Next Article in Journal
Highly Pathogenic Avian Influenza (HPAI H5Nx, Clade 2.3.4.4.b) in Poultry and Wild Birds in Sweden: Synopsis of the 2020–2021 Season
Previous Article in Journal
Expression Analysis of Outer Membrane Protein HPS_06257 in Different Strains of Glaesserella parasuis and Its Potential Role in Protective Immune Response against HPS_06257-Expressing Strains via Antibody-Dependent Phagocytosis
Previous Article in Special Issue
Humoral Responses and Ex Vivo IFN-γ Production after Canine Whole Blood Stimulation with Leishmania infantum Antigen or KMP11 Recombinant Protein
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Spotted Fever Group Rickettsia spp. Diversity in Ticks and the First Report of Rickettsia hoogstraalii in Romania

by
Talida Ivan
1,
Ioana Adriana Matei
2,*,
Cristiana Ștefania Novac
2,
Zsuzsa Kalmár
2,3,4,
Silvia-Diana Borșan
5,
Luciana-Cătălina Panait
5,
Călin Mircea Gherman
5,
Angela Monica Ionică
4,
Ionel Papuc
1 and
Andrei Daniel Mihalca
5
1
Department of Semiology, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, 400372 Cluj-Napoca, Romania
2
Department of Microbiology, Immunology and Epidemiology, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, 400372 Cluj-Napoca, Romania
3
Department of Infectious Diseases, Iuliu Hațieganu University of Medicine and Pharmacy Cluj-Napoca, 400347 Cluj-Napoca, Romania
4
Clinical Hospital of Infectious Diseases of Cluj-Napoca, 400003 Cluj-Napoca, Romania
5
Department of Parasitology and Parasitic Diseases, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, 400372 Cluj-Napoca, Romania
*
Author to whom correspondence should be addressed.
Vet. Sci. 2022, 9(7), 343; https://doi.org/10.3390/vetsci9070343
Submission received: 6 June 2022 / Revised: 5 July 2022 / Accepted: 6 July 2022 / Published: 8 July 2022
(This article belongs to the Special Issue Advances in Vector-Borne Zoonotic Diseases)

Simple Summary

Ticks are important parasites that feed on the blood of various host species, representing the most important arthropods transmitting diseases in Europe. Continuous changes in both tick distribution and abundance are related to multiple factors, including climate change. These changes have strong implications for both animal and human health; therefore, continuous surveillance of tickborne diseases is required for an appropriate evaluation of the potential risks faced by animals and humans in a given area. The spotted fever group Rickettsia comprises a large number of zoonotic agents with an increasing importance recognized in the last 30 years. The aim of this study was to evaluate these bacteria in ticks in Romania. Five Rickettsia species were identified in different tick species, with new pathogen–tick associations reported. Rickettsia hoogstraalii, one member of this group, was detected for the first time in Romania and in Rhipicephalus rossicus ticks. This species was first described in 2006 in Croatia, and its pathogenicity is not well known. In addition, the detection of R. raoultii and R. monacensis in unfed larvae of Haemaphysalis punctata reinforce the hypothesis of transmission of Rickettsia from female ticks to larvae; therefore the bite of larvae could pose a health risk.

Abstract

Tickborne bacterial pathogens have been described worldwide as risk factors for both animal and human health. Spotted fevers caused by Rickettsiae may cause non-specific symptoms, which make clinical diagnosis difficult. The aim of the current study was to evaluate and review the diversity of SFG Rickettsiae in ticks collected in 41 counties in Romania. A total of 2028 questing and engorged ticks collected in Romania belonging to five species were tested by PCR amplification of Rickettsia spp. gltA and 17-D gene fragments: Ixodes ricinus (n = 1128), Dermacentor marginatus (n = 507), D. reticulatus (n = 165), Rhipicephalus rossicus (n = 128) and Haemaphysalis punctata (n = 100). Five Rickettsia species were identified following DNA sequence analysis: R. helvetica, R. monacensis, R. slovaca, R. raoultii, and R. hoogstraalii. The most common species detected was R. monacensis. Moreover, R. hoogstraalii was detected for the first time in Romania and in R. rossicus ticks. The detection of R. raoultii and R. monacensis in questing larvae of Hae. punctata suggests the possible transovarial transmission of these Rickettsia species in ticks. The detection of R. hoogstraalii for the first time in Romania increases the reported SFG Rickettsia diversity in the country.

1. Introduction

Among the most common vectors of disease in Europe, ticks are important hematophagous ectoparasites with a worldwide distribution and the ability to transmit a wide variety of pathogens [1]. The population and community structure, as well as their abundance, are related to the geographical origin and are influenced by various abiotic and biotic factors [2,3,4]. The continuous changes in both tick distribution and abundance are related to multiple factors, such as climate change, habitat alterations, biodiversity loss, and globalisation [5,6]. In addition, land use has direct effects on the ecosystem through cross interactions between pathogens, hosts, and reservoirs, thus enabling the exposure of hosts to potential pathogens [7]. In addition, some tick species (e.g., Ixodes ricinus) possess a broad ecological plasticity, with increased capacity to exploit anthropic landscapes, which has led to the emergence and re-emergence of several tickborne diseases, with strong implications for both animal and human health [8,9]. Considering the ongoing changes in the above-mentioned factors and their effects on both ticks and their associated pathogens, continuous surveillance of tickborne diseases is required for an appropriate evaluation of the potential risks faced by animals and humans in a given area.
The spotted fever group (SFG) of the Rickettsia genus comprises a large number of zoonotic agents. The importance of the recognized tick-associated rickettsial pathogens has increased in the last 30 years. Moreover, the pathogenicity for humans of several species has been continuously described, and novel Rickettsia species of undetermined pathogenicity have been detected in ticks around the world [10,11]. Rickettsia spp. are Gram-negative bacteria with intracellular development [12] belonging to the Class α-proteobacteria, Order Rickettsiales, Family Rickettsiaceae [13]. Rickettsia are transmitted mainly through arthropod vectors, with an important number being transmitted by ticks [14]. In Europe, the majority of Rickettsia infections are tickborne [15]. Rickettsia species of medical concern detected in I. ricinus, one of the most widespread tick species in Europe [16], include R. helvetica [17], R. monacensis, R. raoultii [18,19], R. slovaca, and R. sibirica mongolitimonae [19]. In addition, agents with unknown pathogenicity, such as: Candidatus “R. mendelii” [20], R. bellii, and Rickettsia endosymbiont of Lasioglossum semilucens bee [21] have been reported in this tick species in countries such as the Czech Republic [20], Germany [14], Poland [21], and Sweden [19].
Other ticks, such as Rhipicephalus sanguineus [14], R. pumilio, R. turanicus [17], Dermacentor spp. [14], and Hyalomma marginatum [22], have been shown or suggested to be involved in the circulation and transmission of other Rickettsia spp., such as R. conorii conorii [14], R. raoultii, R. slovaca [14], R. monacensis, R. helvetica [15], R. aeschlimannii [14,17], or Candidatus “Rickettsia uralica” [23].
Divided into five biogeographical regions with 21 ecoregions, Romania is a country with high biodiversity [24], including an important variety of tick species and potential tick vertebrate hosts [25,26]. This diversity in both tick species and vertebrates is expected to result in a high diversity of tick-associated pathogens. Despite increasing efforts, the data regarding diversity and distribution of Rickettsia species across Romania remain scarce, most studies being either limited to a small sampling area or focused on engorged ticks. To date, several SFG Rickettsia have been reported in questing or engorged ticks and less in tissue samples in Romania (Table 1).
Currently, seven out of the eight tickborne rickettsiae with known pathogenicity to humans are present in Europe (except R. sibirica mongolitimonae) and also reported in Romania [14] (Table 1), highlighting an increased risk to public health. However, because most SFG Rickettsia spp. are detected in ticks collected from different hosts (Table 1), the epidemiology of these pathogens in Romania remains poorly described. Therefore, the aim of the present study was to evaluate the diversity of the SFG Rickettsia species, mainly in questing ticks and engorged ticks, in different geographical areas of Romania.

2. Materials and Methods

2.1. Tick Collection and Identification

A total of 2028 questing and engorged ticks were collected as part of several studies on related topics conducted between March 2010 and May 2020. The selection of samples included in the present study was based on geographical coverage, collection data (the newest samples available), DNA concentration, and tick species. Ticks were identified at the species level by stereomicroscopic examination based on morphological and dichotomous characteristics [40]. After identification, all ticks were preserved individually in 70% ethanol and stored at −20 °C.
A total of 1128 I. ricinus ticks included in this study were questing ticks collected by flagging from 183 points in 72 localities in all 41 Romanian counties (Figure 1) as part of a previous study [26]. Ticks from the aforementioned study were first randomly selected to cover the entire territory of Romania. In all selected samples, the DNA concentration was measured to exclude inappropriate samples with low DNA concentration (<30 ng/µL).
Additionally, a total of 672 Dermacentor spp. questing ticks collected by flagging were included in this study, namely 507 D. marginatus and 165 D. reticulatus, all female and male adults. The collection was performed in five counties in northern and northwestern Romania [27].
Similarly, a total of 100 Hae. punctata questing ticks were collected by flagging, including larvae, nymphs, and adults. The ticks were collected from six urban and peri-urban sampling sites in Cluj-Napoca forests [28]
Considering the lack of data on SFG Rickettsia in R. rossicus [41], a tick present in the steppe region of southeastern Romania [42], R. rossicus collected from owned dogs (Canis familiaris) in three locations in Tulcea county were also included in the study. Overall, 128 R. rossicus adults were analysed.

2.2. DNA Extraction

DNA extraction was performed using the ISOLATE II genomic DNA kit (Bioline, UK) in compliance with the manufacturer’s instructions. For accuracy and to avoid cross contamination, negative controls were used during each step. DNA from ticks was extracted individually based on species, developmental stage, and location. The concentration and purity of the DNA extract were evaluated in a representative number of samples through a random procedure using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA).

2.3. Polymerase Chain Reaction (PCR)

Rickettsia spp. DNA amplification protocols were performed using specific primers; initially, primers amplifying a gltA gene fragment [43] were used for Dermacentor spp. ticks, whereas for the remaining tick species, a nested protocol was carried out, using specific primers amplifying 17-kDa outer-membrane gene fragments [44] (Table 2).
Each reaction mix was performed in a volume of 25 µL consisting of 4 µL DNA isolate, 6.5 µL distilled water, 12.5 µL PCR Master Mix (Rovalab), and 1 µL of each diluted primer (10 pmol/µL). Instead of the DNA isolate, 1 µL PCR product was used for the nested protocol. The analysis was performed using a T1000 thermal cycler (Bio-Rad, Berkeley, CA, USA).
The amplification profile for gltA consisted of 5 min of initial denaturation at 95 °C, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 53 °C for 30 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min.
For 17-kDa outer-membrane gene amplification, the profile consisted of an initial denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 61 °C for 30 s, elongation at 72 °C for 45 s, and a final elongation at 72 °C for 5 min. The nested step followed the same profile with an annealing temperature of 54 °C.
In each PCR reaction set with 96 samples, 3 positive and 3 negative controls were used, which were randomly placed in the plate to assess the specificity of the reaction and the presence of possible cross contamination. The negative control had the same composition as the mixture to be analysed, with 4 µL PCR water instead of DNA. The positive controls consisted of Rickettsia spp. DNA confirmed by sequencing [32].
PCR products were visualized after electrophoresis in 1.5% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen, Waltham, MA, USA) addition. Migration occurred at a continuous current intensity of 110 mA, 100 V, for 30–45 min.

2.4. DNA Sequencing

After purifying the PCR products using a FavorPrep™ GEL/PCR purification kit (FAVORGEN-Europe, Wien, Austria), positive amplicons were sequenced at Macrogen Europe BV, Amsterdam, Netherlands. Sequence analysis was performed using Geneious® 9.1.2 software (Auckland, New Zealand) and compared to the sequences present in the GenBank database through BLASTn analysis of the gltA and 17-kDa outer-membrane gene fragment sequences (http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 16 May 2022).

2.5. Statistical Analysis

Data were statistically analysed using Epi Info 7 software (CDC, Atlanta, GA, USA). The infection prevalence of Rickettsia spp., the 95% confidence interval, and infection prevalence based on tick species, developmental stage, sex, and location were analysed using the chi-square independence test. A p-value ≤ 0.05 was considered significant.

3. Results

A total of 2028 ticks were individually analysed by PCR for the presence of Rickettsia spp. The ticks included in the study belonged to five species: I. ricinus, D. marginatus, D. reticulatus, H. punctata, and R. rossicus. All developmental stages were assessed for I. ricinus and H. punctata, and only adults were assessed in the case of Dermacentor spp. and R. rossicus (Table 3).
The overall SFG Rickettsia spp. infection prevalence was 5.82% (118/2028; 95% CI: 4.88–6.92). Although the prevalence varied considerably (between 7 and 24.22%; Table 3) between tick species due to uneven sample collection, the prevalence rates were not compared.
The differences in SFG Rickettsia spp. prevalence in different developmental stages were analysed for Hae. punctata and I. ricinus, from which all developmental stages were available for analysis and a similar prevalence was observed for all except I. ricinus larvae, in which no Rickettsia spp. DNA was found (Table 3).
Infection with Rickettsia spp. was detected in 22 of the 41 Romanian counties (53.66%; 95% CI: 37.42–69.34), with a variable prevalence ranging between 1.35% and 50% (Table 4, Figure 1). Differences in prevalence rates among counties were evaluated only in the case of I. ricinus. A significant difference between counties was registered for R. helvetica (x2 = 156.87, d.f. = 32, p < 0.0001) and R. monacensis (x2 = 106.45, d.f. = 32, p < 0.0001).
According to BLAST analysis, the most prevalent species was R. monacensis, with a prevalence of 43.22% (51/118; 95% CI: 34.13–52.66%) of the total positive ticks. The sequences showed a 97.7–100% similarity with various strains (e.g., Acc. No. MF491748, GU827099) isolated in I. ricinus from different European countries. Rickettsia monacensis was detected in I. ricinus (7 females, 11 males, and 12 nymphs), R. rossicus (12 females and 2 males), and Hae. punctata (1 male, 2 nymphs, and 1 larva) ticks, without a significant difference between tick species, developmental stage, or sex. This species was detected in ticks in 16 counties (Figure 1).
The second most prevalent species detected was R. helvetica, representing 38.14% (45/118, 95% CI: 29.35–47.53) of the positive ticks, with a similarity of 99–100% with various strains (e.g., Acc. No. KY319214, GU827035) isolated from I. ricinus from different European countries. Rickettsia helvetica was detected in I. ricinus (12 females, 13 males, and 10 nymphs) and R. rossicus ticks (6 females and 4 males), without any significant differences. This species was detected in ticks originating from 15 counties (Figure 1).
Rickettsia raoultii was identified in 15.25% of the positive ticks (18/118, 95% CI: 9.3–23.03%), with a 99–100% similarity to a strain (Acc. No. JX683120) isolated from D. marginatus in Romania. Rickettsia raoultii was detected in D. marginatus (4 females and 4 males), I. ricinus (2 males and 3 nymphs), R. rossicus (2 females and 1 male), and Hae. punctata ticks (1 male, nymph, and larva), without a significant difference. This species was detected in ticks originating from nine counties (Figure 1).
Rickettsia slovaca had a 1.69% prevalence (2/118, 95% CI: 0.21–5.99%), with a similarity of 99.7–100% with a strain (Acc. No. JX683122) isolated from D. marginatus in Romania. It was detected only in D. marginatus ticks (1 female and 1 male), without a significant difference. This species was detected in ticks originating from two counties (Figure 1).
The sequence isolated from one R. rossicus collected from a dog representing 0.85% (1/118, 95% CI: 0.02–4.63%) of positive ticks showed a 99% similarity with R. hoogstraalii, various strains (Acc. No. FJ767736, MT010837, MH383145, MN1501180) isolated from Hae. sulcata in Croatia, Argas transgariepinus in Namibia and South Africa, and Amblyomma transversale in the United Arab Emirates.
In one case, the sequence isolated from I. ricinus presented low quality and remained unidentified.

4. Discussion

Although several studies have been published, data regarding the presence of Rickettsia spp. and their epidemiological situation in Romania remain poorly defined. In addition, the geographical distribution and species diversity of ticks in different countries are continuously changing [14,45,46]. To the best of our knowledge, this study represents the first detection of SFG Rickettsia spp. in R. rossicus adults and Hae. punctata larvae and the first report of R. hoogstraalii in Romania.
The overall Rickettsia spp. prevalence detected in the present study was around 5%, similar to the results reported in other studies in Europe [14,17]. The Rickettsia spp. prevalence was similar in adult and immature stages. In the present study, R. monacensis and R. raoultii were detected in Hae. punctata larvae, which highlights the possible transovarial transmission of these pathogens. Similarly, R. monacensis and R. helvetica have been previously detected in I. ricinus larvae [14,47,48].
A difference in Rickettsia spp. prevalence between sexes was observed only in R. rossicus ticks collected from hosts (33% in females vs. 13.5% in males). This difference may be explained by the different feeding behaviour, with females feeding on a larger volume of blood and for a longer period compared to males [49]. However, in this case, the same difference would be expected for the other Ixodidae species.
Rickettsia spp. were detected in more than half of the counties, showing a wide distribution of these pathogens across Romania. Five counties registered a high prevalence (≥20%). However, the number and diversity of collected ticks varied among the counties, making an appropriate interpretation of the results difficult. The importance of the wide distribution and high prevalence is driven by the zoonotic potential of most SFG Rickettsia detected to date in Europe [14,46]
In the present study, five different SFG Rickettsia species were identified, some of which were associated with R. rossicus for the first time. Among these, four species (i.e., R. helvetica, R. monacensis, R. slovaca, and R. raoultii) are recognised as human pathogens, and three (R. helvetica, R. monacensis, and R. raoultii) can be transmitted by I. ricinus [14,46], which is also the most common tick feeding on humans in Romania [50].
Although I. ricinus and D. marginatus are well-known vectors of SFG Rickettsia [14,17], in the present study, the tick species that displayed the highest diversity of Rickettsia was R. rossicus, followed by Hae. punctata. However, in the case of R. rossicus, the DNA origin could be either the blood meal (R. rossicus were collected from dogs) or the tick. However, the high prevalence obtained in R. rossicus, with the majority of positive ticks collected from different individuals, does not support the blood origin. In addition, dogs are known host of only a few SFG Rickettsia, such as R. conorii [14,17,51], R. rickettsii [52], R. parkeri [53], and R. japonica [54].
The most often detected species in the present study was R. monacensis. To the best of our knowledge, this study represents its first detection in R. rossicus ticks and Hae. punctata larvae. Considered one of the most common species of Rickettsia in Europe [55], R. monacensis was detected in Turkey [56], Spain [57], the Netherlands [58], and Serbia [59], as well as and with a lower prevalence in Iceland, Russia, Italy, and Sweden [60,61,62,63]. This species is transmitted by I. ricinus, and it was isolated from humans and lizards, which were suggested as reservoir hosts [14,17]. The previous detection of R. monacensis in different tick species collected from dogs, including R. rossicus in the present study, suggest either the implication of other species as possible vectors [64] or the possible infection of dogs with this rickettsia.
The second most prevalent rickettsia species was R. helvetica, detected in I. ricinus and R. rossicus. Similar to R. monacensis, the main vector is I. ricinus [65]. This Rickettsia species is common in Europe, being detected over most of its territory [14]. Concerns about this species are substantiated by the impact it has on human health, as described in several studies [66,67,68,69].
Other species identified in our study, such as R. raoultii and R. slovaca, are also important human pathogens, being the causative agents of SENLAT (scalp eschar and neck lymphadenopathy), with implications for both animal and human health [70]. In Romania, SENLAT was detected in several patients [37]. The most frequently involved tick species in transmitting infection is D. marginatus [71], followed by D. reticulatus [72]. The presence of SENLAT agents was also reported in Hae. inermis, Hae. bispinosa [73], and I. ricinus [74]. This pathogen was reported in Spain [75], Hungary [76], France [71], Italy [77], Bulgaria [78], and Poland [79].
In one case, the sequence analysis of a Rickettsia spp. isolated from one engorged male of R. rossicus was identified as R. hoogstraalii. Rickettsia hoogstraalii was isolated for the first time in 2006 in Hae. sulcata ticks collected from sheep and goats in Croatia [80] as well as Carios capensis ticks from the United States [81]. Since then, it has been detected in hard ticks collected from domestic and wild ruminants across Europe, in Spain (in Hae. Punctata and Hae. sulcata), Cyprus (Hae. punctata), Italy, Sardinia (Hae. Punctata and Hae. sulcata), Greece (Hae. parva and Hae. sulcata), Turkey (Hae. parva), and Georgia (Hae. sulcata and D. marginatus) [57,82,83,84,85,86]. It has been also detected in other tick species, mainly Argasidae, in different parts of the world, including Japan [87], Ethiopia [88] the western Indian Ocean islands [89], Iran [90], Namibia [91], Zambia [92], China [93], and the UAE [94]. The pathogenic potential of Rickettsia hoogstraalii is poorly understood and is considered similar to R. felis [95]. In addition, it was reported to cause a cytopathic effect in Vero, CCE3, and ISE6 cells [80].
This study represents both the first detection of R. hoogstraalii in R. rossicus and the first detection of this Rickettsia species in Romania. Nevertheless, the obtained short 17-kDa outer membrane gene sequence does not allow for a clear conclusion with respect to this detection. In addition, further studies should be conducted to evaluate the pathogenicity of R. hoogstraalii for mammals, as well as the involvement of R. rossicus as a possible vector species.

5. Conclusions

In this study, we reported a wide distribution of SFG Rickettsia across Romania, including well-known human pathogens, such as R. helvetica, R. raoultii, and R. slovaca, or possible zoonotic pathogens, such as R. monacensis and R. hoogstraalii, raising concerns about the risks posed to public health.
The detection of R. monacensis and R. raoultii in Hae. punctata questing larvae strongly suggests the transovarial transmission of these pathogens and supports the possible involvement of this tick species as a vector.
The detection of R. hoogstraalii, R. helvetica, R. monacensis, and R. raoultii in R. rossicus ticks collected from dogs suggests either the possible involvement of this tick species as a vector for multiple SFG Rickettsia or the possible infection of dogs with these species.
Further studies are required to confirm the presence of R. hoogstraalii in Romania. Moreover, the transovarial transmission of SFG Rickettsia in Hae. punctata ticks and the vectorial implication of R. rossicus or dogs as reservoir hosts for multiple SFG Rickettsia species require additional research to be confirmed.

Author Contributions

Conceptualization, I.P. and A.D.M.; methodology, I.A.M.; software, T.I. and A.M.I.; validation, I.P., C.M.G., and A.D.M.; formal analysis, T.I. and Z.K.; investigation, T.I., S.-D.B., and L.-C.P.; resources, I.A.M. and A.D.M.; writing—original draft preparation, T.I. and I.A.M. writing—review and editing, C.Ș.N.; supervision, I.P. and A.D.M.; project administration, I.A.M. and A.D.M.; funding acquisition. I.A.M. and A.D.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by CNCS-UEFISCDI, grant number PD34/2018 and PCCDI 57/2018.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Publication was supported by funds from the National Research Development Projects to finance excellence (PFE)-14 (ID 546) granted by the Romanian Ministry of Research, Innovation and Digitalization.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ginsberg, H.S.; Faulde, M.K. Ticks; World Health Organization, Regional Office for Europe: Copenhagen, Denmark, 2008; pp. 303–345. ISBN 9789289071888.
  2. Dantas-Torres, F.; Chomel, B.B.; Otranto, D. Ticks and tick-borne diseases: A One Health perspective. Trends Parasitol. 2012, 28, 437–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Tagliapietra, V.; Rosà, R.; Arnoldi, D.; Cagnacci, F.; Capelli, G.; Montarsi, F.; Hauffe, H.C.; Rizzoli, A. Saturation deficit and deer density affect questing activity and local abundance of Ixodes ricinus (Acari, Ixodidae) in Italy. Vet. Parasitol. 2011, 183, 114–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Hofmeester, T.R.; Sprong, H.; Jansen, P.A.; Prins, H.H.; Van Wieren, S.E. Deer presence rather than abundance determines the population density of the sheep tick, Ixodes ricinus, in Dutch forests. Parasites Vectors 2017, 10, 433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Ogden, N.H.; Lindsay, L.R. Effects of climate and climate change on vectors and vector-borne diseases: Ticks are different. Trends Parasitol. 2016, 32, 646–656. [Google Scholar] [CrossRef] [Scilit]
  6. Titcomb, G.; Allan, B.F.; Ainsworth, T.; Henson, L.; Hedlund, T.; Pringle, R.M.; Palmer, T.M.; Njoroge, L.; Campana, M.G.; Fleischer, R.C.; et al. Interacting effects of wildlife loss and climate on ticks and tick-borne disease. Proc. R. Soc. B Biol. Sci. 2017, 284, 20170475. [Google Scholar] [CrossRef] [Scilit]
  7. Allen, T.; Murray, K.A.; Zambrana-Torrelio, C.; Morse, S.S.; Rondinini, C.; Di Marco, M.; Breit, N.; Olival, K.J.; Daszak, P. Global Hotspots and Correlates of Emerging Zoonotic Diseases. Nat. Commun. 2017, 8, 1124. [Google Scholar] [CrossRef] [Scilit]
  8. Rosà, R.; Andreo, V.; Tagliapietra, V.; Baráková, I.; Arnoldi, D.; Hauffe, H.C.; Manica, M.; Rosso, F.; Blaňarová, L.; Bona, M.; et al. Effect of climate and land use on the spatio-temporal variability of tick-borne bacteria in Europe. Int. J. Environ. Res. Public Health 2018, 15, 732. [Google Scholar] [CrossRef] [Scilit]
  9. Boulanger, N.; Boyer, P.; Talagrand-Reboul, E.; Hansmann, Y. Ticks and tick-borne diseases. Med. Mal. Infect. 2019, 49, 87–97. [Google Scholar] [CrossRef] [Scilit]
  10. Moonga, L.C.; Hayashida, K.; Mulunda, N.R.; Nakamura, Y.; Chipeta, J.; Moonga, H.B.; Namangala, B.; Sugimoto, C.; Mtonga, Z.; Mutengo, M.; et al. Molecular Detection and Characterization of Rickettsia asembonensis in Human Blood, Zambia. Emerg. Infect. Dis. 2021, 27, 2237. [Google Scholar] [CrossRef] [Scilit]
  11. Souza, U.A.; Fagundes-Moreira, R.; Costa, F.B.; Alievi, M.M.; Labruna, M.B.; Soare, J.F. Rickettsia amblyommatis-infected Amblyomma coelebs parasitizing a human traveler in Rio Grande do Sul, southern Brazil, after returning from the Amazon. Travel Med. Infect. Dis. 2022, 10, 102328. [Google Scholar] [CrossRef] [Scilit]
  12. Stothard, D.R.; Clark, J.B.; Fuerst, P.A. Ancestral Divergence of Rickettsia bellii from the Spotted Fever and Typhus Groups of Rickettsia and Antiquity of the Genus Rickettsia. Int. J. Syst. Bacteriol. 1994, 44, 798–804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Schoch, C.L.; Ciuofo, S.; Domrachev, M.; Hotton, C.; Kannan, S.; Khovanskaya, R.; Leipe, D.; Mcveigh, R.; O’Neill, K.; Robbertse, B.; et al. NCBI Taxonomy: A Comprehensive Update on Curation, Resources and Tools. Database (Oxford). 2020. Available online: https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=780&lvl=3&keep=1&srchmode=1&unlock (accessed on 10 April 2022).
  14. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Portillo, A.; Santibáñez, S.; García-Álvarez, L.; Palomar, A.M.; Oteo, J.A. Rickettsioses in Europe. Microbes Infect. 2015, 17, 834–838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Otranto, D.; Dantas-Torres, F.; Santos-Silvia, M.M. Ixodes ricinus (Linnaeus, 1758). In Ticks of Europe and North Africa, a Guide to Species Identification; Estrada-Peña, A., Mihalca, A.D., Petney, T., Eds.; Springer: Cham, Switzeland, 2017; pp. 189–197. [Google Scholar]
  17. Borawski, K.; Dunaj, J.; Pancewicz, S.; Król, M.; Czupryna, P.; Moniuszko-Malinowska, A. Tick-borne rickettsioses in Europe–A review. Prz. Epidemiol. 2019, 73, 523–530. [Google Scholar]
  18. Klitgaard, K.; Kjær, L.J.; Isbrand, A.; Hansen, M.F.; Bødker, R. Multiple infections in questing nymphs and adult female Ixodes ricinus ticks collected in a recreational forest in Denmark. Ticks Tick Borne Dis. 2019, 10, 1060–1065. [Google Scholar] [CrossRef] [Scilit]
  19. Wallménius, K.; Pettersson, J.H.O.; Jaenson, T.G.; Nilsson, K. Prevalence of Rickettsia spp., Anaplasma phagocytophilum, and Coxiella burnetii in adult Ixodes ricinus ticks from 29 study areas in central and southern Sweden. Ticks Tick Borne Dis. 2012, 3, 100–106. [Google Scholar] [CrossRef] [Scilit]
  20. Hajduskova, E.; Literak, I.; Papousek, I.; Costa, F.B.; Novakova, M.; Labruna, M.B.; Zdrazilova-Dubska, L. ‘Candidatus Rickettsia mendelii’, a novel basal group rickettsia detected in Ixodes ricinus ticks in the Czech Republic. Ticks Tick Borne Dis. 2016, 7, 482–486. [Google Scholar] [CrossRef] [Scilit]
  21. Stańczak, J.; Biernat, B.; Racewicz, M.; Zalewska, M.; Matyjasek, A. Prevalence of different Rickettsia spp. in Ixodes ricinus and Dermacentor reticulatus ticks (Acari: Ixodidae) in north-eastern Poland. Ticks Tick Borne Dis. 2018, 9, 427–434. [Google Scholar] [CrossRef] [Scilit]
  22. Hornok, S.; Csörgő, T.; Fuente, J.; Gyuranecz, M.; Privigyei, C.; Meli, M.L.; Kreizinger, Z.; Gönczi, E.; Fernandez de Mera, I.G.; Hofmann-Lehmann, R. Synanthropic birds associated with high prevalence of tick-borne rickettsiae and with the first detection of Rickettsia aeschlimannii in Hungary. Vector-Borne Zoonotic Dis. 2013, 13, 77–83. [Google Scholar] [CrossRef] [Scilit]
  23. Vikentjeva, M.; Geller, J.; Remm, J.; Golovljova, I. Rickettsia spp. in rodent-attached ticks in Estonia and first evidence of spotted fever group Rickettsia species Candidatus Rickettsia uralica in Europe. Parasites Vectors 2021, 14, 65. [Google Scholar] [CrossRef] [Scilit]
  24. National Environment Protection Agency. Annual Report 2020. Available online: http://www.anpm.ro/habitate-si-specii (accessed on 10 April 2022).
  25. Mihalca, A.D.; Dumitrache, M.O.; Magdaş, C.; Gherman, C.M.; Domşa, C.; Mircean, V.; Ghira, I.V.; Pocora, V.; Ionescu, D.T.; Barabási, S.S.; et al. Synopsis of the hard ticks (Acari: Ixodidae) of Romania with update on host associations and geographical distribution. Exp. Appl. Acarol. 2012, 58, 183–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Mihalca, A.D.; Gherman, C.M.; Magdaş, C.; Dumitrache, M.O.; Györke, A.; Sándor, A.D.; Domşa, C.; Oltean, M.; Mircean, V.; Mărcuţan, D.I.; et al. Ixodes ricinus is the dominant questing tick in forest habitats in Romania: The results from a countrywide dragging campaign. Exp. Appl. Acarol. 2012, 58, 175–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Matei, I.; Mihalca, A.; Nadăş, G.; Fiţ, N. Testing two PCR protocols targeting different genes to detect SFG Rickettsia DNA in ticks samples. Vet. Med. 2018, 49, 146–149. [Google Scholar]
  28. Borşan, S.D.; Ionică, A.M.; Galon, C.; Toma-Naic, A.; Peştean, C.; Sándor, A.D.; Moutailler, S.; Mihalca, A.D. High Diversity, Prevalence, and Co-infection Rates of Tick-Borne Pathogens in Ticks and Wildlife Hosts in an Urban Area in Romania. Front. Microbiol. 2021, 12, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Raileanu, C.; Moutailler, S.; Porea, D.; Oslobanu, L.; Anita, D.; Anita, A.; Vayssier-Taussat, M.; Savuta, G. Molecular evidence of Rickettsia spp., Anaplasma phagocytophilum, and “Candidatus Neoehrlichia mikurensis” in ticks from natural and urban habitats in Eastern Romania. Vector-Borne Zoonotic Dis. 2018, 18, 343–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Ioniţă, M.; Mitrea, I.L.; Pfister, K.; Hamel, D.; Silaghi, C. Molecular evidence for bacterial and protozoan pathogens in hard ticks from Romania. Vet. Parasitol. 2013, 196, 71–76. [Google Scholar] [CrossRef] [Scilit]
  31. Mărcuţan, I.D.; Kalmár, Z.; Ionică, A.M.; D’Amico, G.; Mihalca, A.D.; Vasile, C.; Sándor, A.D. Spotted fever group rickettsiae in ticks of migratory birds in Romania. Parasites Vectors 2016, 9, 294–301. [Google Scholar] [CrossRef] [Scilit]
  32. Matei, I.A.; Kalmár, Z.; Lupşe, M.; D’Amico, G.; Ionică, A.M.; Dumitrache, M.O.; Gherman, C.M.; Mihalca, A.D. The risk of exposure to rickettsial infections and human granulocytic anaplasmosis associated with Ixodes ricinus tick bites in humans in Romania: A multiannual study. Ticks Tick Borne Dis. 2017, 8, 375–378. [Google Scholar] [CrossRef] [Scilit]
  33. Andersson, M.O.; Marga, G.; Banu, T.; Dobler, G.; Chitimia-Dobler, L. Tick-borne pathogens in tick species infesting humans in Sibiu County, central Romania. Parasitol. Res. 2018, 117, 1591–1597. [Google Scholar] [CrossRef] [Scilit]
  34. Ioniţă, M.; Silaghi, C.; Mitrea, I.L.; Edouard, S.; Parola, P.; Pfister, K. Molecular detection of Rickettsia conorii and other zoonotic spotted fever group rickettsiae in ticks, Romania. Ticks Tick Borne Dis. 2016, 7, 150–153. [Google Scholar] [CrossRef] [Scilit]
  35. Andersson, M.O.; Tolf, C.; Tamba, P.; Stefanache, M.; Radbea, G.; Frangoulidis, D.; Tomaso, H.; Waldenström, J.; Dobler, G.; Chitimia-Dobler, L. Molecular survey of neglected bacterial pathogens reveals an abundant diversity of species and genotypes in ticks collected from animal hosts across Romania. Parasites Vectors 2018, 11, 144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Matei, I.A.; Corduneanu, A.; Sándor, A.D.; Ionică, A.M.; Panait, L.; Kalmár, Z.; Ivan, T.; Papuc, I.; Bouari, C.; Fit, N.; et al. Rickettsia spp. in bats of Romania: High prevalence of Rickettsia monacensis in two insectivorous bat species. Parasites Vectors 2021, 14, 1–8. [Google Scholar] [CrossRef] [Scilit]
  37. Zaharia, M.; Popescu, C.P.; Florescu, S.A.; Ceausu, E.; Raoult, D.; Parola, P.; Socolovschi, C. Rickettsia massiliae infection and SENLAT syndrome in Romania. Ticks Tick Borne Dis. 2016, 7, 759–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Pitigoi, D.; Olaru, I.D.; Badescu, D.; Rafila, A.; Arama, V.; Hristea, A. Mediterranean spotted fever in southeastern Romania. Biomed. Res. Int. 2013, 2013, 395806. [Google Scholar] [CrossRef] [Scilit]
  39. Serban, R.; Pistol, A.; Neguţ, M.; Cucuiu, R. Rickettsia conorii infection in Romania, 2000–2008. Bacteriol. Virusol. Parazitol. Epidemiol. 2009, 54, 177–183. [Google Scholar]
  40. Estrada-Peña, A.; Mihalca, A.D.; Petney, T.N. Ticks of Europe and North Africa: A Guide to Species Identification; Springer: Cham, Switzeland, 2017; pp. 1–403. [Google Scholar]
  41. Mihalca, A.D.; Kalmár, Z.; Dumitrache, M.O. Rhipicephalus rossicus, a neglected tick at the margin of Europe: A review of its distribution, ecology and medical importance. Med. Vet. Entomol. 2015, 29, 215–224. [Google Scholar] [CrossRef] [Scilit]
  42. Sándor, A.D.; Dumitrache, M.O.; D’Amico, G.; Kiss, B.J.; Mihalca, A.D. Rhipicephalus rossicus and not R. sanguineus is the dominant tick species of dogs in the wetlands of the Danube Delta, Romania. Vet. Parasitol. 2014, 204, 430–432. [Google Scholar] [CrossRef] [Scilit]
  43. Regnery, R.L.; Spruill, C.L.; Plikaytis, B. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [Scilit]
  44. Leitner, M.; Yitzhaki, S.; Rzotkiewicz, S.; Keysary, A. Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples. Am. J. Trop. Med. Hyg. 2002, 67, 166–169. [Google Scholar] [CrossRef] [Scilit]
  45. Parola, P.; Raoult, D. Ticks and tick borne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [Scilit]
  46. De Vito, A.; Geremia, N.; Mameli, S.M.; Fiore, V.; Serra, P.A.; Rocchitta, G.; Nuvoli, S.; Spanu, A.; Lobrano, R.; Cossu, A.; et al. Epidemiology, clinical aspects, laboratory diagnosis and treatment of rickettsial diseases in the mediterranean area during COVID-19 pandemic: A review of the literature. Mediterr. J. Hematol. 2020, 12, e2020056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Sprong, H.; Wielinga, P.R.; Fonville, M.; Reusken, C.; Brandenburg, A.H.; Borgsteede, F.; Gaasenbeek, C.; van der Giessen, J.W. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species. Parasites Vectors 2009, 2, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Tomassone, L.; Ceballos, L.A.; Ragagli, C.; Martello, E.; De Sousa, R.; Stella, M.C.; Mannelli, A. Importance of common wall lizards in the transmission dynamics of tick-borne pathogens in the northern Apennine Mountains, Italy. Microb. Ecol. 2017, 74, 961–968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Anderson, J.F.; Magnarelli, L.A. Biology of ticks. Infect. Dis. Clin. N. Am. 2008, 22, 195–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Briciu, V.T.; Titilincu, A.; Tatulescu, D.F.; Carstina, D.; Lefkaditis, M.; Mihalca, A.D. First survey on hard ticks Ixodidae collected from humans in Romania:possible risks for tick-borne diseases. Exp. Appl. Acarol. 2011, 54, 199–204. [Google Scholar] [CrossRef] [Scilit]
  51. Levin, M.L.; Killmaster, L.F.; Zemtsova, G.E. Domestic dogs (Canis familiaris) as reservoir hosts for Rickettsia conorii. Vector-Borne Zoonotic Dis. 2012, 12, 28–33. [Google Scholar] [CrossRef] [Scilit]
  52. Kidd, L.; Maggi, R.; Diniz, P.P.V.P.; Hegarty, B.; Tucker, M.; Breitschwerdt, E. Evaluation of conventional and real-time PCR assays for detection and differentiation of spotted fever group Rickettsia in dog blood. Vet. Microbiol. 2008, 129, 294–303. [Google Scholar] [CrossRef] [Scilit]
  53. Tomassone, L.; Conte, V.; Parrilla, G.; De Meneghi, D. Rickettsia infection in dogs and Rickettsia parkeri in Amblyomma tigrinum ticks, Cochabamba Department, Bolivia. Vector-Borne Zoonotic Dis. 2010, 10, 953–958. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Satoh, H.; Motoi, Y.; Camer, G.A.; Inokuma, H.; Izawa, M.; Kiyuuna, T.; Kumazawa, N.; Muramatsu, Y.; Ueno, H.; Morita, C. Characterization of spotted fever group rickettsiae detected in dogs and ticks in Okinawa, Japan. Microbiol. Immunol. 2002, 46, 257–263. [Google Scholar] [CrossRef] [Scilit]
  55. Heyman, P.; Cochez, C.; Hofhuis, A.; Van Der Giessen, J.; Sprong, H.; Porter, S.R.; Losson, B.; Saegerman, C.; Donoso-Mantke, O.; Niedrig, M.; et al. A clear and present danger: Tick-borne diseases in Europe. Expert Rev. Anti-Infect. Ther. 2010, 8, 33–50. [Google Scholar] [CrossRef] [Scilit]
  56. Gargili, A.; Palomar, A.M.; Midilli, K.; Portillo, A.; Kar, S.; Oteo, J.A. Rickettsia species in ticks removed from humans in Istanbul, Turkey. Vector-Borne Zoonotic Dis. 2012, 12, 938–941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Márquez, F.J. Spotted fever group Rickettsia in ticks from southeastern Spain natural parks. Exp. Appl. Acarol. 2008, 45, 185–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Tijsse-Klasen, E.; Jacobs, J.J.; Swart, A.; Fonville, M.; Reimerink, J.H.; Brandenburg, A.H.; van der Giessen, J.W.; Hofhuis, A.; Sprong, H. Small risk of developing symptomatic tick-borne diseases following a tick bite in The Netherland. Parasites Vectors 2011, 4, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Radulović, Ž.; Chochlakis, D.; Tomanović, S.; Milutinović, M.; Tselentis, Y.; Psaroulaki, A. First detection of spotted fever group Rickettsiae in ticks in Serbia. Vector-Borne Zoonotic Dis. 2011, 11, 111–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Franke, J.; Fritzsch, J.; Tomaso, H.; Straube, E.; Dorn, W.; Hildebrandt, A. Coexistence of pathogens in host-seeking and feeding ticks within a single natural habitat in Central Germany. Appl. Environ. Microbiol. 2010, 76, 6829–6836. [Google Scholar] [CrossRef] [Scilit]
  61. Movila, A.; Reye, A.L.; Dubinina, H.V.; Tolstenkov, O.O.; Toderas, I.; Hübschen, J.M.; Muller, C.P.; Alekseev, A.N. Detection of Babesia sp. EU1 and members of spotted fever group rickettsiae in ticks collected from migratory birds at Curonian Spit, North-Western Russia. Vector-Borne Zoonotic Dis. 2011, 11, 89–91. [Google Scholar] [CrossRef] [Scilit]
  62. Floris, R.; Yurtman, A.N.; Margoni, E.F.; Mignozzi, K.; Boemo, B.; Altobelli, A.; Cinco, M. Detection and identification of Rickettsia species in the northeast of Italy. Vector-Borne Zoonotic Dis. 2008, 8, 777–782. [Google Scholar] [CrossRef] [Scilit]
  63. Elfving, K.; Olsen, B.; Bergström, S.; Waldenström, J.; Lundkvist, Å.; Sjöstedt, A.; Mejlon, H.; Nilsson, K. Dissemination of spotted fever rickettsia agents in Europe by migrating birds. PLoS ONE 2010, 5, 8572. [Google Scholar] [CrossRef] [Scilit]
  64. Sgroi, G.; Iatta, R.; Lia, R.P.; Napoli, E.; Buono, F.; Bezerra-Santos, M.A.; Veneziano, V.; Otranto, D. Tick exposure and risk of tick-borne pathogens infection in hunters and hunting dogs: A citizen science approach. Transbound. Emerg. Dis. 2021. [Google Scholar] [CrossRef] [Scilit]
  65. Oteo, J.A.; Portillo, A. Tick-borne rickettsioses in Europe. Ticks Tick Borne Dis. 2012, 3, 271–278. [Google Scholar] [CrossRef] [Scilit]
  66. Fournier, P.E.; Allombert, C.; Supputamongkol, Y.; Caruso, G.; Brouqui, P.; Raoult, D. Aneruptive fever associated with antibodies to Rickettsia helvetica in Europe and Thailand. J. Clin. Microbiol. 2004, 42, 816–818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Boretti, F.S.; Perreten, A.; Meli, M.L.; Cattori, V.; Willi, B.; Wengi, N.; Hornok, S.; Honegger, H.; Hegglin, D.; Woelfel, R.; et al. Molecular Investigations of Rickettsia helvetica infection in dogs, foxes, humans, and Ixodes ticks. Appl. Environ. Microbiol. 2009, 75, 3230–3237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Nilsson, K.; Lindquist, O.; Påhlson, C. Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet 1999, 354, 1169–1173. [Google Scholar] [CrossRef] [Scilit]
  69. Brouqui, P.; Parola, P.; Fournier, P.E.; Raoult, D. Spotted fever rickettsioses in southern and eastern Europe. FEMS Microbiol. Immunol. 2007, 49, 2–12. [Google Scholar] [CrossRef] [Scilit]
  70. Angelakis, E.; Pulcini, C.; Waton, J.; Imbert, P.; Socolovschi, C.; Edouard, S.; Dellamonica, P.; Raoult, D. Scalp eschar and neck lymphadenopathy caused by Bartonella henselae after tick bite. Clin. Infect. Dis. 2010, 50, 549–551. [Google Scholar] [CrossRef] [Scilit]
  71. Raoult, D.; Berbis, P.H.; Roux, V.; Xu, W.; Maurin, M. A new tick-transmitted disease due to Rickettsia slovaca. Lancet 1997, 350, 112–113. [Google Scholar] [CrossRef] [Scilit]
  72. Chmielewski, T.; Podsiadly, E.; Karbowiak, G.; Tylewska-Wierzbanowska, S. Rickettsia spp. in ticks, Poland. Emerg. Infect. Dis. 2009, 15, 486–488. [Google Scholar] [CrossRef] [Scilit]
  73. Kho, K.L.; Tan, P.E.; Tay, S.T. Diversity of rickettsiae in feeding and questing ticks collected from a Malaysian forest reserve area. J. Med. Entomol. 2019, 56, 547–552. [Google Scholar] [CrossRef] [Scilit]
  74. Boldiš, V.; Štrus, J.; Kocianová, E.; Tušek-Žnidarič, M.; Štefanidesová, K.; Schwarzová, K.; Kúdelová, M.; Sekeyová, Z.; Špitalská, E. Life cycle of Rickettsia slovaca in L929 cell line studied by quantitative real-time PCR and transmission electron microscopy. FEMS Microbiol. Lett. 2009, 293, 102–106. [Google Scholar] [CrossRef] [Scilit]
  75. Revuelta, J.A.O.; Cucalón, V.I.; Ramos, J.R.B. Eritema, necrosis y linfedenopatía: Una nueva enfermedad transmitida por “Dermacentor marginatus” Sulzer, 1776. Zubía 2000, 12, 49–58. [Google Scholar]
  76. Lakos, A. Tick-borne lymphadenopathy—A new rickettsial disease? Lancet 1997, 350, 1006. [Google Scholar] [CrossRef] [Scilit]
  77. Selmi, M.; Bertolotti, L.; Tomassone, L.; Mannelli, A. Rickettsia slovaca in Dermacentor marginatus and tick-borne lymphadenopathy, Tuscany, Italy. Emerg. Infect. Dis. 2008, 14, 817–820. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Komitova, R.; Lakos, A.; Aleksandrov, A.; Christova, I.; Murdjeva, M. A case of tick-transmitted lymphadenopathy in Bulgaria associated with Rickettsia slovaca. Scand. J. Infect. Dis. 2003, 35, 213. [Google Scholar] [CrossRef] [Scilit]
  79. Switaj, K.; Chmielewski, T.; Borkowski, P.; Tylewska-Wierzbanowska, S.; Olszynska-Krowicka, M. Spotted fever rickettsiosis caused by Rickettsia raoultii–case report. Prz. Epidemiol. 2012, 66, 347–350. [Google Scholar]
  80. Duh, D.; Punda-Polic, V.; Avsic-Zupanc, T.; Bouyer, D.; Walker, D.H.; Popov, V.L.; Jelovsek, M.; Gracner, M.; Trilar, T.; Bradaric, N.; et al. Rickettsia hoogstraalii sp. nov., isolated from hard-and soft-bodied ticks. Int. J. Syst. Evol. Microbiol. 2010, 60, 977–984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  81. Mattila, J.T.; Burkhardt, N.Y.; Hutcheson, H.J.; Munderloh, U.G.; Kurtti, T.J. Isolation of cell lines and a rickettsial endosymbiont from the soft tick Carios capensis (Acari: Argasidae: Ornithodorinae). J. Med. Entomol. 2007, 44, 1091–1101. [Google Scholar] [CrossRef] [Scilit]
  82. Chochlakis, D.; Ioannou, I.; Sandalakis, V.; Dimitriou, T.; Kassinis, N.; Papadopoulos, B.; Tselentis, Y.; Psaroulaki, A. Spotted fever group Rickettsiae in ticks in Cyprus. Microb. Ecol. 2012, 63, 314–323. [Google Scholar] [CrossRef] [Scilit]
  83. Chisu, V.; Leulmi, H.; Masala, G.; Piredda, M.; Foxi, C.; Parola, P. Detection of Rickettsia hoogstraalii, Rickettsia helvetica, Rickettsia massiliae, Rickettsia slovaca and Rickettsia aeschlimannii in ticks from Sardinia, Italy. Ticks Tick Borne Dis. 2017, 8, 347–352. [Google Scholar] [CrossRef] [Scilit]
  84. Orkun, Ö.; Karaer, Z.; Çakmak, A.; Nalbantoğlu, S. Spotted fever group rickettsiae in ticks in Turkey. Ticks Tick Borne Dis. 2014, 5, 213–218. [Google Scholar] [CrossRef] [Scilit]
  85. Moraga-Fernández, A.; Chaligiannis, Ι.; Cabezas-Cruz, A.; Papa, A.; Sotiraki, S.; de la Fuente, J.; G Fernández de Mera, I. Molecular identification of spotted fever group Rickettsia in ticks collected from dogs and small ruminants in Greece. Exp. Appl. Acarol. 2019, 78, 421–430. [Google Scholar] [CrossRef] [Scilit]
  86. Sukhiashvili, R.; Zhgenti, E.; Khmaladze, E.; Burjanadze, I.; Imnadze, P.; Jiang, J.; John, H.S.; Farris, C.M.; Gallagher, T.; Obiso, R.J.; et al. Identification and distribution of nine tick-borne spotted fever group rickettsiae in the country of Georgia. Ticks Tick Borne Dis. 2020, 11, 101470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  87. Kawabata, H.; Ando, S.; Kishimoto, T.; Kurane, I.; Takano, A.; Nogami, S.; Fujita, H.; Tsurumi, M.; Nakamura, N.; Sato, F.; et al. First detection of Rickettsia in soft-bodied ticks associated with seabirds, Japan. Microbiol. Immunol. 2006, 50, 403–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  88. Pader, V.; Buniak, J.N.; Abdissa, A.; Adamu, H.; Tolosa, T.; Gashaw, A.; Cutler, R.R.; Cutler, S.J. Candidatus Rickettsia hoogstraalii in Ethiopian Argas persicus ticks. Ticks Tick Borne Dis. 2012, 3, 338–345. [Google Scholar] [CrossRef] [Scilit]
  89. Dietrich, M.; Lebarbenchon, C.; Jaeger, A.; Le Rouzic, C.; Bastien, M.; Lagadec, E.; McCoy, K.D.; Pascalis, H.; Le Corre, M.; Dellagi, K.; et al. Rickettsia spp. in seabird ticks from western Indian Ocean islands, 2011–2012. Emerg. Infect. Dis. 2010, 20, 838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. Kooshki, H.; Goudarzi, G.; Faghihi, F.; Telmadarraiy, Z.; Edalat, H.; Hosseini-Chegeni, A. The first record of Rickettsia hoogstraalii (Rickettsiales: Rickettsiaceae) from Argas persicus (Acari: Argasidae) in Iran. Syst. Appl. Acarol. 2020, 25, 1611–1617. [Google Scholar] [CrossRef] [Scilit]
  91. Reeves, W.K.; Mans, B.J.; Durden, L.A.; Miller, M.M.; Gratton, E.M.; Laverty, T.M. Rickettsia hoogstraalii and a Rickettsiella from the Bat Tick Argas transgariepinus, in Namibia. J. Parasitol. Res. 2020, 106, 663–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  92. Qiu, Y.; Simuunza, M.; Kajihara, M.; Chambaro, H.; Harima, H.; Eto, Y.; Simulundu, E.; Squarre, D.; Torii, S.; Takada, A.; et al. Screening of tick-borne pathogens in argasid ticks in Zambia: Expansion of the geographic distribution of Rickettsia lusitaniae and Rickettsia hoogstraalii and detection of putative novel Anaplasma species. Ticks Tick Borne Dis. 2021, 12, 101720. [Google Scholar] [CrossRef] [Scilit]
  93. Duan, D.Y.; Liu, Y.K.; Liu, L.; Liu, G.H.; Cheng, T.Y. Microbiome analysis of the midguts of different developmental stages of Argas persicus in China. Ticks Tick Borne Dis. 2022, 13, 101868. [Google Scholar] [CrossRef] [Scilit]
  94. Hornok, S.; Kontschán, J.; Takács, N.; Chaber, A.L.; Halajian, A.; Szekeres, S.; Sándor, A.D.; Plantard, O. Rickettsiaceae in two reptile-associated tick species, Amblyomma exornatum and Africaniella transversale: First evidence of Occidentia massiliensis in hard ticks (Acari: Ixodidae). Ticks Tick Borne Dis. 2022, 13, 101830. [Google Scholar] [CrossRef] [Scilit]
  95. Pascucci, I.; Antognini, E.; Canonico, C.; Montalbano, M.G.; Necci, A.; di Donato, A.; Moriconi, M.; Morandi, B.; Morganti, G.; Crotti, S.; et al. One Health Approach to Rickettsiosis: A Five-Year Study on Spotted Fever Group Rickettsiae in Ticks Collected from Humans, Animals and Environment. Microorganisms 2021, 10, 35. [Google Scholar] [CrossRef] [Scilit]
Figure 1. The prevalence, diversity, and geographic distribution of Rickettsia spp. in ticks in Romania.
Figure 1. The prevalence, diversity, and geographic distribution of Rickettsia spp. in ticks in Romania.
Vetsci 09 00343 g001
Table 1. Overview of Rickettsia species in questing and engorged ticks, as well as vertebrate host tissues, in Romania.
Table 1. Overview of Rickettsia species in questing and engorged ticks, as well as vertebrate host tissues, in Romania.
Rickettsia spp.Tick SpeciesHost SpeciesCountyReference
Questing ticks
Rickettsia spp. 1D. marginatus, D. reticulatus-Cluj[27,28]
R. helvetica 1I. ricinus, Hae. punctata-Cluj[28]
I. ricinus-Iași, Tulcea[29]
R. monacensis 1I. ricinus-Iași, Tulcea[29]
I. ricinus, Hae. punctata-Cluj[28]
R. raoultii 1D. reticulatus-Iași[29]
R. conorii 1Hae. punctata-Cluj[28]
Ticks collected from hosts
R. helvetica 1I. ricinusBos taurus, Equus caballusIlfov, Prahova[30]
I. ricinus, I. arboricola, I. redikorzeviErithacus rubecula, Panurus biarmicus, Turdus merula, T. philomelosConstanța[31]
I. ricinusHomo sapiensCluj[32]
I. ricinusH. sapiensSibiu[33]
I. ricinus, I. hexagonusErinaceus roumanicusCluj[28]
I. ricinusE. rubecula, T. merulaCluj[28]
I. ricinusTalpa europeaCluj[28]
R. monacensis 1I. ricinusCanis familiarisIlfov[34]
I. ricinus, I. arboricola, Hae. concinnaE. rubecula, T. merula, T. philomelosConstanța[31]
I. ricinusH. sapiensCluj[32]
I. ricinusH. sapiensSibiu[33]
I. ricinus, D. reticulatus, R. sanguineusC. familiaris, Felis catus, Ovis aries, Vulpes vulpesSatu-Mare, Călărași, Ilfov, Timiș, Dâmbovița, Mehedinți[35]
I. ricinus, I. hexagonus, Hae. punctataE. roumanicusCluj[28]
Hae. concinaSturnus vulgarisCluj[28]
R. raoultii 1D. marginatusB. taurus, O. ariesDâmbovița, Satu-Mare, Vâlcea[30]
D. reticulatusC. familiarisIlfov[34]
D. marginatusH. sapiensSibiu[33]
D. marginatus, D. reticulatus, R. sanguineusC. familiaris, Capra hircus, O. ariesIlfov, Călărași, Covasna, Dâmbovița, Bistrița-Năsăud, Mehedinți, Vâlcea[35]
R. slovaca 1D. marginatusB. taurusDâmbovița[30]
D. reticulatusC. familiarisIlfov[34]
I. ricinusT. merulaConstanța[31]
I. ricinus, D. marginatus, R. sanguineusC. familiaris, Capra hircus, O. aries, V. vulpesCălărași, lfov, Covasna, Timiș, Mehedinți, Vâlcea[35]
R. aeschlimannii 1Hy. marginatumB. taurusBistrița-Năsăud[35]
Hae. concinaS. vulgarisCluj[28]
R. conorii 1R. sanguineusC. familiarisIlfov[34]
R. felis 1I. ricinusT. merulaCluj[28]
R. massiliae 1I. ricinus, I. arboricolaT. philomelosConstanța[31]
Vertebrate host tissues
R. helvetica 1-
-
Parus major, Corvus frugilegusCluj[28]
E. roumanicusCluj[28]
R. monacensis 1-T. merulaCluj[28]
-Apodemus agrarius, A. sylvaticus, Mus musculusCluj[28]
-Pipistrellus pipistrellus, Nyctalus noctulaAlba, Neamț[36]
R. slovaca 2-H. sapiensIlfov[37]
R. massiliae2-H. sapiensIlfov[37]
R. slovaca/R. raoultii 2-H. sapiensIlfov[37]
R. conorii 3-H. sapiensUnspecified[38]
R. conorii 3-H. sapiensUnspecified[39]
1 Molecular detection, 2 Western blot, 3 Immunofluorescence.
Table 2. Primers used for the detection of Rickettsiales DNA in ticks.
Table 2. Primers used for the detection of Rickettsiales DNA in ticks.
Fragments of GenesNames of GeneCitations
Rsfg877: GGGGGCCTGCTCACGGCGGgltA[43]
Rsfg1258: ATTGCAAAAAGTACAGTGAACA
rickP3: GGAACACTTCTTGGCGGTG17-kDa[44]
rickP2: CATTGTCCGTCAGGTTGGCG
rickP5: GCATTACTTGGTTCTCAATTCGG
rickP4: AACCGTAATTGCCGTTATCCGG
Table 3. Rickettsia spp. prevalence and its distribution according to tick species, developmental stage, and sex.
Table 3. Rickettsia spp. prevalence and its distribution according to tick species, developmental stage, and sex.
Tick sp.OriginDevelopmental StageSexPrevalence % (n/Total)95% CI
Haemaphysalis punctataQuestingADF7.14% (1/14)0.18–33.87
M7.14% (1/14)0.18–33.87
N 6.98% (3/43)1.46–19.06
L6.9% (2/29)3.99–10.04
Total7.00% (7/100)5.02–7.87
Ixodes ricinusQuestingADM6.84% (27/395)4.74–9.76
F6.55% (19/290)3.99–10.04
N 5.83% (25/429)3.98–8.46
L0% (0/14)NA
Total6.29% (71/1128)2.86–13.89%
Dermacentor marginatusQuestingADF1.98% (5/253)0.64–4.55%
M1.57% (4/254)0.43–3.98%
Total1.78% (9/507)0.94–3.34%
Dermacentor reticulatusQuestingADF0% (0/94)NA
M0% (0/71)NA
Total0% (0/128)NA
Rhipicephalus rossicusEngorgedADF33.33% (23/69)22.44–45.71%
M13.56% (8/59)6.04–24.98%
Total24.22% (31/128)17.09–32.58%
n/total: positive ticks/total ticks; CI: confidence interval; AD: adult; F: female; M: male; N: nymph; L: larva.
Table 4. Rickettsia spp. prevalence in Romanian counties.
Table 4. Rickettsia spp. prevalence in Romanian counties.
CountyPrevalence % (n/Total)95% CI
Alba18.18 (2/11)2.28–51.78
Argeș6 (6/100)2.23–12.60
Bacău5.63 (4/71)1.56–13.8
Bihor6.1 (10/164)2.96–10.93
Bistrița-Năsăud2.50 (1/40)0.06–13.16
Brașov20 (1/5)0.51–71.64
Buzău7.5 (3/40)1.57–20.39
Cluj3.5 (7/200)1.42–7.08
Covasna7.5 (3/40)1.57–20.39
Dolj50 (5/10)18.71–81.29
Ilfov10 (2/20)1.23–31.70
Iași4.12 (4/97)1.13–10.22
Mehedinți30 (3/10)6.67–65.25
Maramureș8 (6/75)2.99–16.6
Mureș3.64 (4/110)1.00–9.05
Neamț10 (5/50)3.33–21.81
Sălaj1.35 (4/297)0.37–3.41
Suceava1.67 (1/60)0.04–8.94
Tulcea23.87 (37/155)17.4–31.37
Vâlcea15 (4/40)5.71–29.84
Vrancea20 (2/10)2.52–55.61
Vaslui9.09 (2/22)1.12–29.16
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ivan, T.; Matei, I.A.; Novac, C.Ș.; Kalmár, Z.; Borșan, S.-D.; Panait, L.-C.; Gherman, C.M.; Ionică, A.M.; Papuc, I.; Mihalca, A.D. Spotted Fever Group Rickettsia spp. Diversity in Ticks and the First Report of Rickettsia hoogstraalii in Romania. Vet. Sci. 2022, 9, 343. https://doi.org/10.3390/vetsci9070343

AMA Style

Ivan T, Matei IA, Novac CȘ, Kalmár Z, Borșan S-D, Panait L-C, Gherman CM, Ionică AM, Papuc I, Mihalca AD. Spotted Fever Group Rickettsia spp. Diversity in Ticks and the First Report of Rickettsia hoogstraalii in Romania. Veterinary Sciences. 2022; 9(7):343. https://doi.org/10.3390/vetsci9070343

Chicago/Turabian Style

Ivan, Talida, Ioana Adriana Matei, Cristiana Ștefania Novac, Zsuzsa Kalmár, Silvia-Diana Borșan, Luciana-Cătălina Panait, Călin Mircea Gherman, Angela Monica Ionică, Ionel Papuc, and Andrei Daniel Mihalca. 2022. "Spotted Fever Group Rickettsia spp. Diversity in Ticks and the First Report of Rickettsia hoogstraalii in Romania" Veterinary Sciences 9, no. 7: 343. https://doi.org/10.3390/vetsci9070343

APA Style

Ivan, T., Matei, I. A., Novac, C. Ș., Kalmár, Z., Borșan, S.-D., Panait, L.-C., Gherman, C. M., Ionică, A. M., Papuc, I., & Mihalca, A. D. (2022). Spotted Fever Group Rickettsia spp. Diversity in Ticks and the First Report of Rickettsia hoogstraalii in Romania. Veterinary Sciences, 9(7), 343. https://doi.org/10.3390/vetsci9070343

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop