Diversity and New Species of Ascomycota from Bamboo in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Isolates and Morphology
2.2. DNA Extraction, PCR Amplification, and Sequencing
2.3. Phylogenetic Analyses
3. Results
3.1. Phylogenetic Analyses
3.2. Taxonomy
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Manandhar, R.; Kim, J.H.; Kim, J.T. Environmental, social and economic sustainability of bamboo and bamboo-based construction materials in buildings. J. Asian Archit. Build. Eng. 2019, 18, 49–59. [Google Scholar] [CrossRef]
- Binfield, L.; Britton, T.L.; Dai, C.; Innes, J. Evidence on the social, economic, and environmental impact of interventions that facilitate bamboo industry development for sustainable livelihoods: A systematic map protocol. Environ. Evid. 2022, 11, 33. [Google Scholar] [CrossRef]
- Liu, W.Y.; Hui, C.M.; Wang, F.; Wang, M.; Liu, G.L. Review of the Resources and Utilization of Bamboo in China. Bamboo Curr. Future Prospect. 2018, 8, 133–142. [Google Scholar] [CrossRef]
- Dlamini, L.C.; Fakudze, S.; Makombe, G.G.; Muse, S.; Zhu, J. Bamboo as a valuable resource and its utilization in historical and modern-day China. BioResources 2022, 17, 1926–1938. [Google Scholar] [CrossRef]
- Jiang, H.B.; Phookamsak, R.; Hongsanan, S.; Bhat, D.J.; Mortimer, P.E.; Suwannarach, N.; Kakumyan, P.; Xu, J. A review of bambusicolous Ascomycota in China with an emphasis on species richness in southwest China. Stud. Fungi 2022, 7, 20. [Google Scholar] [CrossRef]
- Yu, X.D.; Zhang, S.N.; Liu, J.K. Additions to Bambusicolous Fungi of Savoryellaceae from Southwest China. J. Fungi 2023, 9, 571. [Google Scholar] [CrossRef]
- Thongkantha, S.; Jeewon, R.; Dhanasekaran, V.; Lumyong, S.; McKenzie, E.; Hyde, K. Molecular phylogeny of Magnaporthaceae (Sordariomycetes) with a new species, Ophioceras chiangdaoense from Dracaena loureiroi in Thailand. Fungal Divers. 2009, 34, 157–173. [Google Scholar]
- Luo, J.; Zhang, N. Magnaporthiopsis, a new genus in Magnaporthaceae (Ascomycota). Mycologia 2013, 105, 1019–1029. [Google Scholar] [CrossRef] [PubMed]
- Klaubauf, S.; Tharreau, D.; Fournier, E.; Groenewald, J.Z.; Crous, P.W.; Vries, R.P.; Lebrun, M. Resolving the polyphyletic nature of Pyricularia (Pyriculariaceae). Stud. Mycol. 2014, 79, 85–120. [Google Scholar] [CrossRef]
- Luo, J.; Walsh, E.; Zhang, N. Four new species in Magnaporthaceae from grass roots in New Jersey Pine Barrens. Mycologia 2014, 106, 580–588. [Google Scholar] [CrossRef]
- Luo, J.; Walsh, E.; Zhang, N. Toward monophyletic generic concepts in Magnaporthales: Species with Harpophora asexual states. Mycologia 2015, 107, 641–646. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.K.; Hyde, K.D.; Jones, E.B.G.; Ariyawansa, H.A.; Bhat, D.J.; Boonmee, S.; Maharachchikumbura, S.S.N.; McKenzie, E.H.C.; Phookamsak, R.; Phukhamsakda, C.; et al. Fungal diversity notes 1–110: Taxonomic and phylogenetic contributions to fungal species. Fungal Divers. 2015, 72, 1–197. [Google Scholar] [CrossRef]
- Crous, P.W.; Wingfield, M.; Guarro, J.; Hernández-Restrepo, M.; Sutton, D.; Acharya, K.; Barber, P.; Boekhout, T.; Dimitrov, R.; Dueñas, M.; et al. Fungal Planet description sheets: 320–370. Persoonia 2015, 34, 167–266. [Google Scholar] [CrossRef] [PubMed]
- Hernández-Restrepo, M.; Groenewald, M.; Elliott, M.L.; Canning, G.; McMillan, V.; Crous, P.W. Take-all or nothing. Stud. Mycol. 2016, 83, 19–48. [Google Scholar] [CrossRef] [PubMed]
- Silva, R.M.F.; Oliveira, R.J.V.; Bezerra, J.D.P.; Bezerra, J.L.; Souza-Motta, C.M.; Silva, G.A. Bifusisporella sorghi gen. et sp. nov. (Magnaporthaceae) to accommodate an endophytic fungus from Brazil. Mycol. Prog. 2019, 18, 847–854. [Google Scholar] [CrossRef]
- Pintos, Á.; Alvarado, P. New studies on Apiospora (Amphisphaeriales, Apiosporaceae): Epitypification of Sphaeria apiospora, proposal of Ap. marianiae sp. nov. and description of the asexual morph of Ap. sichuanensis. MycoKeys 2022, 92, 63–78. [Google Scholar] [CrossRef] [PubMed]
