Next Article in Journal
Hyperpolarisation of Mitochondrial Membranes Is a Critical Component of the Antifungal Mechanism of the Plant Defensin, Ppdef1
Next Article in Special Issue
Molecular Characterization of the First Partitivirus from a Causal Agent of Salvia miltiorrhiza Dry Rot
Previous Article in Journal
Induction of Extracellular Hydroxyl Radicals Production in the White-Rot Fungus Pleurotus eryngii for Dyes Degradation: An Advanced Bio-oxidation Process
Previous Article in Special Issue
Ectopic Expression of Gastrodia Antifungal Protein in Rice Enhances Resistance to Rice Sheath Blight Disease
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 10
Issue 1
10.3390/jof10010053
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Identification of Alternaria alternata from Potato Plants Affected by Leaf Spot Disease in Korea: Selection of Effective Fungicides

by
Jiyoon Park
1,2,†,
Seoyeon Kim
1,2,†,
Miju Jo
1,2,‡,
Sunmin An
1,2,‡,
Youngjun Kim
1,
Jonghan Yoon
1,
Min-Hye Jeong
1,
Eun Young Kim
3,
Jaehyuk Choi
4,
Yangseon Kim
5 and
Sook-Young Park
1,2,*
1
Department of Plant Medicine, Sunchon National University, Sunchon 57922, Republic of Korea
2
Interdisciplinary Program in IT-Bio Convergence System (BK21 Plus), Sunchon National University, Suncheon 57922, Republic of Korea
3
Crop Cultivation and Environment Research Division, National Institute of Crop Science, Rural Development Administration, Suwon 16429, Republic of Korea
4
Department of Life Sciences, College of Life Sciences and Bioengineering, Incheon National University, Incheon 22012, Republic of Korea
5
Department of Research and Development, Center for Industrialization of Agricultural and Livestock Microorganisms, Jeongeup-si 56212, Republic of Korea
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
‡
These authors also contributed equally to this work.
J. Fungi 2024, 10(1), 53; https://doi.org/10.3390/jof10010053
Submission received: 14 December 2023 / Revised: 5 January 2024 / Accepted: 5 January 2024 / Published: 7 January 2024
(This article belongs to the Special Issue Fusarium, Alternaria and Rhizoctonia: A Spotlight on Fungal Pathogens)
Browse Figures
Review Reports Versions Notes

Abstract

:
Brown leaf spot disease caused by Alternaria spp. is among the most common diseases of potato crops. Typical brown spot symptoms were observed in commercial potato-cultivation areas of northern Korea from June to August 2020–2021. In total, 68 isolates were collected, and based on sequence analysis of the internal transcribed spacer (ITS) region, the collected isolates were identified as Alternaria spp. (80.9%). Phylogenetic analysis revealed that a majority of these isolates clustered within a clade that included A. alternata. Additionally, the ITS region and rpb2 yielded the most informative sequences for the identification of A. alternata. Pathogenicity tests confirmed that the collected pathogens elicited symptoms identical to those observed in the field. In pathogenicity tests performed on seven commercial cultivars, the pathogens exhibited strong virulence in both wound and non-wound inoculations. Among the cultivars tested, Arirang-1ho, Arirang-2ho, and Golden Ball were resistant to the pathogens. Furthermore, among the fungicides tested in vitro, mancozeb and difenoconazole were found to be effective for inhibiting mycelial growth. In summary, our findings suggest that A. alternata plays a critical role in leaf disease in potato-growing regions and emphasise the necessity of continuous monitoring and management to protect against this disease in Korea.

1. Introduction

Potatoes (Solanum tuberosum L.) are a staple non-cereal food crop and are the fourth-most-productive crop after maize, wheat, and rice worldwide [1]. Various pathogenic infections threaten potato crops and can lead to poor quality and reduced yield. These infections include late blight, caused by Phytophthora infestans; early blight, caused by Alternaria solani; and brown leaf spot disease, caused by Alternaria alternata [2]. In a previous study conducted in Korea, more than 60% of potato leaves exhibited brown leaf spots caused by A. alternata infection under conditions of high humidity and warm temperatures that ranged from 12 °C at night to 30 °C during the daytime [3].
Unlike early blight, potato brown leaf spot disease caused by A. alternata manifests as small, irregular, circular spots on the lower leaves, with sizes ranging from pinpoint to 12 mm, that turn into dark brown spots without concentric rings [4]. This disease occurs throughout the potato-growing season when environmental conditions are favourable for the pathogen. As the disease progresses, the entire leaf becomes chlorotic and turns brown and the leaf edges curl up, mirroring the symptoms of early blight. Eventually, the infected leaves wither and die and are left hanging from the potato plant. Dorby et al. (1984) reported that yields could be reduced by as much as 18% under conditions of high relative humidity and temperature, high pathogen density, and host susceptibility [5].
This disease has been relatively underresearched in comparison to early and late blight, two other diseases of potato plants. However, a brown spot disease caused by A. alternata has been recently reported in several countries [1,3,6,7,8]. Previous studies have reported that A. arborescens, A. tenuissima, A. tomatophila, A. grandis, A. solani, and A. alternata are the causal pathogens of brown leaf blight symptoms in potato plants [1,9,10,11].
The genus Alternaria is difficult to identify based solely on morphology, and employing the commonly used internal transcribed spacer (ITS) region for sequence-based identification remains challenging. Phylogenetic analysis using concatenated sequences offers a potential solution for resolving fungal species classification within the genus [11,12]. Woudenberg et al. (2015) generated sequences from seven loci: the ITS region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), translation elongation factor 1-alpha (tef1), RNA polymerase second-largest subunit (rpb2), Alternaria major allergen gene (Alt a 1), endopolygalacturonase (endoPG), and OPA10-1 [11]. Methods beyond traditional morphological and phylogenetic analyses that focus on these seven loci would aid in the definitive identification of Alternaria species.
Identifying the pathogen causing a disease is the first step towards its control. In a previous study, we reported that A. alternata is the causal pathogen of brown leaf spot symptoms observed during the harvest season in the potato-cultivation areas of Yeoncheon, Gyeonggi Province, Korea [3]. In this study, we employed a comprehensive set of sequences corresponding to seven loci, namely ITS, gapdh, tef1, rpb2, Alt a1, endoPG, and OPA10-1, and generated a phylogenetic tree. This approach allowed us to identify the causal pathogen as A. alternata [3]. Developing resistant potato cultivars is the most efficient strategy for effective control. However, as for potato early blight, no cultivars resistant to potato brown leaf spot have been reported to date [13]. Therefore, implementing efficient fungicide application will help mitigate the reduction in potato yield caused by this pathogen [14].
The objectives of this study were as follows: (i) to use molecular analyses to identify the predominant causal pathogen responsible for leaf blight symptoms, including leaf spots, in leaves collected from Yeoncheon, Baengnyeongdo, and Goseong between 2020 and 2021 and, if dominant pathogens were identified; (ii) to analyse the differences among the dominant species via phylogenetic analysis; (iii) to examine their pathogenicity in different potato cultivars; and (iv) to identify effective fungicides. In this study, we identified A. alternata as the primary pathogen responsible for leaf spot and blight symptoms in samples collected from the three regions from June to August 2020–2021. Furthermore, we performed a phylogenetic analysis using seven loci and found that the ITS and RPB2 loci are the most informative sequences for distinguishing this species from others in the genus and for distinguishing among strains of A. alternata.

2. Materials and Methods

2.1. Isolation of Fungal Isolates

Potato leaves that had developed symptoms were collected from the ‘Superior’ cultivar in three different regions from June to August 2020–2021. Infected tissues (5 × 5 mm) from the diseased leaf samples were immersed in 70% ethanol for 1 min, rinsed three times in sterilised water, dried, placed on water agar amended with 100 g/mL of streptomycin, and then incubated in the dark at 25 °C for 3–7 days. After hyphae emerged from the tissues, the fungal isolates were transferred onto potato dextrose agar (PDA; Difco Laboratories, Detroit, MI, USA) or V8-Juice agar medium (8% Campbell’s V8-Juice, 1.5% agar, pH adjusted to 7 using 0.1 N NaOH). All fungal strains were stored at 4 °C in sterile distilled water or were placed in long-term storage until the experiment at −80 °C in 15% glycerol in the agar blocks on which the fungi were grown.

2.2. Fungal Cultures and DNA Extraction

All the collected isolates were subjected to DNA extraction. Fungal isolates were grown in 5 mL of potato dextrose broth (Difco Laboratories, Detroit, MI, USA) at 25 °C for 7 days. Genomic DNA was isolated as described previously [15] or purified using the NucleoSpin Plant kit (Macherey-Nagel, Dűren, Germany) according to the manufacturer’s instructions. The DNA concentration was estimated using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc. Wilmington, NC, USA). The DNA concentration was adjusted to 12.5 ng/μL for each isolate and subjected to PCR amplification.

2.3. PCR and Sequencing

PCR was performed using an ABI 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA). PCR amplification was performed with 25 ng of genomic DNA and 2 pmol/L of each primer (Table 1) using the i-StarMAX II PCR master mix (iNtRON Biotechnology Inc., Seongnam, Republic of Korea). The amplification conditions were as follows: (a) initial denaturation at 96 °C for 1 min; (b) 2 cycles of denaturation at 94 °C for 1 min, annealing at 52 °C for 1 min, and elongation at 72 °C for 1 min; (c) 28 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 1 min; and (d) elongation at 72 °C for 3 min.
PCR products were resolved via 0.8% agarose gel electrophoresis and bidirectionally sequenced by the Bioneer sequencing service (Bioneer Inc., Daejeon, Republic of Korea) on both strands with the same primers used for PCR amplification. Sequence assembly was performed using the SeqMan program DNAStar (Madison, WI, USA) and CodonCode Aligner V3.5.4. software (CodonCode Co., Centerville, MA, USA). The aligned sequences were subjected to a BLASTn search in the GenBank database “http://www.ncbi.nlm.nih.gov/BLAST (accessed on 1 December 2023)”. All of the generated sequences were deposited in GenBank (Supplementary Table S1).

2.4. Phylogenetic Analysis

Phylogenetic analysis was performed on A. alternata isolates, and the dominant group was identified using ITS region sequencing. Multiple sequence alignments of the concatenated sequences were generated using ClustalX [24] and manually adjusted. Sequence divergence was estimated using the MEGA computer package version 11 [25] and the Tamura-Nei model of evolution [26]. Phylogenetic analyses of the sequence data consisted of a maximum-likelihood analysis of both the individual data partitions and the combined dataset.

2.5. Pathogenicity Test

To fulfil Koch’s postulates and confirm that these fungi could infect potato leaves, 1-month-old potato plants (S. tuberosum cultivar (cv.) Superior) grown in a 25 °C growth chamber were sprayed with a conidial suspension (1 × 106 conidia/mL) containing 250 ppm Tween 20 prepared from 7-to-14-day-old cultures of the selected Alternaria spp. isolates. Sterile distilled water was used as the control. The inoculated plants were placed in a plastic box (50 × 40 × 45 cm) to maintain high humidity and incubated in the dark at 25 °C for 1 day. The box was transferred to a growth chamber, and the plants were grown under a 16-h photoperiod with fluorescent lighting and maintained at a temperature of 25 °C and humidity >70%. Disease severity was measured 7 days after inoculation. The assay was performed in triplicate.

2.6. Virulence Test on Commercial Cultivars

Seven commercial potato cultivars, Arirang-1ho, Arirang-2ho, Golden Ball, Daekwang, Daeji, Superior, and Chubaek, were obtained from the Highland Agriculture Research Institute, National Institute of Crop Science, Rural Development Administration, Korea. The cultivars were grown in a greenhouse (23–30 °C). For large-scale screening, a detached leaf assay was performed using leaves from 45-day-old plants from all seven potato cultivars.
Healthy leaves were placed in a plastic box and maintained in a watered state using cotton. Then, a single leaf was inflicted with wounds 10 times at each of the three inoculation sites using a hand acupuncture needle (0.18 × 8 mm, Qingdao Dongbang Medical Co., Ltd., Shandong, China). The inoculum was prepared with 6-mm agar plugs from the 7-day-old A. alternata culture in a V8 juice agar medium. For inoculation, the mycelial agar plugs were placed upside down onto the detached leaves.
Inoculation was conducted in the dark at 25 °C. At 1 day post-inoculation (dpi), the inoculum was removed from the infection sites and the containers were incubated in a growth chamber (16 h light with >70% humidity and at 25 °C). The symptoms were observed at 7 dpi. An uninoculated V8 juice–agar plug was used as a control. All the experiments were performed twice. Diseased leaf area (DLA) was calculated by measuring the leaf area with observable symptoms relative to the total observed area using ImageJ software version 1.48 [27]. The formula used was as follows:
Diseased leaf area (%) = (leaf area with visible symptoms/total observed area) × 100.

2.7. In Vitro Screening of Fungicide Sensitivity

The ability of the fungicides to inhibit the radial growth of the A. alternata isolates was assayed. To select a suitable fungicide for the control of A. alternata isolates, different fungicides with varied mechanisms of action were tested: mancozeb and chlorothalonil; difenoconazole; boscalid and pydiflumetofen; kresoxim-methyl; and thiophanate-methyl (Table 2).
After the A. alternata isolates were selected, the ability of the fungicides to inhibit the radial growth of these isolates was evaluated using the agar dilution method [28]. The selected fungicide was added to the PDA medium before the medium solidified, and the mycelial plug from the edge of the hyphae was cultured for 7 days in the PDA medium using a 6 mm cork borer. After 7 days, the mycelial plugs were inoculated into the fungicide medium.
After 7 days of incubation at 25 °C, the amounts of radial growth in both the control (C, PDA) and treated (T, PDA amended with fungicide) groups were measured. The percentages of radial growth inhibition (I) and corrected inhibition (IC) were calculated as previously described [29]. In brief, two formulae were used:
I (%) = [(C − T)/C] × 100
IC (%) = [(C − T)/(C − C0)] × 100
where C is the diameter of the fungal colony from the selected isolate on the PDA plate, T is the diameter of the colony on the treated plate, and C0 is the diameter of the primary fungal mycelial disc (6 mm).

2.8. Statistical Analysis

The results of the study are presented as the mean ± standard deviation. Statistical analysis was performed using one-way analysis of variance in IBM SPSS software (Ver. 20.0, SPSS Inc., Chicago, IL, USA). Duncan’s multiple range test was used to determine significance at the 95% probability level.

3. Results

3.1. Collection of Fungal Isolates from Potato Plants with Brown Leaf Spot Disease

We investigated the occurrence of diseases affecting potatoes cultivated in three northern regions (Yeoncheon, Goseong, and Baengnyeongdo) of Korea from June and July 2020 to 2021 (Table 3). Brown leaf spot disease was observed in 2020 and 2021, with a particularly severe outbreak in Yeoncheon in 2021 (Figure 1a). The molecular identification of the isolates was performed by analysing their morphological characteristics and ITS region sequences, then cross-referencing the obtained ITS sequences with the results of the NCBI BLAST search (Table 3).
During the first round of sampling (2020), we collected 31 isolates (83.8%) of Alternaria spp. and six isolates (16.2%) of Fusarium spp. from the entire collection area. In the second round (in 2021), we collected 24 isolates (77.4%) of Alternaria spp., 2 isolates (6.5%) of Fusarium spp., 2 isolates (6.5%) of Boeremia spp., 2 isolates (6.5%) of Stagonosporopsis spp., and 1 isolate (3.2%) of Colletotrichum sp. from the same collection area. Altogether, the 68 isolates collected across the 2-year period comprised Alternaria spp. (55 isolates), Fusarium spp. (8 isolates), Boeremia spp. (2 isolates), Stagonosporopsis spp. (2 isolates), and Colletotrichum sp. (1 isolate).

3.2. Phylogenetic Analysis of Alternaria spp. Isolates Using Seven Barcoding Genes

Given that members of the Alternaria genus were the predominant fungal species detected throughout the study period, we obtained nucleotide sequences for seven barcoding genes: ITS, gapdh, tef1, rpb2, Alt a 1, endoPG, and OPA10-2, for species-level identification of the 55 selected Alternaria spp. isolates. For parts of the analysis, we used individual gene sequences (ITS (Supplementary Figure S1), gapdh (Supplementary Figure S2), tef1 (Supplementary Figure S3), rpb2 (Supplementary Figure S4), Alt a 1 (Supplementary Figure S5), endoPG (Supplementary Figure S6), and OPA10-2 (Supplementary Figure S7)). Additionally, a concatenated multigene phylogeny encompassing all seven genes was generated (Figure 2). The multigene phylogenetic tree revealed that 51 isolates corresponded to A. alternata, while the remaining four isolates comprised two strains of A. arborescens and two strains of A. solani (Figure 2). Notably, the phylogenetic tree generated from rpb2 sequences showed similar clustering (Supplementary Figure S4) to that seen in the concatenated seven-gene phylogenetic tree; two isolates (SYP-F0352 and SYP-F035) clustered with the type strain A. solani CBS109157, and two isolates (SYP-F0713 and SYP-F0714) were associated with A. arborescens CBS 102605 (Supplementary Figure S4). However, in the remaining single-gene tree, isolates of A. alternata, A. arborescens, and A. solani could not be clearly distinguished.

3.3. Pathogenicity Test

Infections caused by Alternaria spp. involve the direct invasion of host plants through the stomata and/or wounds [30]. To investigate the possibility of infection through stomata, we inoculated conidia onto the entire unwounded surface of samples from the Superior potato cultivar. Based on the results of the phylogenetic analysis, the isolates were clustered into three distinct groups, and we selected isolates from each of these the three groups for virulence testing (Figure 2): six isolates (SYP-F0939, SYP-F0942, SYP-F0934, SYP-F0941, SYP-F0944, and SYP-F0946) from Group I, one isolate (SYP-F0936) from Group II, and four isolates (SYP-F0935, SYP-F0940, SYP-F0943, and SYP-F0945) from Group III.
Disease symptoms were first observed 3 days post-inoculation (dpi) in most isolates, and severe necrotic brown spot symptoms were observed at 7 dpi. Necrosis progressed from the outer edges to the inner regions of the leaves, causing them to turn black and wilt (Figure 3). These symptoms are similar to those observed in the field (Figure 1). In particular, two strains classified in Group I, SYP-F0939 and SYP-F0942, caused severe disease, leading to the death of all inoculated potato seedlings. No symptoms were observed in the control seedlings. The isolates retrieved from all diseased leaves were confirmed to be A. alternata based on their sequences at the rpb2 locus, establishing A. alternata as the causative agent of this disease.

3.4. Virulence Test on Commercial Cultivars

Typical symptoms of Alternaria spp. infection were observed in both wounded and non-wounded leaves within 7 days of the initial exposure in the detached leaf assay. These symptoms were similar to those observed in the field. The results of the virulence test for all seven cultivars indicated that the disease incidence depended on both the potato cultivar and the A. alternata isolate in wounding and non-wounding inoculations. The control group showed no symptoms on either wounded or non-wounded leaves (Figure 4a).
Potato cv. Chubaek: typical progressive or acute symptoms included brownish-black lesions, leaf discoloration, and purple coloration in response to some isolates (Figure 4a). Among the seven cultivars tested, Chubaek was relatively abundant. The DLA rates for all isolates (12, 2, and 12 isolates selected from A. alternata groups I, II, and III, respectively, see Figure 2) were 33.2% and 52.2% with non-wounding (Figure 4b) and wounding (Figure 4c) inoculations, respectively. These results indicate the heightened susceptibility of Chubaek to the A. alternata isolates obtained from the potato fields, compared to the other six cultivars.
The potato cvs. Daekwang, Daeji, and Superior exhibited typical brownish-black lesions and halo formations (Figure 4a). The DLA rates for all isolates were 16.4%, 17.9%, and 19.3% for non-wounding inoculations and 19.6%, 31.0%, and 33.0% for wounding inoculations, respectively (Figure 4b).
The incidence of disease was the lowest in potato cvs. Arirang-1ho, Arirang-2ho, and Golden Ball inoculated with any of the isolates (Figure 4). The DLA rates of cvs. Arirang-1ho, Arirang-2ho, and Golden Ball were 1.2%, 2.2%, and 3.0%, respectively, for non-wounding inoculations (Figure 4a,b). For wounding inoculations (Figure 4c), the values were 11.5%, 12.3%, and 9.1%, respectively, indicating resistance to the disease. Consistent re-isolation of the pathogen from symptomatic plants of most cultivars confirmed A. alternata as the causative agent responsible for the observed symptoms.

3.5. Selection of Appropriate Fungicides for Potato Brown Spot Disease in Korea

In total, 10 isolates were used for the fungicide-selection experiment, with two selected from each of the three groups (I, II, and III) of A. alternata and two isolates each of A. arborescens and A. solani (Figure 2). The fungicides mancozeb and difenoconazole effectively controlled the mycelial growth of all isolates, with control rates ranging from 100% to 73.1% (Figure 5, Table 4). Pydiflumetofen and boscalid exhibited lower, yet still significant, inhibitory effects on mycelial growth compared to mancozeb and difenoconazole. In contrast, chlorothalonil, kresoxim-methyl, and thiophanate-methyl had limited effectiveness, with control of mycelial growth rates ranging from a maximum of 56% to a minimum of 3.2% (Figure 5; Table 4).

4. Discussion

This study aimed to identify the causal pathogen responsible for potato brown leaf spot in the three northern regions of Korea from June to August in 2020–2021, identify potato cultivars resistant to this pathogen, and select the most effective commercially available fungicides for controlling this pathogen in Korean potato crops.
Our results strongly suggest that A. alternata is the major pathogen responsible for brown leaf spot disease in these regions. Although A. alternata has long been reported as a major pathogen in potato-cultivation areas in Europe [31,32], the United States [6,10,13], China [1], Israel [5], South Africa [33], and Russia [34], it was first reported in Korea only in 2023 [3]. Subsequent research on the pathogen’s distribution, the presence of resistant varieties, and the selection of effective control agents against A. alternata in Korea is lacking.
The phylogenetic analysis revealed genetic disparities, showing three distinct clusters—groups I, II, and III—among A. alternata isolates. These groups were primarily distinguished based on the ITS region and the rpb2 gene. In addition, the rpb2 gene sequences were found to be highly effective in identifying strains of A. arborescens, A. solani, and A. alternata. Previous studies have highlighted employing a combination of gene sequences in phylogenetic analysis for distinguishing among Alternaria spp. [1,2,10,13,14,32], and our study accurately identified A. alternata using a set of gene sequences that included the ITS region, gapdh, tef1, rpb2, Alt a1, endoPG, and OPA 10-1. We believe that more extensive genetic information can offer deeper insights. However, despite the genotype-based clustering into groups I, II, and III, these differences did not translate into notable differences in phenotype. No significant differences were noted in pathogenicity, virulence across the seven cultivars, or sensitivity to fungicides among these genotype-based groups. This result suggests that these genetic distinctions might not be practically significant.
In the northern region of Korea, the period from late June to mid-July is a critical time for the growth and harvest of potatoes, directly impacting potential yield losses. Due to recent climate change, significant temperature fluctuations between day and night result in wet leaves and prolonged high humidity during the rainy season. These conditions may elevate the risk that potato plants will be susceptible to various pathogens, including A. alternata. Based on our survey, the data indicate that A. alternata is dominant over A. solani or P. infestans in Korea (see Table 3). In a previous study, it was noted that the occurrence of late blight decreases when the sowing date is shifted to a cooler season [35]. Therefore, it is expected that using climate-change scenarios and developing a model will enable researchers to identify actions that can be taken to decrease the prevalence of the disease.
The majority of the differences between A. alternata and A. solani or P. infestans may be attributed to chemical treatments. Choi et al. (2023) recently reported a shortage of fungicides developed to control A. alternata, the pathogen responsible for potato leaf spot disease in Korea [3]. Therefore, if a farmer sprayed fungicides on the potato field, they most likely controlled the spread of A. solani or P. infestans. Based on this information, the A. alternata isolated in this study is likely resistant to fungicides, especially considering that A. alternata was the predominant isolate. This finding is significant because both A. solani and P. infestans thrive in high humidity and at a wide range of temperatures [35,36,37]. On the other hand, it is highly likely that A. alternata is not resistant to mancozeb and chlorothalonil, which were not used in the fields. Therefore, testing for resistance to fungicides should be conducted. Additionally, although this issue was not investigated in our study, the extensive use of QoI fungicides has been reported to lead to resistance in anthracnose on pepper plants in Korea [38,39].
Notably, all 10 selected isolates exhibited resistance to the QoI fungicide, kresoxim-methyl (Figure 5; Table 4). Therefore, testing for resistance to other QoI fungicides, such as azoxystrobin, is warranted; the widespread use of QoIs in commercial potato fields in Korea has led to a high probability of resistance development in Alternaria spp. Dube et al. (2014) reported the presence of A. alternata isolates resistant to azoxystrobin, which is commonly used to control early blight [33]. These isolates had a single point mutation in the cyt b gene of the mitochondrial genome, resulting in an amino-acid substitution from glycine to alanine at position 143 (G143A) [33]. This result highlights the feasibility of confirming resistance to QoI-class pesticides through PCR amplification and sequencing. The finding of resistance emphasises the importance of continuous monitoring and management of resistant strains of Alternaria spp. to implement effective fungicide-application strategies.

5. Conclusions

This study identified A. alternata, A. arborescens, and A. solani as the causative agents of brown leaf spot disease in potatoes in Korea through phylogenetic analyses. Among these, A. alternata was found to be the major pathogen. Pathogenicity tests confirmed that all the selected isolates resulted in the same symptoms observed in the field. When inoculated with and without wounds, Arirang-1ho, Arirang-2ho, and Golden Ball exhibited resistance; Daekwang, Daeji, and Superior demonstrated moderate resistance; and Chubaek was found to be susceptible. In vitro screening identified mancozeb and difenoconazole as the most effective fungicides for inhibiting fungal growth, making them the most suitable fungicide options. Our study revealed that brown spot disease caused by A. alternata, which has been previously reported in various countries, has the potential to become a major disease affecting potato production in Korea. Further research is required to investigate the genetic diversity of this pathogen and environmental factors influencing the occurrence of this disease.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof10010053/s1, Phylogenetic tree constructed based on the ITS region (Figure S1), gapdh (Figure S2), tef1 (Figure S3), rpb2 (Figure S4), Alt a1 (Figure S5), endoPG (Figure S6), OPA 10-2 (Figure S7) sequence of the Alternaria spp.; Table S1: Isolates used in this study and their GenBank accession numbers.

Author Contributions

Conceptualization, J.P., J.C., Y.K. (Yangseon Kim) and S.-Y.P.; methodology, J.P., S.K. and S.-Y.P.; validation, J.P., S.K. and S.-Y.P.; formal analysis, J.P., S.K., M.J., S.A., M.-H.J. and S.-Y.P.; investigation, J.P., S.K., M.J., S.A., Y.K. (Youngjun Kim), J.Y. and M.-H.J.; resources, J.P. and S.-Y.P.; data curation, J.P., S.K., M.J., S.A., M.-H.J. and S.-Y.P.; writing—original draft preparation, J.P. and S.-Y.P.; writing—review and editing, S.-Y.P.; visualization, J.P., M.-H.J. and S.-Y.P.; supervision, S.-Y.P.; project administration, E.Y.K. and S.-Y.P.; funding acquisition, E.Y.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a grant from the Rural Development Administration (PJ015278022023).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and supplementary materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zheng, H.H.; Zhao, J.; Wang, T.Y.; Wu, X.H. Characterization of Alternaria species associated with potato foliar disease in China. Plant Pathol. 2016, 64, 425–433. [Google Scholar] [CrossRef]
  2. van der Waals, J.E.; Korsten, L.; Slippers, B. Genetic diversity among Alternaria solani isolated from potatoes in South Africa. Plant Dis. 2004, 88, 959–964. [Google Scholar] [CrossRef] [PubMed]
  3. Choi, J.; Jeung, M.-H.; Choi, E.D.; Park, J.; Park, S.-Y. First report of brown spot caused by Alternaria alternata on potato (Solanum tuberosum) in Korea. Plant Dis. 2023, 107, 2253. [Google Scholar] [CrossRef] [PubMed]
  4. Stevenson, W.R.; Loria, R.; Franc, G.D.; Weingartner, D.P. Compendium of Potato Diseases, 2nd ed.; The American Phytopathological Society: St. Paul, MN, USA, 2001. [Google Scholar]
  5. Dorby, S.; Dinoor, A.; Prusky, D.; Barkaigolan, R. Pathogenicity of Alternaria alternata on potato in Israel. Phytopathology 1984, 74, 537–542. [Google Scholar] [CrossRef]
  6. Fairchild, K.L.; Miles, T.D.; Wharton, P.S. Assessing fungicide resistance in population of Alternaria in Idaho potato fields. Crop Prot. 2013, 49, 31–39. [Google Scholar] [CrossRef]
  7. Soleimani, M.J.; Kirk, W. Enhance resistance to Alternaria alternata causing pototo brown leaf spot disease by using some plant defense inducers. J. Plant Prot. Res. 2012, 52, 83–90. [Google Scholar] [CrossRef]
  8. Thomma, B.P. Alternaria spp.: From general saprophyte to specific parasite. Mol. Plant Pathol. 2003, 4, 225–236. [Google Scholar] [CrossRef] [PubMed]
  9. Rodrigues, T.T.M.S.; Berbee, M.L.; Simmons, E.G.; Cardoso, C.R.; Reis, A.; Maffia, L.A.; Mizubuti, E.S.G. First report of Alternaria tomatophila and A. grandis causing early blight on tomato and potato in Brazil. New Des. Rep. 2010, 22, 28. [Google Scholar] [CrossRef]
  10. Tymon, L.S.; Cummings, T.F.; Johnson, D.A. Identification and aggressiveness of three Alternaria spp. on potato foliage in the US Northwest. Plant Dis. 2016, 100, 797–801. [Google Scholar] [CrossRef]
  11. Woudenberg, J.H.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 82, 1–21. [Google Scholar] [CrossRef]
  12. Woudenberg, J.H.; Truter, M.; Groenewald, J.Z.; Crous, P.W. Large-spored Alternaria pathogens in section Porri disentangled. Stud. Mycol. 2014, 79, 1–47. [Google Scholar] [CrossRef] [PubMed]
  13. Ding, S.; Meinholz, K.; Cleveland, K.; Jordan, S.A.; Gevens, A.J. Diversity and virulence of Alternaria spp. causing potato early blight and brown spot in Wisconsin. Phytopathology 2018, 109, 436–445. [Google Scholar] [CrossRef] [PubMed]
  14. Meng, J.W.; Zhu, W.; He, M.H.; Wu, E.J.; Duan, G.H.; Xie, Y.K.; Jin, Y.J.; Yang, L.N.; Shang, L.P.; Zhan, J. Population genetic analysis reveals cryptic sex in the phytopathogenic fungus Alternaria alternata. Sci. Rep. 2015, 5, 18250. [Google Scholar] [CrossRef] [PubMed]
  15. Chi, M.-H.; Park, S.-Y.; Lee, Y.-H. A quick and safe method for fungal DNA extraction. Plant Pathol. J. 2009, 25, 108–111. [Google Scholar] [CrossRef]
  16. de Hoog, G.S.; Gerrits van den Ende, A.H. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 1998, 41, 183–189. [Google Scholar] [CrossRef] [PubMed]
  17. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics; Academic Press: New York, NY, USA, 1990; Volume 18, pp. 315–322. [Google Scholar]
  18. Berbee, M.L.; Pirseyedi, M.; Hubbard, S. Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 1999, 91, 964–977. [Google Scholar] [CrossRef]
  19. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  20. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef]
  21. Sung, G.H.; Sung, J.M.; Hywel-Jones, N.L.; Spatafora, J.W. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 2007, 44, 1204–1223. [Google Scholar] [CrossRef]
  22. Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
  23. Hong, S.G.; Cramer, R.A.; Lawrence, C.B.; Pryor, B.M. Alt a 1 allergen homologs from Alternaria and related taxa: Analysis of phylogenetic content and secondary structure. Fungal Genet. Biol. 2005, 42, 119–129. [Google Scholar] [CrossRef] [PubMed]
  24. Andrew, M.; Peever, T.L.; Pryor, B.M. An expanded multilocus phylogeny does not resolve morphological species within the small-spored Altemrnaria species complex. Mycologia 2009, 101, 95–109. [Google Scholar] [CrossRef] [PubMed]
  25. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [PubMed]
  26. Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [PubMed]
  27. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
  28. Hanlon, A.; Taylor, M.; Dick, J. Agar Dilution Susceptibility Testing; CRC Press: Boca Raton, FL, USA, 2007. [Google Scholar]
  29. Gorai, P.S.; Ghosh, R.; Konra, S.; Mandal, N.C. Biological control of early blight disease of potato caused by Alternaria alternata EBP3 by an endophytic bacterial strain Bacillus velenzensis SEB1. Biol. Control 2021, 156, 104551. [Google Scholar] [CrossRef]
  30. Agrios, G.N. Plant Patholgy, 5th ed.; Elsevier Academic Press: Amsterdam, The Netherlands, 2005. [Google Scholar]
  31. Edin, E.; Liljeroth, E.; Andersson, B. Long term field sampling in Sweden reveal a shift in occurrence of cytochrome b genotype and amino acid substitution F129L in Alternaria solani, together with a high incidence of the G143A substitution in Alternaria alternata. Eur. J. Plant Pathol. 2019, 155, 627–641. [Google Scholar] [CrossRef]
  32. Vandecasteelea, M.; Landschoota, S.; Carrettea, J.; Verwaerena, J.; Hofte, M.; Audenaerta, K.; Haesaert, G. Species prevalence and disease progression studies demonstrate a seasonal shift in the Alternaria population composition on potato. Plant Pathol. 2018, 67, 327–336. [Google Scholar] [CrossRef]
  33. Dube, J.P.; Truter, M.; van der Waals, J.E. First report of resistance to QoI fungicides in Alternaria alternata isolates from potato in South Africa. Plant Dis. 2014, 98, 1431. [Google Scholar] [CrossRef]
  34. Kokaeva, L.Y.; Belosokhov, A.F.; Doeva, L.Y.; Skolotneva, E.S.; Elansky, S.N. Distribution of Alternaria species on blighted potato and tomato leaves in Russia. J. Plant Dis. Prot. 2018, 125, 205–212. [Google Scholar] [CrossRef]
  35. Sparks, A.H.; Forbes, G.A.; Hijmans, R.J.; Garrett, K.A. Climate change may have limited effect on global risk of potato late blight. Glob. Chang. Biol. 2014, 20, 3621–3631. [Google Scholar] [CrossRef] [PubMed]
  36. Escuredo, O.; Seijo-Rodriguez, A.; Meno, L.; Rodriguez-Flores, M.S.; Seijo, M.C. Seasonal dynamics of Alternaria during the potato growing cycle and the influence of weather on the early blight disease in North-West Spain. Am. J. Potato Res. 2019, 96, 532–540. [Google Scholar] [CrossRef]
  37. Meno, L.; Abuley, I.K.; Escuredo, O.; Seijo, M.C. Suitability of early blight forecasting systems for detecting first symptoms in potato crops of NW Spain. Agronomy 2022, 12, 1611. [Google Scholar] [CrossRef]
  38. Kim, S.; Min, J.; Kim, H.T. Mycological characteristics and field fitness of Colletotrichum acutatum resistant to pyraclostrobin. Korean J. Pestic. Sci. 2019, 23, 231–239. [Google Scholar] [CrossRef]
  39. Park, S.; Kim, H.T. Cross-resistance of Colletotrichum acutatum s. lat. to strobilurin fungicides and inhibitory effect of fungicides with other mechanisms on C. acutatum s. lat. resistant to pyraclostrobin. Res. Plant Dis. 2022, 28, 122–131. [Google Scholar] [CrossRef]
Jof 10 00053 g001
Figure 1. Naturally occurring leaf brown spot on potato plants, representatives of collected isolates, and percentage distribution of fungal isolates during 2020–2021 in Korea. (a) Brown spot symptoms on potato leaves collected from Yeoncheon (June 2021). Symptoms on the front of the leaves (left), back of the leaves (centre), and stem (right); (b) 14-day-old PDA cultures of five representative fungal species, including Alternaria spp. (far left): Fusarium spp. (second from the left), Boeremia spp. (centre), Stagonosporopsis spp. (right of centre), and Colletotrichum sp. (far right); (c) Spores of each fungus. The scale bar indicate 10 μm.
Figure 1. Naturally occurring leaf brown spot on potato plants, representatives of collected isolates, and percentage distribution of fungal isolates during 2020–2021 in Korea. (a) Brown spot symptoms on potato leaves collected from Yeoncheon (June 2021). Symptoms on the front of the leaves (left), back of the leaves (centre), and stem (right); (b) 14-day-old PDA cultures of five representative fungal species, including Alternaria spp. (far left): Fusarium spp. (second from the left), Boeremia spp. (centre), Stagonosporopsis spp. (right of centre), and Colletotrichum sp. (far right); (c) Spores of each fungus. The scale bar indicate 10 μm.
Jof 10 00053 g001
Jof 10 00053 g002
Figure 2. Phylogenetic analysis. Phylogenetic tree constructed based on concatenated sequences of ITS, gapdh, tef1, rpb2, Alt a1, endoPG, and OPA10-2 from 23 strains of Alternaria spp. Reference sequences were retrieved from GenBank (accession numbers shown in Supplementary Table S1). The tree was constructed using the maximum-likelihood method, and bootstrap values (1000 replications) are shown in front of each node. MEGA version X software was used for the analysis.
Figure 2. Phylogenetic analysis. Phylogenetic tree constructed based on concatenated sequences of ITS, gapdh, tef1, rpb2, Alt a1, endoPG, and OPA10-2 from 23 strains of Alternaria spp. Reference sequences were retrieved from GenBank (accession numbers shown in Supplementary Table S1). The tree was constructed using the maximum-likelihood method, and bootstrap values (1000 replications) are shown in front of each node. MEGA version X software was used for the analysis.
Jof 10 00053 g002
Jof 10 00053 g003
Figure 3. Pathogenicity test. One-month-old potato cultivar Superior plants were inoculated by spraying with conidial suspension (1 × 105 conidia/mL). The photographs were captured at 7 days post-inoculation.
Figure 3. Pathogenicity test. One-month-old potato cultivar Superior plants were inoculated by spraying with conidial suspension (1 × 105 conidia/mL). The photographs were captured at 7 days post-inoculation.
Jof 10 00053 g003
Jof 10 00053 g004
Figure 4. Detached leaf assay without/with wounding and box-plot analysis. (a) Detached leaf assay. Sterilised distilled water was used as the control. Isolates for the virulence test were selected from groups I, II, and III (on the left), which are identical to the groups shown in Figure 2. Box-plot analysis using diseased-leaf-area data from the virulence test (b) without wounding, and (c) with wounding. The use of the same colour in different box plots indicates no significant difference between cultivars. The line inside each box represents the median value. Outliers are shown as dots. Bars indicate the standard error of the means (n = 25).
Figure 4. Detached leaf assay without/with wounding and box-plot analysis. (a) Detached leaf assay. Sterilised distilled water was used as the control. Isolates for the virulence test were selected from groups I, II, and III (on the left), which are identical to the groups shown in Figure 2. Box-plot analysis using diseased-leaf-area data from the virulence test (b) without wounding, and (c) with wounding. The use of the same colour in different box plots indicates no significant difference between cultivars. The line inside each box represents the median value. Outliers are shown as dots. Bars indicate the standard error of the means (n = 25).
Jof 10 00053 g004
Jof 10 00053 g005
Figure 5. Effects of seven fungicides on growth rates of selected Alternaria spp. isolates causing potato brown leaf spot. Selected Alternaria spp. isolates grown for 7 days on PDA containing mancozeb (1500 μg/mL), chlorothalonil (1253 μg/mL), difenoconazole (34 µg/mL), pydiflumetofen (46 μg/mL), boscalid (328 μg/mL), kresoxim-methyl (148 μg/mL), or thiophanate-methyl (700 μg/mL).
Figure 5. Effects of seven fungicides on growth rates of selected Alternaria spp. isolates causing potato brown leaf spot. Selected Alternaria spp. isolates grown for 7 days on PDA containing mancozeb (1500 μg/mL), chlorothalonil (1253 μg/mL), difenoconazole (34 µg/mL), pydiflumetofen (46 μg/mL), boscalid (328 μg/mL), kresoxim-methyl (148 μg/mL), or thiophanate-methyl (700 μg/mL).
Jof 10 00053 g005
Table 1. Primers used for PCR and sequencing.
Table 1. Primers used for PCR and sequencing.
Locus aPrimerPrimer Sequence (5′-3′)References
ITSV9GTTACGTCCCTGCCCTTTGTA[16]
ITS4CCTCCGCTTATTGATATGC[17]
gapdhgpd1CAACGGCTTCGGTCGCATTG[18]
gpd2GCCAAGCAGTTGGTTGTGC[18]
tef1EF1-728F CATCGAGAAGTTCGAGAAGG[19]
EF1-986R TAC TTG AAG GAA CCC TTA CC[19]
EF2GGARGTACCAGTSATCATGTT[20]
rpb2RPB2-5F2GGGGWGAYCAGAAGAAGGC[21]
fRPB2-7cR CCCATRGCTTGTYYRCCCAT[22]
Alt a 1Alt-ForATGCAGTTCACCACCATCGC[23]
Alt-RevACGAGGGTGAYGTAGGCGTC[23]
endoPGPG3TACCATGGTTCTTTCCGA[24]
PG2bGAGAATTCRCARTCRTCYTGRTT[24]
OPA10-2OPA 10-2R GATTCGCAGCAGGGAAACTA[24]
OPA 10-2L TCGCAGTAAGACACA TTCTACG[24]
a ITS: internal transcribed spacer regions 1 and 2 and intervening 5.8S nrDNA, gapdh: glyceraldehyde 3-phosphate dehydrogenase, tef1: translation elongation factor 1-alpha, rpb2: RNA polymerase second largest subunit, Alt a 1: Alternaria major allergen gene, endoPG: endopolygalacturonase, and OPA10-2: anonymous region.
Table 2. Chemical names, group name, formulation, and final concentration in the medium used in the Alternaria trials.
Table 2. Chemical names, group name, formulation, and final concentration in the medium used in the Alternaria trials.
Chemical NameTarget SiteGroup NameManufacturerFormulation
(%)		Concentration Recommended by the ManufacturerFinal Conc. of Fungicide in the Medium (μg/mL)
MancozebMulti-site contact
activity		Dithiocarbamates Daeyu Co., Ltd.,
Seoul, Republic of Korea		75500-fold1500
ChlorothalonilChloronitrilesHanearl Science Ltd.,
Seoul, Republic of Korea		75600-fold1253
DifenoconazoleInhibit sterol biosynthesis in membraneC14-methylase in sterol biosynthesisHanearl Science Ltd.,
Seoul, Republic of Korea		103000-fold34
Pydiflumetofen“Complex II”
Succinate
dehydrogenase		Succinate-dehydrogenase inhibitor (SDHI)Agrigento Co.,
Kyungnam, Republic of Korea		18.351500-fold46
BoscalidSyngenta Republic of Korea,
Seoul, Republic of Korea		49.304000-fold328
Krexosim-methylInhibit mitochondrial respirationQuinone outside inhibitor (QoI)Nonghyup chemical, Seoul, Republic of Korea40.203000-fold148
Thiophanate-methylB1 tubulin
polymerization		Methyl benzimidazole carbamates (MBC)FarmHannong, Ltd., Seoul, Republic of Korea701000-fold700
Table 3. List of collected isolates, localities, species, and GenBank accession numbers for ITS region sequences.
Table 3. List of collected isolates, localities, species, and GenBank accession numbers for ITS region sequences.
IsolatesThe Closest Matching GenBank TaxaGenBank Accession Nos.Query
Over		PercentCollected RegionsDate of
Isolation
SYP-F0690Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0691Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0693Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0694Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0697Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0698Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0700Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0702Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0703Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0704Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0705Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0707Alternaria alternataOR787445.1100100Goseong26 June 2020
SYP-F0696Fusarium acuminatumMT635295.1100100Goseong26 June 2020
SYP-F0688Fusarium equisetiMT560375.1100100Goseong26 June 2020
SYP-F0689Fusarium equisetiMT560375.1100100Goseong26 June 2020
SYP-F0692Fusarium equisetiMT560375.1100100Goseong26 June 2020
SYP-F0708Fusarium equisetiMT560375.1100100Goseong26 June 2020
SYP-F0709Fusarium equisetiMT560375.1100100Goseong26 June 2020
SYP-F0347Alternaria alternataMH992147.1100100Goseong22 July 2020
SYP-F0348Alternaria alternataOR787445.1100100Goseong22 July 2020
SYP-F0349Alternaria alternataKX816031.1100100Goseong22 July 2020
SYP-F0350Alternaria alternataOR787445.110099.81Goseong22 July 2020
SYP-F0351Alternaria alternataOR787445.1100100Goseong22 July 2020
SYP-F0354Alternaria alternataOR787445.1100100Baengnyeongdo22 July 2020
SYP-F0352Alternaria solaniMT498268.1100100Baengnyeongdo22 July 2020
SYP-F0353Alternaria solaniOR787445.1100100Baengnyeongdo22 July 2020
SYP-F0937Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0938Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0939Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0940Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0941Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0942Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0943Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0944Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0945Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0946Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0947Alternaria alternataOR787445.1100100Yeoncheon27 June 2020
SYP-F0710Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0711Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0715Alternaria alternataOR687203.110099.61Yeoncheon22 June 2021
SYP-F0719Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0720Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0721Alternaria alternataOR734592.1100100Yeoncheon22 June 2021
SYP-F0722Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0723Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0725Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0726Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0728Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0731Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0737Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0740Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0741Alternaria alternataON599295.110098.33Yeoncheon22 June 2021
SYP-F0743Alternaria alternataMT498268.1100100Yeoncheon22 June 2021
SYP-F0934Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0935Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0936Alternaria alternataOR787445.1100100Yeoncheon22 June 2021
SYP-F0713Alternaria arborescensMT212228.1100100Yeoncheon22 June 2021
SYP-F0714Alternaria arborescensOR787445.1100100Yeoncheon22 June 2021
SYP-F0736Boeremia exiguaKY555024.1100100Yeoncheon22 June 2021
SYP-F0733Boeremia exiguaMT397284.1100100Yeoncheon22 June 2021
SYP-F0730Colletotrichum nymphaeaeLC435466.1100100Yeoncheon22 June 2021
SYP-F0732Fusarium equisetiMK752407.1100100Yeoncheon22 June 2021
SYP-F0734Fusarium graminearumOR346117.1100100Yeoncheon22 June 2021
SYP-F0724Stagonosporopsis dennisiiOQ158929.110099.18Yeoncheon22 June 2021
SYP-F0727Stagonosporopsis dennisiiOK315470.1100100Yeoncheon22 June 2021
SYP-F0951Alternaria alternataOR787445.1100100Baengnyeongdo19 July 2021
SYP-F0952Alternaria alternataOR787445.1100100Baengnyeongdo1 August 2021
SYP-F0953Alternaria alternataOR787445.1100100Baengnyeongdo1 August 2021
Table 4. Rates of inhibition of fungal growth by seven selected fungicides tested against Alternaria spp.
Table 4. Rates of inhibition of fungal growth by seven selected fungicides tested against Alternaria spp.
IsolatesControlMancozebDifenoconazolePydiflumetofenBoscalidChlorothalonilKresoxim-MethylThiophanate-Methyl
SYP-F09340.0 ± 0.0 g,#100.0 ± 0.0 a90.0 ± 1.6 b77.3 ± 4.2 c77.3 ± 1.6 c46.4 ± 1.6 d38.2 ± 3.1 e14.6 ± 3.1 f
SYP-F09440.0 ± 0.0 g100.0 ± 0.0 a96.3 ± 1.6 b75.7 ± 1.6 c72.9 ± 1.6 c58.0 ± 2.8 d39.3 ± 3.2 e20.6 ± 1.6 f
SYP-F09450.0 ± 0.0 f100.0 ± 0.0 a90.5 ± 1.6 b84.8 ± 3.3 c81.0 ± 1.6 c41.9 ± 1.6 d44.8 ± 4.4 d25.7 ± 2.9 e
SYP-F09360.0 ± 0.0 g100.0 ± 0.0 a87.3 ± 2.5 b75.8 ± 1.9 c68.1 ± 1.9 d40.0 ± 1.0 e3.2 ± 1.9 g10.9 ± 1.7 f
SYP-F09350.0 ± 0.0 f100.0 ± 0.0 a83.7 ± 2.7 b77.3 ± 1.6 bc80.0 ± 5.7 c51.9 ± 1.6 d55.5 ± 1.6 d28.2 ± 1.6 e
SYP-F09430.0 ± 0.0 f100.0 ± 0.0 a92.6 ± 1.6 b82.4 ± 4.2 c80.6 ± 2.8 c56.5 ± 3.2 d50.0 ± 2.8 e45.4 ± 4.2 e
SYP-F07130.0 ± 0.0 h100.0 ± 0.0 a88.1 ± 0.0 c97.0 ± 0.0 b74.3 ± 1.7 d41.6 ± 1.7 e32.7 ± 3.4 f13.9 ± 0.0 g
SYP-F07140.0 ± 0.0 f100.0 ± 0.0 a90.0 ± 8.7 b76.0 ± 3.0 c80.0 ± 1.7 c44.9 ± 1.7 d43.9 ± 1.7 d14.9 ± 1.7 e
SYP-F03520.0 ± 0.0 g100.0 ± 0.0 a89.0 ± 2.8 b79.8 ± 1.6 c79.8 ± 1.6 c52.2 ± 1.6 d43.1 ± 1.6 e14.6 ± 7.3 f
SYP-F03530.0 ± 0.0 f98.7 ± 2.2 a73.1 ± 20.0 b74.4 ± 2.2 b66.7 ± 2.2 b37.2 ± 2.2 c25.6 ± 2.2 c5.1 ± 2.2 d
Data are presented as mean ± SD from three replicates. # Duncan’s multiple range test was used to determine significance at the 95% probability level. The presence of the same letters multiple times in a column indicates no significant difference between those results.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Park, J.; Kim, S.; Jo, M.; An, S.; Kim, Y.; Yoon, J.; Jeong, M.-H.; Kim, E.Y.; Choi, J.; Kim, Y.; et al. Isolation and Identification of Alternaria alternata from Potato Plants Affected by Leaf Spot Disease in Korea: Selection of Effective Fungicides. J. Fungi 2024, 10, 53. https://doi.org/10.3390/jof10010053

AMA Style

Park J, Kim S, Jo M, An S, Kim Y, Yoon J, Jeong M-H, Kim EY, Choi J, Kim Y, et al. Isolation and Identification of Alternaria alternata from Potato Plants Affected by Leaf Spot Disease in Korea: Selection of Effective Fungicides. Journal of Fungi. 2024; 10(1):53. https://doi.org/10.3390/jof10010053

Chicago/Turabian Style

Park, Jiyoon, Seoyeon Kim, Miju Jo, Sunmin An, Youngjun Kim, Jonghan Yoon, Min-Hye Jeong, Eun Young Kim, Jaehyuk Choi, Yangseon Kim, and et al. 2024. "Isolation and Identification of Alternaria alternata from Potato Plants Affected by Leaf Spot Disease in Korea: Selection of Effective Fungicides" Journal of Fungi 10, no. 1: 53. https://doi.org/10.3390/jof10010053

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop