LTD4 and TGF-β1 Induce the Expression of Metalloproteinase-1 in Chronic Rhinosinusitis via a Cysteinyl Leukotriene Receptor 1-Related Mechanism
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Reagents
2.3. Isolation of Nasal Mucosa Fibroblasts
2.4. Cell Stimulation
2.5. Measurement of MMP-1, TIMP-1, and Cysteinyl Leukotrienes
2.6. Real-Time qPCR for CYSLT1 Receptor
2.7. Statistical Analysis
3. Results
3.1. Effect of LTC4, LTD4, and Cytokines on the Expression of CysLT1 Receptor
3.2. Effect of LTC4, LTD4, and Cytokines on the Release of Metalloproteinases
3.3. Effect of Montelukast on MMP-1 and CysLT1 Receptor Expression Induced by LTD4 and TGF-β1
4. Discussion
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Van Zele, T.; Claeys, S.; Gevaert, P.; van Maele, G.; Holtappels, G.; van Cauwenberge, P.; Bachert, C. Differentiation of chronic sinus diseases by measurement of inflammatory mediators. Allergy Eur. J. Allergy Clin. Immunol. 2006, 61, 1280–1289. [Google Scholar] [CrossRef] [PubMed]
- Watelet, J.B.; van Zele, T.; Gjomarkaj, M.; Canonica, G.W.; Dahlen, S.E.; Fokkens, W.; Lund, V.J.; Scadding, G.K.; Mullol, J.; Papadopoulos, N.; et al. Tissue remodelling in upper airways: W is the link with lower airway remodelling? Allergy 2006, 61, 1249–1258. [Google Scholar] [CrossRef] [PubMed]
- Kostamo, K.; Toskala, E.; Tervahartiala, T.; Sorsa, T. Role of matrix metalloproteinases in chronic rhinosinusitis. Curr. Opin. Allergy Clin. Immunol. 2008, 8, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Sacco, O.; Silvestri, M.; Sabatini, F.; Sale, R.; Defilippi, A.C.; Rossi, G.A. Epithelial cells and fibroblasts: Structural repair and remodelling in the airways. Paediatr. Respir. Rev. 2004, 5, S35–S40. [Google Scholar] [CrossRef]
- Nagase, H.; Visse, R.; Murphy, G. Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc. Res. 2006, 69, 562–573. [Google Scholar] [CrossRef] [PubMed]
- Murphy, G.; Nagase, H. Progress in matrix metalloproteinase research. Mol. Asp. Med. 2009, 29, 290–308. [Google Scholar] [CrossRef] [PubMed]
- Page-McCaw, A.; Ewald, A.J.; Werb, Z. Matrix metalloproteinases and the regulation of tissue remodelling. Nat. Rev. Mol. Cell Biol. 2007, 8, 221–233. [Google Scholar] [CrossRef] [PubMed]
- Demedts, I.K.; Brusselle, G.G.; Bracke, K.R.; Vermaelen, K.Y.; Pauwels, R.A. Matrix metalloproteinases in asthma and COPD. Curr. Opin. Pharmacol. 2005, 5, 257–263. [Google Scholar] [CrossRef] [PubMed]
- Funk, C.D. Prostaglandins and leukotrienes: Advances in eicosanoid biology. Science 2001, 294, 1871–1875. [Google Scholar] [CrossRef] [PubMed]
- Ogawa, Y.; Calhoun, W.J. The role of leukotrienes in airway inflammation. J. Allergy Clin. Immunol. 2006, 118, 789–798. [Google Scholar] [CrossRef] [PubMed]
- Hui, Y.; Funk, C.D. Cysteinyl leukotriene receptors. Biochem. Pharmacol. 2002, 64, 1549–1557. [Google Scholar] [CrossRef]
- Pérez-Novo, C.A.; Watelet, J.B.; Claeys, C.; Van Cauwenberge, P.; Bachert, C. Prostaglandin, leukotriene, and lipoxin balance in chronic rhinosinusitis with and without nasal polyposis. J. Allergy Clin. Immunol. 2005, 115, 1189–1196. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Novo, C.A.; Claeys, C.; Van Cauwenberge, P.; Bachert, C. Expression of eicosanoid receptors subtypes and eosinophilic inflammation: implication on chronic rhinosinusitis. Respir. Res. 2006, 7, 75. [Google Scholar] [CrossRef] [PubMed]
- Clarke, D.L.; Dakshinamurti, S.; Larsson, A.K.; Ward, J.E.; Yamasaki, A. Lipid metabolites as regulators of airway smooth muscle function. Pulm. Pharmacol. Ther. 2009, 22, 426–435. [Google Scholar] [CrossRef] [PubMed]
- Parameswaran, K.; Radford, K.; Fanat, A.; Stephen, J.; Bonnans, C.; Levy, B.D.; Janssen, L.J.; Cox, P.G. Modulation of human airway smooth muscle migration by lipid mediators and Th-2 cytokines. Am. J. Respir. Cell Mol. Biol. 2007, 37, 240–247. [Google Scholar] [CrossRef] [PubMed]
- Tokuriki, S.; Ohshima, Y.; Yamada, A.; Ohta, N.; Tsukahara, H.; Mayumi, M. Leukotriene D4 enhances the function of endothelin-1-primed fibroblasts. Clin. Immunol. 2007, 125, 88–94. [Google Scholar] [CrossRef] [PubMed]
- Yoshisue, H.; Kirkham-Brown, J.; Healy, E.; Holgate, S.T.; Sampson, A.P.; Davies, D.E. Cysteinyl leukotrienes synergize with growth factors to induce proliferation of human bronchial fibroblasts. J. Allergy Clin. Immunol. 2007, 119, 132–140. [Google Scholar] [CrossRef] [PubMed]
- Gharaee-Kermani, M.; Hu, B.; Thannickal, V.J.; Phan, S.H.; Gyetko, M.R. Current and emerging drugs for idiopathic pulmonary fibrosis. Expert. Opin. Emerg. Drugs 2007, 12, 627–646. [Google Scholar] [CrossRef] [PubMed]
- Potter-Perigo, S.; Baker, C.; Tsoi, C.; Braun, K.R.; Isenhath, S.; Altman, G.M.; Altman, L.C.; Wight, T.N. Regulation of Proteoglycan Synthesis by Leukotriene D4 and Epidermal Growth Factor in Bronchial Smooth Muscle Cells. Am. J. Respir. Cell Mol. Biol. 2004, 30, 101–108. [Google Scholar] [CrossRef] [PubMed]
- Currie, G.P.; McLaughlin, K. The expanding role of leukotriene receptor antagonists in chronic asthma. Ann. Allergy Asthma Immunol. 2006, 97, 731–742. [Google Scholar] [CrossRef]
- Kemp, J.P. Recent advances in the management of asthma using leukotriene modifiers. Am. J. Respir. Med. 2003, 2, 139–156. [Google Scholar] [CrossRef] [PubMed]
- Fukushima, C.; Matsuse, H.; Hishikawa, Y.; Kondo, Y.; Machida, I.; Saeki, S.; Kawano, T.; Tomari, S.; Obase, Y.; Shimoda, T.; Koji, T.; Kohno, S. Pranlukast, a leukotriene receptor antagonist, inhibits interleukin-5 production via a mechanism distinct from leukotriene receptor antagonism. Int. Arch. Allergy Immunol. 2005, 136, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Fokkens, W.J.; Lund, V.J.; Mullol, J.; Bachert, C.; Alobid, I.; Baroody, F.; Cohen, N.; Cervin, A.; Douglas, R.; Gevaert, P.; et al. EPOS 2012: European position paper on rhinosinusitis and nasal polyps 2012. A summary for otorhinolaryngologists. Rhinology 2012, 50, 1–12. [Google Scholar] [PubMed]
- Bousquet, J.; Clark, T.J.H.; Hurd, S.; Khaltaev, N.; Lenfant, C.; O’Byrne, P.; Sheffer, A. GINA guidelines on asthma and beyond. Allergy Eur. J. Allergy Clin. Immunol. 2007, 62, 102–112. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Novo, C.A.; Claeys, C.; Speleman, F.; van Cauwenberge, F.; Bachert, C.V.J. Impact of RNA quality on reference gene expression stability. Biotechniques 2005, 39, 52–56. [Google Scholar] [CrossRef] [PubMed]
- Hellemans, J.; Mortier, G.; de Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [PubMed]
- Eyibilen, A.; Cayli, S.; Aladag, I.; Koç, S.; Gurbuzler, L.; Atay, G.A. Distribution of matrix metalloproteinases MMP-1, MMP-2, MMP-8 and tissue inhibitor of matrix metalloproteinases-2 in nasal polyposis and chronic rhinosinusitis. Histol. Histopathol. 2011, 26, 615–621. [Google Scholar] [PubMed]
- Van Bruaene, N.; Derycke, L.; Perez-Novo, C.A.; Gevaert, P.; Holtappels, G.; de Ruyck, N.; Cuvelier, C.; van Cauwenberge, P.; Bachert, C. TGF-beta signaling and collagen deposition in chronic rhinosinusitis. J. Allergy Clin. Immunol. 2009, 124, 253–259. [Google Scholar] [CrossRef] [PubMed]
- Medina, L.; Pérez-Ramos, J.; Ramírez, R.; Selman, M.; Pardo, A. Leukotriene C4 upregulates collagenase expression and synthesis in human lung fibroblasts. BBA Mol. Cell Res. 1994, 1224, 168–174. [Google Scholar] [CrossRef]
- Rajah, R.; Nunn, S.E.; Herrick, D.J.; Grunstein, M.M.; Cohen, P. Leukotriene D4 induces MMP-1, which functions as an IGFBP protease in human airway smooth muscle cells. Am. J. Physiol. 1996, 271, L1014–L1022. [Google Scholar] [PubMed]
- Kato, J.; Kohyama, T.; Okazaki, H.; Desaki, M.; Nagase, T.; Rennard, S.I.; Takizawa, H. Leukotriene D4 potentiates fibronectin-induced migration of human lung fibroblasts. Clin. Immunol. 2005, 117, 177–181. [Google Scholar] [CrossRef] [PubMed]
- Vannella, K.M.; McMillan, T.R.; Charbeneau, R.P.; Wilke, C.A.; Thomas, P.E.; Toews, G.B.; Peters-Golden, M.; Moore, B.B. Cysteinyl leukotrienes are autocrine and paracrine regulators of fibrocyte function. J. Immunol. 2007, 179, 7883–7890. [Google Scholar] [CrossRef] [PubMed]
- Asakura, T.; Ishii, Y.; Chibana, K.; Fukuda, T. Leukotriene D4 stimulates collagen production from myofibroblasts transformed by TGF-β. J. Allergy Clin. Immunol. 2004, 114, 310–315. [Google Scholar] [CrossRef] [PubMed]
- Steinke, J.W.; Crouse, C.D.; Bradley, D.; Hise, K.; Lynch, K.; Kountakis, S.E.; Borish, L. Characterization of Interleukin-4-Stimulated Nasal Polyp Fibroblasts. Am. J. Respir. Cell Mol. Biol. 2004, 30, 212–219. [Google Scholar] [CrossRef] [PubMed]
- Reiss, T.F.; Chervinsky, P.; Dockhorn, R.J.; Shingo, S.; Seidenberg, B.; Edwards, T.B. Montelukast, a once-daily leukotriene receptor antagonist, in the treatment of chronic asthma: A multicenter, randomized, double-blind trial. Montelukast Clinical Research Study Group. Arch. Intern. Med. 1998, 158, 1213–1220. [Google Scholar] [CrossRef] [PubMed]
- Reiss, T.F.; Sorkness, C.A.; Stricker, W.; Botto, A.; Busse, W.W.; Kundu, S.; Zhang, J. Effects of montelukast (MK-0476); a potent cysteinyl leukotriene receptor antagonist, on bronchodilation in asthmatic subjects treated with and without inhaled corticosteroids. Thorax 1997, 52, 45–48. [Google Scholar] [CrossRef] [PubMed]







| Gene | Forward Primer 5′ → 3′ | Reverse Primer 5′ → 3′ | Amplicon Size (bp) | GenBank Accession Number |
|---|---|---|---|---|
| CysLT1 | TCCTTAGAATGCAGAAGTCCGTG | AAATATAGGAGAGGGTCAAAGCAA | 80 | NM_001282187 |
| ACTB | CTGGAACGGTGAAGGTGACA | AAGGGACTTCCTGTAACAATGCA | 139 | NM_001101.3 |
| HMBS | GGCAATGCGGCTGCAA | GGGTACCCACGCGAATCAC | 154 | NM_000190.3 |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pezato, R.; Claeys, C.; Holtappels, G.; Bachert, C.; Pérez-Novo, C.A. LTD4 and TGF-β1 Induce the Expression of Metalloproteinase-1 in Chronic Rhinosinusitis via a Cysteinyl Leukotriene Receptor 1-Related Mechanism. Sinusitis 2016, 1, 65-75. https://doi.org/10.3390/sinusitis1010065
Pezato R, Claeys C, Holtappels G, Bachert C, Pérez-Novo CA. LTD4 and TGF-β1 Induce the Expression of Metalloproteinase-1 in Chronic Rhinosinusitis via a Cysteinyl Leukotriene Receptor 1-Related Mechanism. Sinusitis. 2016; 1(1):65-75. https://doi.org/10.3390/sinusitis1010065
Chicago/Turabian StylePezato, Rogerio, Cindy Claeys, Gabriele Holtappels, Claus Bachert, and Claudina A. Pérez-Novo. 2016. "LTD4 and TGF-β1 Induce the Expression of Metalloproteinase-1 in Chronic Rhinosinusitis via a Cysteinyl Leukotriene Receptor 1-Related Mechanism" Sinusitis 1, no. 1: 65-75. https://doi.org/10.3390/sinusitis1010065
APA StylePezato, R., Claeys, C., Holtappels, G., Bachert, C., & Pérez-Novo, C. A. (2016). LTD4 and TGF-β1 Induce the Expression of Metalloproteinase-1 in Chronic Rhinosinusitis via a Cysteinyl Leukotriene Receptor 1-Related Mechanism. Sinusitis, 1(1), 65-75. https://doi.org/10.3390/sinusitis1010065
