Characterisation of Itersonilia spp. from Parsnip and Other Hosts
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Itersonilia Isolates
2.2. Virulence of Itersonilia spp. Isolates on Parsnip Roots
2.3. Virulence of Itersonilia spp. Isolates on Detached Parsnip Leaves
2.4. Effect of Temperature on Itersonilia spp. Growth Rate
2.5. Effect of Temperature on Itersonilia spp. Spore Production
2.6. Genome Sequencing and Assembly of I. pastinacae
2.7. Molecular Characterisation of Itersonilia spp. Isolates
3. Results
3.1. Virulence of Itersonilia spp. Isolates on Parsnip Roots
3.2. Virulence of Itersonilia spp. Isolates on Detached Parsnip Leaves
3.3. Effect of Temperature on Itersonilia spp. Growth Rate
3.4. Effect of Temperature on Itersonilia spp. Spore Production
3.5. Molecular Characterisation of Itersonilia spp. Isolates
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Millanes, A.M.; Diederich, P.; Ekman, S.; Wedin, M. Phylogeny and character evolution in the jelly fungi (Tremellomycetes, Basidiomycota, Fungi). Mol. Phylogenet. Evol. 2011, 61, 12–28. [Google Scholar] [CrossRef] [PubMed]
- Boekhout, T. Systematics of Itersonilia: A comparative phenetic study. Mycol. Res. 1991, 95, 135–146. [Google Scholar] [CrossRef]
- Derx, H.G. Itersonilia nouveau genre de Sporobolomycètes à mycelium bouclé. Bull. Bot. Gard. Buitenzorg Ser. II 1948, 17, 465–472. [Google Scholar]
- Nyland, G. Studies on Some unusual Heterobasidiomycetes from Washington State. Mycologia 1949, 41, 686–701. [Google Scholar] [CrossRef]
- Sowell, G., Jr.; Korf, R.P. An emendation of the genus Itersonilia based on studies of morphology and pathogenicity. Mycologia 1960, 52, 934–945. [Google Scholar] [CrossRef]
- Channon, A.G. Studies on parsnip canker: I. The causes of the diseases. Ann. Appl. Biol. 1963, 51, 1–15. [Google Scholar] [CrossRef]
- Niwata, Y.; Takashima, M.; Tornai-Lehoczki, J.; Deak, T.; Nakase, T. Udeniomyces pannonicus sp. nov., a ballistoconidium-forming yeast isolated from leaves of plants in Hungary. Int. J. Syst. Evol. Microbiol. 2002, 52, 1887–1892. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.Z.; Wang, Q.M.; Göker, M.; Groenewald, M.; Kachalkin, A.V.; Lumbsch, H.T.; Millanes, A.M.; Wedin, M.; Yurkov, A.M.; Boekhout, T.; et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 2015, 81, 85–147. [Google Scholar] [CrossRef]
- Ingold, C.T. Structure and development in an isolate of Itersonilia perplexans. Trans. Br. Mycol. Soc. 1983, 80, 365–368. [Google Scholar] [CrossRef]
- Boekhout, T.; Poot, G.; Hackman, P.; Steensma, H.Y. Genomic characteristics of strains of Itersonilia: Taxonomic consequences and life cycle. Can. J. Microbiol. 1991, 37, 188–194. [Google Scholar] [CrossRef]
- Lambourne, C. Herbs: A Survey into the Prevalence and Severity of Itersonilia spp. in UK Crops. AHDB Horticulture 2011, FV 381a. Available online: https://horticulture.ahdb.org.uk/fv-381a-itersonilia-spp-a-survey-into-its-prevalence-and-severity-in-uk-herb-crops-continuation-2011 (accessed on 5 December 2024).
- Channon, A.G. Studies on parsnip canker: II. Observations on the occurrence of Itersonilia pastinacae and related fungi on the leaves of parsnips and in the air within parsnip crops. Ann. Appl. Biol. 1963, 51, 223–230. [Google Scholar] [CrossRef]
- McPherson, G.M. Carrot: Investigation into the Incidence, Severity and Cause of Leaf Dieback and Crown Rot in Commercial Crops. AHDB Horticulture 1995, FV 167. Available online: https://projectbluearchive.blob.core.windows.net/media/Default/Research%20Papers/Horticulture/FV%20167%20Carrot%20leaf%20dieback%20and%20crown%20rot%201995.pdf (accessed on 5 December 2024).
- McGovern, R.J.; Horita, H.; Stiles, C.M.; Seijo, T.E. Host Range of Itersonilia perplexans and Management of Itersonilia Petal Blight of China Aster. Plant Health Prog. 2006, 7, 7. [Google Scholar] [CrossRef]
- Horita, H.; Yasuoka’, S. Black streak of edible burdock caused by Itersonila in Japan. J. Gen. Plant Pathol. 2002, 68, 277–283. [Google Scholar] [CrossRef]
- Channon, A.G. Infection of the flowers and seed of parsnip by Itersonilia pastinacae. Ann. Appl. Biol. 1969, 64, 281–288. [Google Scholar] [CrossRef]
- Webster, J.; Davey, R.A.; Duller, G.A.; Ingold, C.T. Ballistospore discharge in Itersonilia perplexans. Trans. Br. Mycol. Soc. 1984, 82, 13–29. [Google Scholar] [CrossRef]
- Gladders, P. Parsnip: Control of Canker. AHDB Horticulture 1997, FV 167a. Available online: https://projectbluearchive.blob.core.windows.net/media/Default/Research%20Papers/Horticulture/FV%20167a%20Parsnip%20canker%20control%201997.pdf (accessed on 5 December 2024).
- Smith, P.R. The survival in soil of Itersonilia pastinacae Channon, the cause of parsnip canker. Aust. J. Biol. Sci. 1967, 20, 647–660. [Google Scholar] [CrossRef]
- Ingold, C.T. Features of ballistospore germination in Itersonilia. Trans. Br. Mycol. Soc. 1987, 89, 575–578. [Google Scholar] [CrossRef]
- McPherson, G.M. Parsnip: An Improved Understanding of Root Blemishes and Their Prevention. AHDB Horticulture 2011, FV 366. Available online: https://projectblue.blob.core.windows.net/media/Default/Research%20Papers/Horticulture/FV%20366%20Annual%20Report%202012.pdf (accessed on 5 December 2024).
- Schindelin, J.; Rueden, C.T.; Hiner, M.C.; Eliceiri, K.W. The ImageJ ecosystem: An open platform for biomedical image analysis. Mol. Reprod. Dev. 2015, 82, 518–529. [Google Scholar] [CrossRef]
- Briere, J.; Pracros, P.; LE Roux, A.; Pierre, J. A novel rate model of temperature dependent development for arthropods. Environ. Entomol. 1999, 28, 22–29. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- David-Palma, M.; Libkind, D.; Brito, P.H.; Silva, M.; Bellora, N.; Coelho, M.A.; Heitman, J.; Gonçalves, P.; Sampaio, J.P. The untapped Australasian diversity of astaxanthin-producing yeasts with biotechnological potential—Phaffia australis sp. nov. and Phaffia tasmanica sp. nov. Microorganisms 2020, 8, 1651. [Google Scholar] [CrossRef] [PubMed]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes—Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Kauserud, H.; Schumacher, T. Outcrossing or inbreeding: DNA markers provide evidence for type of reproductive mode in Phellinus nigrolimitatus (Basidiomycota). Mycol. Res. 2001, 105, 676–683. [Google Scholar] [CrossRef]
- Channon, A.G. Studies on parsnip canker: III. The effect of sowing date and spacing on canker development. Ann. Appl. Biol. 1964, 54, 63–70. [Google Scholar] [CrossRef]
- Channon, A.G.; Thomson, M.C. Parsnip canker caused by Cylindrocarpon destructans. Plant Pathol. 1981, 30, 181. [Google Scholar] [CrossRef]
- Ingold, C.T. Further observations on Itersonilia. Trans. Br. Mycol. Soc. 1984, 83, 166–174. [Google Scholar] [CrossRef]
- Ayerst, G. The effects of moisture and temperature on growth and spore germination in some fungi. J. Stored Prod. Res. 1969, 5, 127–141. [Google Scholar] [CrossRef]
- Margesin, R.; Fell, J.W. Mrakiella cryoconiti gen. nov., sp. nov., a psychrophilic, anamorphic, basidiomycetous yeast from alpine and arctic habitats. Int. J. Syst. Evol. Microbiol. 2008, 58, 2977–2982. [Google Scholar] [CrossRef]
- Xin, M.X.; Zhou, P.J. Mrakia psychrophila sp. nov., a new species isolated from Antarctic soil. J. Zhejiang Univ. B 2007, 8, 260–265. [Google Scholar] [CrossRef] [PubMed]
- Gandy, D.G. Itersonilia perplexans on chrysanthemums: Alternative hosts and ways of overwintering. Trans. Br. Mycol. Soc. 1966, 49, 499–507. [Google Scholar] [CrossRef]
- Smith, P.R. Seed transmission of Itersonilia pastinacae in parsnip and its elimination by a steam-air treatment. Aust. J. Exp. Agric. 1966, 6, 441–444. [Google Scholar] [CrossRef]
- Raja, H.A.; Miller, A.N.; Pearce, C.J.; Oberlies, N.H. Fungal identification using molecular tools: A primer for the natural products research Community. J. Nat. Prod. 2017, 80, 756–770. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Sierra, A.; Henricot, B. Identification of fungal species beyond morphology. Mycologist 2002, 2, 4246. [Google Scholar] [CrossRef]
- Clivot, H.; Cornut, J.; Chauvet, E.; Elger, A.; Poupin, P.; Guérold, F.; Pagnout, C. Leaf-associated fungal diversity in acidified streams: Insights from combining traditional and molecular approaches. Environ. Microbiol. 2014, 16, 2145–2156. [Google Scholar] [CrossRef]
- Pashley, C.H.; Fairs, A.; Free, R.C.; Wardlaw, A.J. DNA analysis of outdoor air reveals a high degree of fungal diversity, temporal variability, and genera not seen by spore morphology. Fungal Biol. 2012, 116, 214–224. [Google Scholar] [CrossRef]
- West, J.S.; Bravo, C.; Oberti, R.; Moshou, D.; Ramon, H.; McCartney, H.A. Detection of fungal diseases optically and pathogen inoculum by air sampling. In Precision Crop Protection—The Challenge and Use of Heterogeneity; Oerke, E.-C., Gerhards, R., Menz, G., Sikora, R.A., Eds.; Springer: Dordrecht, The Netherlands, 2010; pp. 135–149. [Google Scholar] [CrossRef]









| Culture | Fungal Species | Host Plant Material | Origin/Culture Collection | Country |
|---|---|---|---|---|
| IP1 | I. pastinacae | Parsnip seed | Lincolnshire | England |
| IP2 | I. pastinacae | Parsnip seed | Lincolnshire | England |
| IP3 | I. pastinacae | Parsnip seed | Lincolnshire | England |
| IP4 | I. pastinacae | Parsnip seed | NIAB | England |
| IP5 | I. pastinacae | Parsnip seed | NIAB | England |
| IP6 | I. pastinacae | Parsnip seed | NIAB | England |
| IP7 | I. pastinacae | Parsnip seed | Crop Health Services, Fera | England |
| IP8 | I. pastinacae | Parsnip seed | Crop Health Services, Fera | England |
| IP9 | I. pastinacae | Parsnip seed | Crop Health Services, Fera | England |
| IP10 | I. pastinacae | Parsnip seed | Heves | Hungary |
| IP11 | I. pastinacae | Parsnip root | Stockbridge Technology Centre | England |
| IP12 | I. pastinacae | Parsnip root | Stockbridge Technology Centre | England |
| IP13 | Itersonilia sp. | Chrysanthemum petal | Stockbridge Technology Centre | England |
| IP14 * | Itersonilia sp. | Chrysanthemum petal | Stockbridge Technology Centre | England |
| IP15 | Itersonilia sp. | Dill leaves | Stockbridge Technology Centre | England |
| IP16 * | Itersonilia sp. | Dill leaves | Stockbridge Technology Centre | England |
| IP17 | Itersonilia sp. | Dill leaves | Stockbridge Technology Centre | England |
| IP18 * | I. pastinacae | Parsnip seed | Heves | Hungary |
| IP19 | I. pastinacae | Parsnip seed | Heves | Hungary |
| IP20 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP21 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP22 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP23 | I. pastinacae | Parsnip seed | Kent | England |
| IP24 | I. pastinacae | Parsnip seed | Lincolnshire | England |
| IP25 | I. pastinacae | Parsnip seed | Lincolnshire | England |
| IP26 | Itersonilia sp. | Chrysanthemum petal | ADAS | England |
| IP27 | I. pastinacae | Parsnip leaves | Norfolk | England |
| IP28 | I. pastinacae | Parsnip leaves | ADAS | England |
| IP29 | I. pastinacae | Parsnip root | Vegetable Consultancy Services | England |
| IP30 | I. pastinacae | Parsnip root | Lincolnshire | England |
| IP31 | I. pastinacae | Parsnip seed | Wanganui | New Zealand |
| IP32 | I. pastinacae | Parsnip seed | Wanganui | New Zealand |
| IP33 | I. pastinacae | Parsnip seed | Wanganui | New Zealand |
| IP34 | I. pastinacae | Parsnip seed | Wanganui | New Zealand |
| IP35 | I. pastinacae | Parsnip leaves | Nottingham | England |
| IP36 | Itersonilia sp. | Fennel leaves | Middlesex | England |
| IP37 | Itersonilia sp. | Dill leaves | Middlesex | England |
| IP38 | Itersonilia sp. | Parsley leaves | Middlesex | England |
| IP39 | I. pastinacae | Parsnip root | Cupar, Fife | Scotland |
| IP40 | I. pastinacae | Parsnip root | Östersund | Sweden |
| IP41 | I. pastinacae | Parsnip root | Nottingham | England |
| IP42 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP43 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP44 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP45 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP46 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP47 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP48 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP49 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP50 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| IP51 | I. pastinacae | Parsnip seed | Poituo-Charentes | France |
| Genetic Locus | Primer Code | Primer Sequence (5′-3′) | Length (bp) | Thermocycling Conditions | Amplicon Size (bp) | Source | |
|---|---|---|---|---|---|---|---|
| ITS | Nuclear rDNA Internal transcribed spacer regions | ITS1 | TCCGTAGGTGAACCTGCGG | 19 | one cycle of 2 min at 94 °C, 40 cycles of 35 s at 94 °C, 55 s at 61 °C and 1 min at 72 °C, followed by one cycle of 10 min at 72 °C | 444 | [26] |
| ITS4 | TCCTCCGCTTATTGATATGC | 20 | [27] | ||||
| EF-1α | Translation Elongation Factor 1-α | EF595F | CGTGACTTCATCAAGAACATG | 21 | one cycle of 2 min at 94 °C, 40 cycles of 35 s at 94 °C, 55 s at 61 °C and 1 min at 72 °C, followed by one cycle of 10 min at 72 °C | 392 | [28] |
| EF1160R | CCGATCTTGTAGACGTCCTG | 20 | |||||
| Rpb2 | RNA Polymerase II | IP RpbII F | GACTTTGACCTGACGCCCTCTC | 22 | one cycle of 2 min at 94 °C, 30 cycles of 30 s at 94 °C, 1 min at 68 °C and 1 min at 72 °C, followed by one cycle of 10 min at 72 °C | 1186 | Designed from Isolate IP10 Genome |
| Second largest subunit | IP RpbII R | AAGGGCCGAGATTCAGTCAG | 20 | ||||
| TUB2 | Partial β-Tubulin | TUB2 55F | GCGTAGCCGACCATGAAGAAGC | 22 | one cycle of 2 min at 94 °C, 35 cycles of 45 s at 94 °C, 30 s at 68 °C and 1 min at 72 °C, followed by one cycle of 7 min at 72 °C | 559 | Designed from Isolate IP10 Genome |
| TUB2 536R | ACACGGTCGTCGAGCCCTACAA | 21 | |||||
| LSU | Partial 28s rRNA gene | IP LSU F | ATGCGAGTTTCTGCTATCCTGAG | 23 | one cycle of 2 min at 94 °C, 30 cycles of 30 s at 94 °C, 1 min at 59 °C and 1 min at 72 °C, followed by one cycle of 7 min at 72 °C | 214 | Designed from Isolate IP10 Genome |
| IP LSU R | ATCAATAAGCGGAGGAAAAGAAAC | 23 | |||||
| SSU | Partial 18s rRNA gene | IP SSU F | CGTCAATTCCTTTAAGTTTCAGC | 23 | one cycle of 2 min at 94 °C, 30 cycles of 30 s at 94 °C, 1 min at 48 °C and 1 min at 72 °C, followed by one cycle of 7 min at 72 °C | 21 | Designed from Isolate IP10 Genome |
| IP SSU R | TATCTGCCCTATCAACTTTC | 20 | |||||
| TTF | Triosephosphate Transporter Family | 588 F | CCCCGGGCGCTGAGTAGG | 18 | one cycle of 2 min at 94 °C, 15 cycles of 30 s at 94 °C, 1 min at 71 °C (decreasing 1 °C per cycle) and 1 min at 72 °C, followed by 25 cycles of 30 s at 94 °C, 1 min at 70 °C and 1 min at 72 °C followed by one cycle of 7 min at 72 °C | 422 | Designed from Isolate IP10 Genome |
| 1159 R | TGAGGGAGTGCGAGAAGTGTTAGC | 24 | |||||
| tMT | tRNA methyl transferase | 36 F | GACGGGACCGATCTGCGACTGCTC | 24 | one cycle of 2 min at 94 °C, 15 cycles of 30 s at 94 °C, 1 min at 71 °C (decreasing 1 °C per cycle) and 1 min at 72 °C, followed by 25 cycles of 30 s at 94 °C, 1 min at 70 °C and 1 min at 72 °C followed by one cycle of 7 min at 72 °C | 612 | Designed from Isolate IP10 Genome |
| 437 R | GCCGATGACCTGACGACCGCTGTG | 24 | |||||
| CDH | Cellubiose Dehydrogenase | 6381 F | GCAGTTGGCGCAGGCTATG | 19 | one cycle of 2 min at 94 °C, 15 cycles of 30 s at 94 °C, 1 min at 70 °C (decreasing 1 °C per cycle) and 1 min at 72 °C, followed by 25 cycles of 30 s at 94 °C, 1 min at 69 °C and 1 min at 72 °C followed by one cycle of 7 min at 72 °C | 610 | Designed from Isolate IP10 Genome |
| 6927 R | AGGAGGCGTGAGAAGAGTGTGAGG | 24 | |||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chappell, L.H.K.; Barker, G.C.; Clarkson, J.P. Characterisation of Itersonilia spp. from Parsnip and Other Hosts. J. Fungi 2024, 10, 873. https://doi.org/10.3390/jof10120873
Chappell LHK, Barker GC, Clarkson JP. Characterisation of Itersonilia spp. from Parsnip and Other Hosts. Journal of Fungi. 2024; 10(12):873. https://doi.org/10.3390/jof10120873
Chicago/Turabian StyleChappell, Lauren H. K., Guy C. Barker, and John P. Clarkson. 2024. "Characterisation of Itersonilia spp. from Parsnip and Other Hosts" Journal of Fungi 10, no. 12: 873. https://doi.org/10.3390/jof10120873
APA StyleChappell, L. H. K., Barker, G. C., & Clarkson, J. P. (2024). Characterisation of Itersonilia spp. from Parsnip and Other Hosts. Journal of Fungi, 10(12), 873. https://doi.org/10.3390/jof10120873