- Liao, C.F.; Senanayake, I.C.; Dong, W.; Thilini Chethana, K.W.; Tangtrakulwanich, K.; Zhang, Y.X.; Doilom, M.K. Taxonomic and Phylogenetic Updates on Apiospora: Introducing Four New Species from Wurfbainia villosa and Grasses in China. J. Fungi 2023, 9, 1087. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.Y.; Li, D.H.; Zhang, Z.X.; Liu, S.B.; Liu, X.Y.; Wang, Y.X.; Zhao, H.; Liu, X.Y.; Zhang, X.G.; Xia, J.W.; et al. Morphological and phylogenetic analyses reveal two new species and a new record of Apiospora (Amphisphaeriales, Apiosporaceae) in China. MycoKeys 2023, 95, 27–45. [Google Scholar] [CrossRef] [PubMed]
- Pintos, Á.; Alvarado, P. Phylogenetic delimitation of Apiospora and Arthrinium. Fungal Syst. Evol. 2021, 7, 197–221. [Google Scholar] [CrossRef]
- Kwon, S.L.; Cho, M.; Lee, Y.M.; Lee, H.; Kim, C.; Kim, G.H.; Kim, J.J. Diversity of the Bambusicolous Fungus Apiospora in Korea: Discovery of New Apiospora Species. Mycobiology 2022, 50, 302–316. [Google Scholar] [CrossRef]
- Hyde, K.D.; Frohlich, J.; Taylor, J.E. Fungi from palms. XXXVI. Reflections on unitunicate ascomycetes with apiospores. Sydowia 1998, 50, 21–80. [Google Scholar]
- Zhang, J.Y.; Chen, M.L.; Boonmee, S.; Wang, Y.X.; Lu, Y.Z. Four New Endophytic Apiospora Species Isolated from Three Dicranopteris Species in Guizhou, China. Fungal Divers. 2023, 9, 1096. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.G.; Karunarathna, S.C.; Mapook, A.; Promputtha, I.; Xu, J.C.; Bao, D.F.; Tibpromma, S. One New Species and Two New Host Records of Apiospora from Bamboo and Maize in Northern Thailand with Thirteen New Combinations. Life 2021, 11, 1071. [Google Scholar] [CrossRef] [PubMed]
- Su, D.; Zhang, W.H.; Sun, R.; Zhang, Z.T.; Lyu, G. First Report of Botryosphaeria dothidea Causing Leaf Spot on Kadsura coccinea in China. Plant Dis. 2021, 105, 2714. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.X.; Liu, X.Y.; Tao, M.F.; Liu, X.Y.; Xia, J.W.; Zhang, X.G.; Meng, Z. Taxonomy, Phylogeny, Divergence Time Estimation, and Biogeography of the Family Pseudoplagiostomataceae (Ascomycota, Diaporthales). J. Fungi 2023, 9, 82. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Zhu, M.; Keyhani, N.O.; Wu, Z.; Lv, H.; Heng, Z.; Chen, R.; Dang, Y.; Yang, C.; Chen, J.; et al. Three New Species of Russulaceae (Russulales, Basidiomycota) from Southern China. J. Fungi 2024, 10, 70. [Google Scholar] [CrossRef] [PubMed]
- Mu, T.; Chen, J.; Zhao, Z.; Zhang, W.; Stephenson, S.L.; Yang, C.; Zhu, M.; Su, H.; Liu, P.; Guan, X.; et al. Morphological and phylogenetic analyzes reveal two new species of Melanconiella from Fujian Province, China. Front. Microbiol. 2023, 14, 1229705. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing offungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef]
- Matheny, P.B.; Liu, Y.J.; Ammirati, J.F.; Hall, B.D. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). Am. J. Bot. 2002, 89, 688–698. [Google Scholar] [CrossRef]
- Castlebury, L.; Rossman, A.; Sung, G.; Hyten, A.; Spatafora, J. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol. Res. 2004, 108, 864–872. [Google Scholar] [CrossRef]
- Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Han, X.; Luo, Z.L.; Xian, L.; Tang, S.M.; Luo, H.M.; Niu, K.Y.; Su, X.J.; Li, S.H. Species diversity of Ganoderma (Ganodermataceae, Polyporales) with three new species and a key to Ganoderma in Yunnan Province, China. Front. Microbiol. 2022, 13, 1035434. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
- Rani, A.K.; Hina, S.; Iqbal, H.; Shabbir, Z.; Izhar, A.; Usman, M.; Khalid, A.N. Identification and taxonomic position of a new Pseudoomphalina species from Pakistan based on light, scanning electron microscopy, and molecular analysis. Microsc. Res. Tech. 2023, 86, 1144–1153. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.; von Haeseler, A.; Minh, B. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2014, 32, 268–274. [Google Scholar] [CrossRef]
- Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast Approximation for Phylogenetic Bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
- Hughes, S.J. Conidiophores, conidia, and classification. Can. J. Bot. 2011, 31, 577–659. [Google Scholar] [CrossRef]
- Zeng, Q.; Lv, Y.C.; Xu, X.L.; Deng, Y.; Wang, F.H.; Liu, S.Y.; Liu, L.J.; Yang, C.J.; Liu, Y.G. Morpho-Molecular Characterization of Microfungi Associated with Phyllostachys (Poaceae) in Sichuan, China. J. Fungi 2022, 8, 702. [Google Scholar] [CrossRef] [PubMed]
- Crous, P.W.; Groenewald, J.Z. A phylogenetic re-evaluation of Athrinium. IMA Fungus 2013, 4, 133–154. [Google Scholar] [CrossRef] [PubMed]
- Alves-Silva, G.; Drechsler-Santos, E.R.; da Silveira, R.M. Bambusicolous Fomitiporia revisited: Multilocus phylogeny reveals a clade of host-exclusive species. Mycologia 2020, 112, 633–648. [Google Scholar] [CrossRef] [PubMed]






| Locus | Primers | Sequence (5′–3′) | PCR Cycles | References |
|---|---|---|---|---|
| ITS | ITS5 | GGA AGT AAA AGT CGT AAC AAG G | (95 °C: 30 s, 55 °C: 30 s, 72 °C: 1 min) × 35 cycles | [28] |
| ITS4 | TCCTCCGCTTATTGATATGC | |||
| LSU | LROR | GTACCC GCTGAACTTAAGC | (95 °C: 30 s, 52 °C: 30 s, 72 °C: 1 min) × 35 cycles | [29] |
| LR5 | TCCTGAGGGAAACTTCG | |||
| rpb1 | fRPB1-Ac | GAR TGY CCD GGD CAY TTY GG | (95 °C: 30 s, From 57 °C to 72 °C at 0.2 °C/s:30 s, 72 °C: 1 min) × 35 cycles | [30,31] |
| fRPB1-Cr | CCNGCDATNTCRTTRTCCATRTA | |||
| tef1-α | EF1-983F | GCYCCYGGHCAYCGTGAYTT | (95 °C: 30 s, 57/52 °C: 30 s, 72 °C: 1 min) × 35 cycles | [32] |
| EF1-2218R | ATGACACCRACRGCRACRGTYTGYAT | |||
| EF1-728F | CATCGAGAAGTTCGAGAAGG | (95°C: 30 s, 51 °C: 30 s, 72 °C: 1 min) × 35 cycles | [33] | |
| EF-2 | GGARGTACCAGTSATCATGTT | |||
| tub2 | Bt2a | GGTAACCAAATCGGT GCTGCT TTC | (95 °C: 30 s, 56 °C: 30 s, 72 °C: 1 min) × 35 cycles | [34] |
| Bt2b | ACCCTCAGTGTAGTGACCCTTGGC |
| Species | Culture/Voucher | Host/Substrate | Country | GenBank Accession Number | ||||
|---|---|---|---|---|---|---|---|---|
| ITS | LSU | tef1-a | tub2 | rpb1 | ||||
| Barretomyces calatheae | CBS 129274 = CPC 18464 | Calathea longifolia | Brazil | KM484831 | KM484950 | - | - | KM485045 |
| Bambusicularia brunnea | CBS 133599 | Sasa sp. | Japan | KM484830 | KM484948 | - | - | KM485043 |
| Bambusicularia brunnea | CBS 133600 | Phyllostachys bambusoides | Japan | AB274436 | KM484949 | - | - | KM485044 |
| Bifusisporella bambooensis | CGMCC3.25653 | Bambusoideae sp. | China | PP159031 | PP159039 | PP488459 | - | PP488463 |
| Bifusisporella bambooensis | CGMCC3.27207 | Bambusoideae sp. | China | PP477445 | PP477439 | PP488461 | - | PP488465 |
| Bifusisporella fujianensis | CGMCC3.25651 | Bambusoideae sp. | China | PP159030 | PP159038 | PP488458 | - | PP488462 |
| Bifusisporella fujianensis | CGMCC3.27206 | Bambusoideae sp. | China | PP477444 | PP477438 | PP488460 | - | PP488464 |
| Bifusisporella sorghi | URM 7442 | Sorghum bicolorendophyte | Brazil | MK060155 | MK060153 | MK060157 | - | MK060159 |
| Bifusisporella sorghi | URM 7864 | Sorghum bicolorendophyte | Brazil | MK060156 | MK060154 | MK060158 | - | MK060160 |
| Bifusisporella sichuanensis | SICAUCC 22-0073 | Phyllostachys edulis | China | ON227097 | ON227101 | ON244427 | - | ON244428 |
| Bussabanomyces longisporus | CBS 125232 | Amomum siamense, leaves | Thailand | KM484832 | KM484951 | KM009202 | - | KM485046 |
| Buergenerula spartinae | ATCC 22848 | Spartina alterniflora, leaves | USA | JX134666 | DQ341492 | JX134692 | - | JX134720 |
| Falciphora oryzae | CBS 125863= R5-6-l | Oryza sativa, root, endophyte | China | EU636699 | KJ026705 | JN857963 | - | KJ026706 |
| Falciphoriella solaniterrestris | CBS 117.83 | Soil in potato field | Netherlands | KM484842 | KM484959 | - | - | KM485058 |
| Gaeumannomycella graminis | CPC 26020 = CBS 141384 | Cynodon dactylon × C. transvaalensis | USA | KX306498 | KX306568 | KX306701 | - | KX306633 |
| Gaeumannomycella graminicola | CPC 26025 = CBS 141381 | Stenotaphrum secundatum | USA | KX306495 | KX306565 | KX306698 | - | KX306630 |
| Gaeumannomycella caricis | CPC 26262 = CBS 141374 | Carex rostrata | UK | KX306478 | KX306548 | KX306675 | - | KX306671 |
| Gaeumannomycella caricis | CBS 388.81 | Carex rostrata | UK | KM484843 | KM484960 | KX306674 | - | - |
| Gaeumannomyces floridanus | CPC 26037 | Stenotaphrum secundatum | USA | KX306491 | KX306561 | KX306693 | - | KX306626 |
| Gaeumannomyces fusiformis | CPC 26068 | Oryza sativa | USA | KX306492 | KX306562 | KX306694 | - | KX306627 |
| Gaeumannomyces glycinicola | CPC 26266 | Glycine max | USA | KX306494 | KX306564 | KX306696 | - | KX306629 |
| Gaeumannomyces glycinicola | CPC 26057 | Glycine max | USA | KX306493 | KX306563 | KX306695 | - | KX306628 |
| Gaeumannomyces graminicola | CBS 352.93 | - | - | KM484834 | DQ341496 | KX306697 | - | KM485050 |
| Gaeumannomyces graminis | CPC 26045 | Cynodon dactylon × C. transvaalensis | - | KX306505 | KX306575 | KX306708 | - | KX306640 |
| Gaeumannomyces graminis var. graminis | M33 | - | - | JF710374 | JF414896 | JF710411 | - | JF710442 |
| Gaeumannomyces graminis var. graminis | M54 | - | - | JF414848 | JF414898 | JF710419 | - | JF710444 |
| Gaeumannomyces hyphopodioides | CBS 350.77 | Zea mays, root | UK | KX306506 | KX306576 | - | - | - |
| Gaeumannomyces hyphopodioides | CBS 541.86 | Triticum aestivum, seedling | Germany | KX306507 | KX306577 | KX306709 | - | - |
| Gaeumannomyces oryzicola | CPC 26063 | Oryza sativa | USA | KX306516 | KX306586 | KX306717 | - | KX306646 |
| Gaeumannomyces oryzinus | CPC 26030 | Cynodon dactylon × C. transvaalensis | Bahamas | KX306517 | KX306587 | KX306718 | - | KX306647 |
| Gaeumannomyces radicicola | CBS 296.53 | - | Canada | KM009170 | KM009158 | KM009206 | - | KM009194 |
| Gaeumannomyces setariicola | CPC 26059 | Setaria italica | South Africa | KX306524 | KX306594 | KX306725 | - | KX306654 |
| Gaeumannomyces tritici | CBS 273.36 | Triticum aestivum | Argentina | KX306525 | KX306595 | KX306729 | - | KX306655 |
| Gaeumannomyces walkeri | CPC 26028 | Stenotaphrum secundatum | USA | KX306543 | KX306613 | KX306746 | - | KX306670 |
| Gaeumannomyces wongoonoo | BRIP:60376 | Stenotaphrum secundatum | Australia | KP162137 | KP162146 | - | - | - |
| Kohlmeyeriopsis medullaris | CBS 117849 = JK5528S | Juncus roemerianus | USA | KM484852 | KM484968 | - | - | KM485068 |
| Macgarvieomyces borealis | CBS 461.65 | Juncus effiisus, leaf spots | UK | MH858669 | DQ341511 | KM009198 | - | KM485070 |
| Macgarvieomyces juncicola | CBS 610.82 | Juncus effiisus, stem base | The Netherlands | KM484855 | KM484970 | KM009201 | - | KM485071 |
| Magnaporthaceae, incertaesedis | CPC 26284 = GP57 | Triticum aestivum | UK | KX306546 | KX306616 | KX306677 | - | - |
| Magnaporthiopsissp. | CPC 26038 | Cynodon dactylon × C. transvaalensis | USA | KX306545 | - | KX306676 | - | KX306672 |
| Magnaporthiopsis incrustans | M35 | - | - | JF414843 | JF414892 | - | - | JF710437 |
| Magnaporthiopsis maydis | CBS 133165 = ATCC MYA-3356 | Zeamays | Israel | KX306544 | KX306614 | - | - | - |
| Magnaporthiopsis maydis | CBS 662.82A | Zeamays | Egypt | KM484856 | KM484971 | - | - | KM485072 |
| Magnaporthiopsis cynodontis | RS7-2 = CBS 141700 | ultradwarf bermudagrass roots | USA | KJ855508 | KM401648 | KP282714 | - | KP268930 |
| Magnaporthiopsis cynodontis | RS5-5 | roots | USA | KJ855506 | KM401646 | KP282712 | - | KP268928 |
| Magnaporthiopsis cynodontis | RS3-1 | roots | USA | KJ855505 | KM401645 | KP282711 | - | KP268927 |
| Magnaporthiopsis meyeri-festucae | FF2 | - | - | MF178146 | MF178151 | MF178167 | - | MF178162 |
| Magnaporthiopsis meyeri-festucae | SCR11 | - | - | MF178150 | MF178155 | MF178171 | - | MF178166 |
| Magnaporthiopsis panicorum | CM2S8 | - | - | KF689643 | KF689633 | KF689623 | - | KF689613 |
| Magnaporthiopsis panicorum | CM10s2 | - | - | KF689644 | KF689634 | KF689624 | - | KF689614 |
| Magnaporthiopsis rhizophila | M22 | - | - | JF414833 | JF414882 | JF710407 | - | JF710431 |
| Nakataeasp. | CBS 332.53 | Oryza sativa | USA | KM484867 | KM484981 | - | - | KM485083 |
| Nakataea oryzae | CBS 252.34 | Oryza sativa | Burma | KM484862 | KM484976 | - | - | KM485078 |
| Nakataea oryzae | CBS 288.52 | Oryza sativa, stem | Japan | KM484864 | KM484978 | - | - | KM485080 |
| Neogaeumannomyces bambusicola | MFLUCC11-0390 | Dead culm of bamboo (Bambusae) | Thailand | KP744449 | KP744492 | - | - | - |
| Neopyricularia commelinicola | CBS 128307 = KACC 44083 | Commelina communis, leaves | Korea | FJ850125 | KM484984 | KM009199 | - | KM485086 |
| Neopyricularia commelinicola | CBS 128308 | Commelina communis, leaves | Korea | FJ850122 | KM484985 | - | - | KM485087 |
| Omnidemptus affinis | ATCC 200212 | Panicum effiisum var. effiisum grass leaves | Australia | JX134674 | KX134686 | JX134700 | - | JX134728 |
| Ophioceras dolichostomum | CBS 114926 = HKUCC 3936 = KM 8 | Wood | China | JX134677 | JX134689 | JX134703 | - | JX134731 |
| Ophioceras leptosporum | CBS 894.70 = ATCC 24161 = HME 2955 | Dead stem of dicot plant (probably Urtica dioicd) | UK | JX134678 | JX134690 | JX134704 | - | JX134732 |
| Proxipyricularia zingiberis | CBS 132355 | Zingiber mioga | Japan | AB274433 | KM484987 | - | - | KM485090 |
| Proxipyricularia zingiberis | CBS 133594 | Zingiber mioga | Japan | AB274434 | KM484988 | - | - | KM485091 |
| Pseudoph ialophora eragrostis | CM12m9 | Eragrostis sp. | USA | KF689648 | KF689638 | KF689628 | - | KF689618 |
| Pseudopyricularia cyperi | CBS 133595 | Cyperus iria | Japan | KM484872 | KM484990 | - | - | AB818013 |
| Pseudopyricularia kyllingae | CBS 133597 | Kyllinga brevifolia | Japan | KM484876 | KM484992 | KT950880 | - | KM485096 |
| Pyricularia grisea | BR0029 | Digitaria sanguinalis | Brazil | KM484880 | KM484995 | - | - | KM485100 |
| Pyricularia grisea | CR0024 | Lolium perenne | Korea | KM484882 | KM484997 | - | - | KM485102 |
| Pyricularia ctenantheicola | GR0001 = Ct-4 = ATCC 200218 | Ctenanthe oppenheimiana | Greece | KM484878 | KM484994 | - | KM485098 | |
| Pyricularia oryzae | CBS 365.52 = MUCL 9451 | - | Japan | KM484890 | KM485000 | - | - | KM485110 |
| Slopeiomyces cylindrosporus | CBS 609.75 | Grass root, associated with Phialophora graminicola | UK | KM484944 | KM485040 | JX134693 | - | KM485158 |
| Utrechtiana cibiessia | CBS 128780 = CPC 18916 | Phragmites australis, leaves | Netherlands | JF951153 | JF951176 | - | - | KM485047 |
| Xenopyricularia zizaniicola | CBS 132356 | Zizania latifolia | Japan | KM484946 | KM485042 | KM009203 | - | KM485160 |
| Apiospora acutiapica | KUMCC 20-0209 | - | - | MT946342 | MT946338 | MT947359 | MT947365 | - |
| Apiospora acutiapica | KUMCC 20-0210 | Bambusa bambos | China | - | MT946339 | MT947360 | MT947366 | - |
| Apiospora agari | KUC 21333 | Agarum cribrosum | Korea | - | MH498440 | MH544663 | MH498478 | - |
| Apiospora aquatica | MFLU 18-1628 | Submerged wood | China | MK828608 | MK835806 | - | - | - |
| Apiospora arctoscopi | KUC 21331 | Egg of Arctoscopus japonicus | Korea | - | MH498449 | MN868918 | MH498487 | - |
| Apiospora arctoscopi | KUC 21344 | - | - | MH498528 | - | MN868919 | MH498486 | - |
| Apiospora arctoscopi | KUC 21347 | - | - | MH498525 | - | MN868922 | MH498483 | - |
| Apiospora arundinis | CBS 114316 | Hordeum vulgare | Iran | KF144884 | KF144928 | KF145016 | KF144974 | - |
| Apiospora arundinis | CBS 106.12 | - | - | KF144883 | KF144927 | KF145015 | KF144973 | - |
| Apiospora arundinis | CBS 732.71 | - | - | KF144889 | KF144934 | KF145022 | KF144980 | - |
| Apiospora aurea | CBS 244.83 | Air | Spain | AB220251 | KF144935 | KF145023 | KF144981 | - |
| Apiospora balearica | CBS 145129 | Poaceae | Spain | MK014869 | MK014836 | MK017946 | MK017975 | - |
| Apiospora neobambusae | HMAS LC7106 | - | - | KY494718 | KY494794 | KY806204 | KY705186 | - |
| Apiospora bambusicola | MFLUCC20-0144 | Schizostachyum brachycladum | Thailand | MW173030 | MW173087 | MW183262 | - | - |
| Apiospora biserialis | CGMCC 3.20135 | Bambusoideae sp. | China | MW481708 | MW478885 | MW522938 | MW522955 | - |
| Apiospora camelliae-sinensis | LC5007 | Camellia sinensis | China | KY494704 | KY494780 | KY705103 | KY705173 | - |
| Apiospora camelliae-sinensis | LC8181 | - | - | KY494761 | KY494837 | KY705157 | KY705229 | - |
| Apiospora chiangraiense | MFLU 21-0046 | - | - | MZ542520 | MZ542524 | - | MZ546409 | - |
| Apiospora chromolaenae | MFLUCC 17-1505 | Chromolaena odorata | Thailand | MT214342 | MT214436 | MT235802 | - | - |
| Apiospora cordylines | GUCC 10027 | - | - | MT040106 | - | MT040127 | MT040148 | - |
| Apiospora cyclobalanopsidis | CGMCC 3.20136 | Cyclobalanopsis glauca | China | MW481713 | MW478892 | MW522945 | MW522962 | - |
| Apiospora cyclobalanopsidis | GZCC:20-0103 | - | - | MW481714 | - | MW522946 | MW522963 | - |
| Apiospora descalsii | CBS 145130 | Ampelodesmos mauritanicus | Spain | MK014870 | MK014837 | MK017947 | MK017976 | - |
| Apiospora dichotomanthi | CGMCC 3.18332 | Dichotomanthes tristaniiaecarpa | China | KY494697 | KY494773 | KY705096 | KY705167 | - |
| Apiospora esporlensis | CBS 145136 | Phyllostachys aurea | Spain | MK014878 | MK014845 | MK017954 | MK017983 | - |
| Apiospora esporlensis | 18TJAM004 | - | - | MT856406 | - | MT881953 | MT881991 | - |
| Apiospora euphorbiae | IMI 285638b | Bambusoideae sp. | Bangladesh | AB220241 | AB220335 | - | AB220288 | - |
| Apiospora euphorbiae | ZHKUCC 22-0001 | - | - | OM728647 | OM486971 | OM543543 | OM543544 | - |
| Apiospora fermenti | KUC 21289 | - | - | MF615226 | - | MH544667 | MF615231 | - |
| Apiospora fermenti | KUC 21288 | - | - | MF615230 | - | MH544668 | MF615235 | - |
| Apiospora fujianensis | CGMCC3.25647 | Bambusoideae sp. | China | PP159026 | PP159034 | PP488454 | PP488470 | - |
| Apiospora fujianensis | CGMCC3.25648 | Bambusoideae sp. | China | PP159027 | PP159035 | PP488455 | PP488471 | - |
| Apiospora fuzhouensis | CGMCC3.25649 | Bambusoideae sp. | China | PP159028 | PP159036 | PP488456 | PP488468 | - |
| Apiospora fuzhouensis | CGMCC3.25650 | Bambusoideae sp. | China | PP159029 | PP159037 | PP488457 | PP488469 | - |
| Apiospora gaoyouensis | CFCC52301 | Phragmites australis | China | MH197124 | - | MH236793 | MH236789 | - |
| Apiospora garethjonesii | JHB004 | Culms of dead bamboo | China | KY356086 | KY356091 | - | - | - |
| Apiospora garethjonesii | SICAUCC 22-0028 | - | - | ON228606 | ON228662 | - | ON237654 | - |
| Apiospora garethjonesii | SICAUCC 22-0027 | - | - | ON228603 | ON228659 | - | ON237651 | - |
| Apiospora gelatinosa | HKAS 111962 | Culms of dead bamboo | China | MW481706 | MW478888 | MW522941 | MW522958 | - |
| Apiospora guiyangensis | HKAS 102403 | Dead culms of Poaceae | China | MW240647 | MW240577 | MW759535 | MW775604 | - |
| Apiospora guizhouensis | CGMCC 3.18334 | Air in karst cave | China | KY494709 | KY494785 | KY705108 | KY705178 | - |
| Apiospora guizhouensis | KUMCC 20-0206 | - | - | MT946347 | MT946341 | MT947364 | MT947370 | - |
| Apiospora hainanensis | SAUCC 1681 | Leaf of bamboo | China | OP563373 | OP572422 | OP573262 | OP573268 | - |
| Apiospora hispanica | IMI 326877 | Maritime sand | Spain | AB220242 | AB220336 | - | AB220289 | - |
| Apiospora hydei | CBS 114990 | Bambusoideae sp. | China | KF144890 | KF144936 | KF145024 | KF144982 | - |
| Apiospora hydei | LC 7103 | - | - | KY494715 | KY494791 | KY705114 | KY705183 | - |
| Apiospora hyphopodii | SICAUCC 22-0034 | - | - | ON228605 | ON228661 | - | ON237653 | - |
| Apiospora hysterina | ICMP 6889 | Bambusoideae sp. | New Zealand | MK014874 | MK014841 | MK017951 | MK017980 | - |
| Apiospora hysterina | KUC21438 | - | - | ON764019 | ON787758 | ON806623 | ON806633 | - |
| Apiospora iberica | CBS 145137 | Arundo donax | Portugal | MK014879 | MK014846 | MK017955 | MK017984 | - |
| Apiospora intestini | CBS 135835 | Gut of grasshopper | India | KR011352 | KR149063 | KR011351 | KR011350 | - |
| Apiospora intestini | MFLU:21-0045 | - | - | MZ542521 | MZ542525 | MZ546406 | MZ546410 | - |
| Apiospora italica | AP29118 | - | - | MK014881 | MK014848 | MK017957 | MK017986 | - |
| Apiospora jatrophae | CBS 134262 | Jatropha podagrica | India | JQ246355 | - | - | - | - |
| Apiospora jiangxiensis | CGMCC 3.18381 | Maesa sp. | China | KY494693 | KY494769 | KY705092 | KY705163 | - |
| Apiospora jiangxiensis | SICAU 22-0070 | - | - | ON227094 | ON227098 | ON244431 | ON244432 | - |
| Apiospora kogelbergensis | CBS 113332 | Cannomois virgata | South Africa | KF144891 | KF144937 | KF145025 | KF144983 | - |
| Apiospora kogelbergensis | CBS 117206 | - | - | KF144895 | KF144941 | KF145029 | KF144987 | - |
| Apiospora koreana | KUC 21332 | Egg of Arctoscopus japonicus | Korea | MH498524 | - | MH544664 | MH498482 | - |
| Apiospora koreana | KUC21350 | - | - | MH498521 | - | MN868929 | MH498479 | - |
| Apiospora locuta-pollinis | LC11683 | Brassica campestris | China | MF939595 | - | MF939616 | MF939622 | - |
| Apiospora locuta-pollinis | KUNCC:22-12409 | - | - | OP377737 | OP377744 | OP381091 | - | - |
| Apiospora longistroma | MFLU 15-1184 | Culms of decaying bamboo | Thailand | KU940141 | KU863129 | - | - | - |
| Apiospora malaysiana | CBS 102053 | Macaranga hullettii | Malaysia | KF144896 | KF144942 | KF145030 | KF144988 | - |
| Apiospora malaysiana | CBS:251.29 | - | - | KF144897 | KF144943 | KF145031 | KF144989 | - |
| Apiospora marianiae | AP18219 | Dead stems of Phleum pratense | Spain | ON692406 | ON692422 | ON677180 | ON677186 | - |
| Apiospora marii | CBS 497.90 | Air | Spain | MH873913 | KF144947 | KF145035 | KF144993 | - |
| Apiospora marii | CBS 200.57 | - | - | KF144900 | KF144946 | KF145034 | KF144992 | - |
| Apiospora marina | KUC 21328 | Seaweed | Korea | MH498538 | MH498458 | MH544669 | MH498496 | - |
| Apiospora mediterranea | IMI 326875 | Air | Spain | AB220243 | AB220337 | - | AB220290 | - |
| Apiospora minutispora | 17E 042 | Soil | Korea | LC517882 | - | LC518889 | LC518888 | - |
| Apiospora montagnei | LSU0093 | - | - | MT000394 | MT000490 | - | - | - |
| Apiospora mori | MFLU 18-2514 | Dead leaves of Morus australis | China | MW114313 | MW114393 | - | - | - |
| Apiospora mori | NCYU 19-0364 | - | - | MW114314 | MW114394 | - | - | - |
| Apiospora mukdahanensis | MFLUCC 22-0056 | - | - | OP377735 | OP377742 | OP381089 | - | - |
| Apiospora multiloculata | MFLUCC 21-0023 | Dead culms of Bambusae | Thailand | OL873137 | OL873138 | - | OL874718 | - |
| Apiospora mytilomorpha | DAOM 214595 | Dead blades of Andropogon sp. | India | KY494685 | - | - | - | - |
| Apiospora neobambusae | LC7124 | - | - | KY494727 | KY494803 | KY806206 | KY705195 | - |
| Apiospora neochinense | CFCC 53036 | Fargesia qinlingensis | China | MK819291 | - | MK818545 | MK818547 | - |
| Apiospora neogarethjonesii | HKAS 102408 | Dead culms of Bambusae | China | MK070897 | MK070898 | - | - | - |
| Apiospora neosubglobosa | SICAUCC 22-0039 | - | - | ON228614 | ON228670 | - | ON237662 | - |
| Apiospora obovata | CGMCC 3.18331 | Lithocarpus sp. | China | KY494696 | KY494772 | KY705095 | KY705166 | - |
| Apiospora obovata | LC8177 | - | - | KY494757 | KY494833 | KY705153 | KY705225 | - |
| Apiospora ovata | CBS 115042 | Arundinaria hindsii | China | KF144903 | KF144950 | KF145037 | KF144995 | - |
| Apiospora paraphaeosperma | MFLUCC13-0644 | Dead clumps of Bambusa sp. | Thailand | KX822128 | KX822124 | - | - | - |
| Apiospora phragmitis | CBS 135458 | Phragmites australis | Italy | KF144909 | KF144956 | KF145043 | KF145001 | - |
| Apiospora phragmitis | AP29717A | - | - | MK014892 | MK014859 | MK017968 | MK017997 | - |
| Apiospora phyllostachydis | MFLUCC 18-1101 | Phyllostachys heteroclada | China | MK351842 | MH368077 | MK340918 | MK291949 | - |
| Apiospora piptatheri | CBS 145149 | Piptatherum miliaceum | Spain | MK014893 | MK014860 | - | - | - |
| Apiospora piptatheri | KUC21279 | - | - | MF615229 | - | MH544671 | MF615234 | - |
| Apiospora pseudoparenchymatica | CGMCC 3.18336 | Bambusoideae sp. | China | KY494743 | - | KY705139 | KY705211 | - |
| Apiospora pseudorasikravindrae | KUMCC 20-0208 | - | - | MT946344 | - | MT947361 | MT947367 | - |
| Apiospora pseudorasikravindrae | KUMCC 20-0211 | - | - | MT946345 | - | MT947362 | MT947368 | - |
| Apiospora pseudosinensis | CPC 21546 | Leaf of bamboo | The Netherlands | KF144910 | KF144957 | KF145044 | MN868936 | - |
| Apiospora pseudospegazzinii | CBS 102052 | Macaranga hullettii | Malaysia | KF144911 | KF144958 | KF145045 | KF145002 | - |
| Apiospora pterosperma | CBS 134000 | Machaerina sinclairii | Australia | KF144913 | KF144960 | KF145046 | KF145004 | - |
| Apiospora pusillisperma | KUC 21321 | Seaweed | Korea | MH498533 | MH498453 | MN868930 | MH498491 | - |
| Apiospora qinlingensis | CFCC 52303 | Fargesia qinlingensis | China | MH197120 | - | MH236795 | MH236791 | - |
| Apiospora rasikravindrae | LC5449 | Soil in karst cave | China | KY494713 | KY494789 | KY705112 | KY705182 | - |
| Apiospora rasikravindrae | AP10418 | - | - | MK014896 | MK014863 | - | MK017999 | - |
| Apiospora sacchari | CBS 212.30 | Phragmites australis | UK | KF144916 | KF144962 | KF145047 | KF145005 | - |
| Apiospora sacchari | CBS:664.74 | - | - | KF144919 | KF144965 | KF145050 | KF145008 | - |
| Apiospora saccharicola | CBS 191.73 | Air | The Netherlands | KF144920 | KF144966 | KF145051 | KF145009 | - |
| Apiospora sargassi | KUC 21228 | Sargassum fulvellum | Korea | KT207746 | - | MH544677 | KT207644 | - |
| Apiospora sasae | CBS 146808 | Dead culms of Sasa veitchii | The Netherlands | MW883402 | MW883797 | MW890104 | MW890120 | - |
| Apiospora septata | CGMCC 3.20134 | Bambusoideae sp. | China | MW481711 | MW478890 | MW522943 | MW522960 | - |
| Apiospora serenensis | IMI 326869 | - | Spain | AB220250 | AB220344 | - | AB220297 | - |
| Apiospora serenensis | ATCC 76309 | - | - | AB220240 | AB220334 | - | AB220287 | - |
| Apiospora setariae | CFCC 54041 | Decaying culms of Setaria viridis | China | MT492004 | - | - | - | - |
| Apiospora setostroma | KUMCC 19-0217 | Dead branches of bamboo | China | MN528012 | MN528011 | MN527357 | - | - |
| Apiospora sichuanensis | HKAS 107008 | Dead culms of Poaceae | China | MW240648 | MW240578 | MW759536 | MW775605 | - |
| Apiospora sorghi | URMBRA 9300 | Sorghum bicolor | Brazil | MK371706 | - | - | MK348526 | - |
| Apiospora sphaerosperma | CBS114314 | Leaf of Hordeum vulgare | Iran | KF144904 | KF144951 | KF145038 | KF144996 | - |
| Apiospora sphaerosperma | CBS 142.55 | - | - | KF144908 | KF144955 | KF145042 | AB220303 | - |
| Apiospora stipae | CBS 146804 | Stipa gigantea | Spain | MW883403.1 | MW883798.1 | - | MW890121.1 | - |
| Apiospora subglobosa | MFLUCC 11-0397 | Dead culms of bamboo | Thailand | KR069112 | KR069113 | - | - | - |
| Apiospora subrosea | CGMCC 3.18337 | Bambusoideae sp. | China | KY494752 | KY494828 | KY705148 | KY705220 | - |
| Apiospora subrosea | LC 7291 | - | - | KY494751 | KY494827 | KY705147 | KY705219 | - |
| Apiospora taeanensis | KUC 21322 | Seaweed | Korea | MH498515 | - | MH544662 | MH498473 | - |
| Apiospora taeanensis | KUC 21359 | - | - | MH498513 | - | MN868935 | MH498471 | - |
| Apiospora thailandica | MFLUCC 15-0202 | - | - | KU940145 | KU863133 | - | - | - |
| Apiospora thailandica | MFLUCC 15-0199 | - | - | KU940146 | KU863134 | - | - | - |
| Apiospora tropica | MFLUCC 21–0056 | - | - | OK491657 | OK491653 | - | OK560922 | - |
| Apiospora vietnamensis | IMI 99670 | Citrus sinensis | Vietnam | KX986096 | KX986111 | - | KY019466 | - |
| Apiospora xenocordella | CBS 478.86 | Soil from roadway | Zimbabwe | KF144925 | KF144970 | KF145055 | KF145013 | - |
| Apiospora xenocordella | LC3486 | - | - | KY494687 | KY494763 | KY705086 | KY705158 | - |
| Apiospora yunnana | MFLUCC 150002 | Culms of Decaying bamboo | China | KU940147 | KU863135 | - | - | - |
| Apiospora yunnana | SICAU 22-0072 | - | - | ON227096 | ON227100 | ON244425 | ON244426 | - |
| Species | Location | Host/Substrate | Conidiogenous Cells | Size of Conidiophore Cells (µm) | Conidia | Size of Conidia (µm) | References |
|---|---|---|---|---|---|---|---|
| Bifusisporella bambooensis sp. nov. | China | Bambusoideae sp. | Cylindrical | 7.2–21.0 × 4.2–6.4 | falcate or curved moon-shaped | 10.8–45.0 × 2.8–4.9 | In this study |
| Bifusisporella sorghi | Brazil | Sorghum bicolor | Cylindrical orclavate | 5.0–19.5 × 3.0–4.0 | falcate | Macroconidia 19.0–34.0 × 3.0–4.0 Microconidia 7.0–14.5 × 1.0–2.0 | [15] |
| Bifusisporella fujianensis sp. nov. | China | Bambusoideae sp. | Cylindricalor rod-shaped | 8.9–14.3 × 5.8–8.1 | falcate or curved moon-shaped | 37.3–56.3 × 3.6–5.7 | In this study |
| Bifusisporella sichuanensis | China | Phyllostachys edulis | - | - | - | - | [43] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Z.; Mu, T.; Keyhani, N.O.; Pu, H.; Lin, Y.; Lv, Z.; Xiong, J.; Chen, X.; Zhan, X.; Lv, H.; et al. Diversity and New Species of Ascomycota from Bamboo in China. J. Fungi 2024, 10, 454. https://doi.org/10.3390/jof10070454
Zhao Z, Mu T, Keyhani NO, Pu H, Lin Y, Lv Z, Xiong J, Chen X, Zhan X, Lv H, et al. Diversity and New Species of Ascomycota from Bamboo in China. Journal of Fungi. 2024; 10(7):454. https://doi.org/10.3390/jof10070454
Chicago/Turabian StyleZhao, Zhiying, Taichang Mu, Nemat O. Keyhani, Huili Pu, Yongsheng Lin, Ziying Lv, Jinming Xiong, Xiaohao Chen, Xinyang Zhan, Huajun Lv, and et al. 2024. "Diversity and New Species of Ascomycota from Bamboo in China" Journal of Fungi 10, no. 7: 454. https://doi.org/10.3390/jof10070454
APA StyleZhao, Z., Mu, T., Keyhani, N. O., Pu, H., Lin, Y., Lv, Z., Xiong, J., Chen, X., Zhan, X., Lv, H., Jibola-Shittu, M. Y., Jia, P., Wu, J., Huang, S., Qiu, J., & Guan, X. (2024). Diversity and New Species of Ascomycota from Bamboo in China. Journal of Fungi, 10(7), 454. https://doi.org/10.3390/jof10070454

