambooChinaOP563373OP572422OP573262OP573268-
Apiospora hispanicaIMI 326877Maritime sandSpainAB220242AB220336-AB220289-
Apiospora hydeiCBS 114990Bambusoideae sp.ChinaKF144890KF144936KF145024KF144982-
Apiospora hydeiLC 7103--KY494715KY494791KY705114KY705183-
Apiospora hyphopodiiSICAUCC 22-0034--ON228605ON228661-ON237653-
Apiospora hysterinaICMP 6889Bambusoideae sp.New ZealandMK014874MK014841MK017951MK017980-
Apiospora hysterinaKUC21438--ON764019ON787758ON806623ON806633-
Apiospora ibericaCBS 145137Arundo donaxPortugalMK014879MK014846MK017955MK017984-
Apiospora intestiniCBS 135835Gut of grasshopperIndiaKR011352KR149063KR011351KR011350-
Apiospora intestiniMFLU:21-0045--MZ542521MZ542525MZ546406MZ546410-
Apiospora italicaAP29118--MK014881MK014848MK017957MK017986-
Apiospora jatrophaeCBS 134262Jatropha podagricaIndiaJQ246355----
Apiospora jiangxiensisCGMCC 3.18381Maesa sp.ChinaKY494693KY494769KY705092KY705163-
Apiospora jiangxiensisSICAU 22-0070--ON227094ON227098ON244431ON244432-
Apiospora kogelbergensisCBS 113332Cannomois virgataSouth AfricaKF144891KF144937KF145025KF144983-
Apiospora kogelbergensisCBS 117206--KF144895KF144941KF145029KF144987-
Apiospora koreanaKUC 21332Egg of Arctoscopus japonicusKoreaMH498524-MH544664MH498482-
Apiospora koreanaKUC21350--MH498521-MN868929MH498479-
Apiospora locuta-pollinisLC11683Brassica campestrisChinaMF939595-MF939616MF939622-
Apiospora locuta-pollinisKUNCC:22-12409--OP377737OP377744OP381091--
Apiospora longistromaMFLU 15-1184Culms of decaying bambooThailandKU940141KU863129---
Apiospora malaysianaCBS 102053Macaranga hullettiiMalaysiaKF144896KF144942KF145030KF144988-
Apiospora malaysianaCBS:251.29--KF144897KF144943KF145031KF144989-
Apiospora marianiaeAP18219Dead stems of Phleum pratenseSpainON692406ON692422ON677180ON677186-
Apiospora mariiCBS 497.90AirSpainMH873913KF144947KF145035KF144993-
Apiospora mariiCBS 200.57--KF144900KF144946KF145034KF144992-
Apiospora marinaKUC 21328SeaweedKoreaMH498538MH498458MH544669MH498496-
Apiospora mediterraneaIMI 326875AirSpainAB220243AB220337-AB220290-
Apiospora minutispora17E 042SoilKoreaLC517882-LC518889LC518888-
Apiospora montagneiLSU0093--MT000394MT000490---
Apiospora moriMFLU 18-2514Dead leaves of Morus australisChinaMW114313MW114393---
Apiospora moriNCYU 19-0364--MW114314MW114394---
Apiospora mukdahanensisMFLUCC 22-0056--OP377735OP377742OP381089--
Apiospora multiloculataMFLUCC 21-0023Dead culms of BambusaeThailandOL873137OL873138-OL874718-
Apiospora mytilomorphaDAOM 214595Dead blades of Andropogon sp.IndiaKY494685----
Apiospora neobambusaeLC7124--KY494727KY494803KY806206KY705195-
Apiospora neochinenseCFCC 53036Fargesia qinlingensisChinaMK819291-MK818545MK818547-
Apiospora neogarethjonesiiHKAS 102408Dead culms of BambusaeChinaMK070897MK070898---
Apiospora neosubglobosaSICAUCC 22-0039--ON228614ON228670-ON237662-
Apiospora obovataCGMCC 3.18331Lithocarpus sp.ChinaKY494696KY494772KY705095KY705166-
Apiospora obovataLC8177--KY494757KY494833KY705153KY705225-
Apiospora ovataCBS 115042Arundinaria hindsiiChinaKF144903KF144950KF145037KF144995-
Apiospora paraphaeospermaMFLUCC13-0644Dead clumps of Bambusa sp.ThailandKX822128KX822124---
Apiospora phragmitisCBS 135458Phragmites australisItalyKF144909KF144956KF145043KF145001-
Apiospora phragmitisAP29717A--MK014892MK014859MK017968MK017997-
Apiospora phyllostachydisMFLUCC 18-1101Phyllostachys heterocladaChinaMK351842MH368077MK340918MK291949-
Apiospora piptatheriCBS 145149Piptatherum miliaceumSpainMK014893MK014860---
Apiospora piptatheriKUC21279--MF615229-MH544671MF615234-
Apiospora pseudoparenchymaticaCGMCC 3.18336Bambusoideae sp.ChinaKY494743-KY705139KY705211-
Apiospora pseudorasikravindraeKUMCC 20-0208--MT946344-MT947361MT947367-
Apiospora pseudorasikravindraeKUMCC 20-0211--MT946345-MT947362MT947368-
Apiospora pseudosinensisCPC 21546Leaf of bambooThe NetherlandsKF144910KF144957KF145044MN868936-
Apiospora pseudospegazziniiCBS 102052Macaranga hullettiiMalaysiaKF144911KF144958KF145045KF145002-
Apiospora pterospermaCBS 134000Machaerina sinclairiiAustraliaKF144913KF144960KF145046KF145004-
Apiospora pusillispermaKUC 21321SeaweedKoreaMH498533MH498453MN868930MH498491-
Apiospora qinlingensisCFCC 52303Fargesia qinlingensisChinaMH197120-MH236795MH236791-
Apiospora rasikravindraeLC5449Soil in karst caveChinaKY494713KY494789KY705112KY705182-
Apiospora rasikravindraeAP10418--MK014896MK014863-MK017999-
Apiospora sacchariCBS 212.30Phragmites australisUKKF144916KF144962KF145047KF145005-
Apiospora sacchariCBS:664.74--KF144919KF144965KF145050KF145008-
Apiospora saccharicolaCBS 191.73AirThe NetherlandsKF144920KF144966KF145051KF145009-
Apiospora sargassiKUC 21228Sargassum fulvellumKoreaKT207746-MH544677KT207644-
Apiospora sasaeCBS 146808Dead culms of Sasa veitchiiThe NetherlandsMW883402MW883797MW890104MW890120-
Apiospora septataCGMCC 3.20134Bambusoideae sp.ChinaMW481711MW478890MW522943MW522960-
Apiospora serenensisIMI 326869-SpainAB220250AB220344-AB220297-
Apiospora serenensisATCC 76309--AB220240AB220334-AB220287-
Apiospora setariaeCFCC 54041Decaying culms of Setaria viridisChinaMT492004----
Apiospora setostromaKUMCC 19-0217Dead branches of bambooChinaMN528012MN528011MN527357--
Apiospora sichuanensisHKAS 107008Dead culms of PoaceaeChinaMW240648MW240578MW759536MW775605-
Apiospora sorghiURMBRA 9300Sorghum bicolorBrazilMK371706--MK348526-
Apiospora sphaerospermaCBS114314Leaf of Hordeum vulgareIranKF144904KF144951KF145038KF144996-
Apiospora sphaerospermaCBS 142.55--KF144908KF144955KF145042AB220303-
Apiospora stipaeCBS 146804Stipa giganteaSpainMW883403.1MW883798.1-MW890121.1-
Apiospora subglobosaMFLUCC 11-0397Dead culms of bambooThailandKR069112KR069113---
Apiospora subroseaCGMCC 3.18337Bambusoideae sp.ChinaKY494752KY494828KY705148KY705220-
Apiospora subroseaLC 7291--KY494751KY494827KY705147KY705219-
Apiospora taeanensisKUC 21322SeaweedKoreaMH498515-MH544662MH498473-
Apiospora taeanensisKUC 21359--MH498513-MN868935MH498471-
Apiospora thailandicaMFLUCC 15-0202--KU940145KU863133---
Apiospora thailandicaMFLUCC 15-0199--KU940146KU863134---
Apiospora tropicaMFLUCC 21–0056--OK491657OK491653-OK560922-
Apiospora vietnamensisIMI 99670Citrus sinensisVietnamKX986096KX986111-KY019466-
Apiospora xenocordellaCBS 478.86Soil from roadwayZimbabweKF144925KF144970KF145055KF145013-
Apiospora xenocordellaLC3486--KY494687KY494763KY705086KY705158-
Apiospora yunnanaMFLUCC 150002Culms of Decaying bambooChinaKU940147KU863135---
Apiospora yunnanaSICAU 22-0072--ON227096ON227100ON244425ON244426-
Notes: newly generated sequences are in bold.
Table 3. The location, hosts or substrate, and main morphological characters of Bifusisporella.
Table 3. The location, hosts or substrate, and main morphological characters of Bifusisporella.
SpeciesLocationHost/SubstrateConidiogenous Cells Size of
Conidiophore Cells (µm)
ConidiaSize of
Conidia (µm)
References
Bifusisporella bambooensis sp. nov.ChinaBambusoideae sp.Cylindrical 7.2–21.0 × 4.2–6.4falcate or curved moon-shaped10.8–45.0 × 2.8–4.9In this study
Bifusisporella sorghiBrazilSorghum bicolorCylindrical orclavate5.0–19.5 × 3.0–4.0falcateMacroconidia
19.0–34.0 × 3.0–4.0
Microconidia
7.0–14.5 × 1.0–2.0
[15]
Bifusisporella fujianensis sp. nov.ChinaBambusoideae sp.Cylindricalor rod-shaped8.9–14.3 × 5.8–8.1falcate or curved moon-shaped37.3–56.3 × 3.6–5.7In this study
Bifusisporella sichuanensisChinaPhyllostachys edulis----[43]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, Z.; Mu, T.; Keyhani, N.O.; Pu, H.; Lin, Y.; Lv, Z.; Xiong, J.; Chen, X.; Zhan, X.; Lv, H.; et al. Diversity and New Species of Ascomycota from Bamboo in China. J. Fungi 2024, 10, 454. https://doi.org/10.3390/jof10070454

AMA Style

Zhao Z, Mu T, Keyhani NO, Pu H, Lin Y, Lv Z, Xiong J, Chen X, Zhan X, Lv H, et al. Diversity and New Species of Ascomycota from Bamboo in China. Journal of Fungi. 2024; 10(7):454. https://doi.org/10.3390/jof10070454

Chicago/Turabian Style

Zhao, Zhiying, Taichang Mu, Nemat O. Keyhani, Huili Pu, Yongsheng Lin, Ziying Lv, Jinming Xiong, Xiaohao Chen, Xinyang Zhan, Huajun Lv, and et al. 2024. "Diversity and New Species of Ascomycota from Bamboo in China" Journal of Fungi 10, no. 7: 454. https://doi.org/10.3390/jof10070454

APA Style

Zhao, Z., Mu, T., Keyhani, N. O., Pu, H., Lin, Y., Lv, Z., Xiong, J., Chen, X., Zhan, X., Lv, H., Jibola-Shittu, M. Y., Jia, P., Wu, J., Huang, S., Qiu, J., & Guan, X. (2024). Diversity and New Species of Ascomycota from Bamboo in China. Journal of Fungi, 10(7), 454. https://doi.org/10.3390/jof10070454

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop