Manipulation of Rice Straw Silage Fermentation with Different Types of Lactic Acid Bacteria Inoculant Affects Rumen Microbial Fermentation Characteristics and Methane Production
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation, Identification and Characterization of LAB
2.2. Molecular Identification
2.3. Silage Preparation and Fermentation
2.4. Chemical Analyses and Fermentation Quality for Rice Straw Silage
2.5. In Vitro Rumen Fermentation and Digestibility
2.6. Quantification of Rumen Microbial Population by Real-Time PCR
2.7. Statistical Analyses
3. Results
3.1. Chemical Analyses and Fermentation Quality of Rice Straw Silage
3.2. In Vitro Rumen Fermentation Characteristics, Methane Production and DM Digestibility
3.3. In Vitro Rumen Microbial Populations
4. Discussion
4.1. Chemical Composition and Fermentation Characteristics
4.2. In Vitro Rumen Fermentation Characteristics, Methane Production and DM Digestibility
4.3. In Vitro Rumen Microbial Populations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, Q.; Yang, H.; Yu, Z. Effects of sucrose, formic acid and lactic acid bacteria inoculant on quality, in vitro rumen digestibility and fermentability of drooping wild ryegrass (Elymus nutans Griseb.) silage. J. Anim. Feed Sci. 2017, 26, 26–32. [Google Scholar] [CrossRef] [Scilit]
- Ghazali, H.; Wan, M.; Wan, Z. Effects of inoculating Lactobacillus plantarum, molasses and urea on the fermentation of whole crop rice silage. Malays. J. Anim. Sci. 2013, 16, 75–82. [Google Scholar]
- Shafie, S.; Masjuki, H.H.; Mahlia, T.M.I. Life cycle assessment of rice straw-based power generation in Malaysia. Energy 2014, 70, 401–410. [Google Scholar] [CrossRef] [Scilit]
- He, L.; Zhou, W.; Wang, Y.; Wang, C.; Chen, X.; Zhang, Q. Effect of applying lactic acid bacteria and cellulase on the fermentation quality, nutritive value, tannins profile and in vitro digestibility of Neolamarckia cadamba leaves silage. J. Anim. Physiol. Anim. Nutr. 2018, 102, 1429–1436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, V.; Pereira, O.; Leandro, E.; Da Silva, T.; Ribeiro, K.; Mantovani, H.; Santos, S. Effects of lactic acid bacteria with bacteriocinogenic potential on the fermentation profile and chemical composition of alfalfa silage in tropical conditions. J. Dairy Sci. 2016, 99, 1895–1902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.J.; Liu, X.P.; Ren, J.W.; Zhao, H.Y.; Yuan, X.F.; Wang, X.F.; Salem, A.Z.; Cui, Z.J. The effects of fermentation and adsorption using lactic acid bacteria culture broth on the feed quality of rice straw. J. Integr. Agric. 2015, 14, 503–513. [Google Scholar] [CrossRef] [Scilit]
- Oladosu, Y.; Rafii, M.Y.; Abdullah, N.; Magaji, U.; Hussin, G.; Ramli, A.; Miah, G. Fermentation quality and additives: A case of rice straw silage. BioMed Res. Int. 2016, 2016, 7985167. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Xin, H.; Hua, J. Effects of treating whole-plant or chopped rice straw silage with different levels of lactic acid bacteria on silage fermentation and nutritive value for lactating Holsteins. Asian-Australas. J. Anim. Sci. 2010, 23, 1601–1607. [Google Scholar] [CrossRef] [Scilit]
- Cao, Y.; Cai, Y.; Takahashi, T. Ruminal digestibility and quality of silage conserved via fermentation by lactobacilli. In Lactic Acid Bacteria-R & D for Food, Health and Livestock Purposes; InTechOpen: London, UK, 2013. [Google Scholar]
- Contreras-Govea, F.E.; Muck, R.E.; Mertens, D.R.; Weimer, P.J. Microbial inoculant effects on silage and in vitro ruminal fermentation, and microbial biomass estimation for alfalfa, bmr corn, and corn silages. Anim. Feed Sci. Technol. 2011, 163, 2–10. [Google Scholar] [CrossRef] [Scilit]
- Ellis, J.; Bannink, A.; Hindrichsen, I.; Kinley, R.; Pellikaan, W.; Milora, N.; Dijkstra, J. Effect of lactic acid bacteria inoculants on in vitro rumen organic matter digestibility, total gas and methane production. Anim. Feed Sci. Technol. 2016, 90, 34–39. [Google Scholar]
- Jafari, S.; Ebrahimi, M.; Goh, Y.M.; Rajion, M.A.; Jahromi, M.F.; Al-Jumaili, W.S. Manipulation of rumen fermentation and methane gas production by plant secondary metabolites (saponin, tannin and essential oil): A review of ten-year studies. Ann. Anim. Sci. 2018, 19, 3–29. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, T.T.G.; Wanapat, M.; Phesatcha, K.; Kang, S. Effect of inclusion of different levels of Leucaena silage on rumen microbial population and microbial protein synthesis in dairy steers fed on rice straw. Asian-Australas. J. Anim. Sci. 2017, 30, 181. [Google Scholar] [CrossRef] [Scilit]
- Ebrahimi, M. Production of Omega-3 Polyunsaturated Fatty Acid-entiched Chevon Using Treated Oil Palm (Elaesis Guineensis Jacq.) Frond Silage. Ph.D. Thesis, Universiti Putra Malaysia, Seri Kembangan, Malaysia, 2012. [Google Scholar]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Huber, T.; Faulkner, G.; Hugenholtz, P. Bellerophon: A program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 2004, 20, 2317–2319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashelford, K.E.; Chuzhanova, N.A.; Fry, J.C.; Jones, A.J.; Weightman, A.J. New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras. Appl. Environ. Microbiol. 2006, 72, 5734–5741. [Google Scholar] [CrossRef] [Scilit]
- AOAC International. Official Methods of Analysis; Association of Official Analytical Chemists: Gaithersburg, MD, USA, 2007. [Google Scholar]
- Van Soest, P.v.; Robertson, J.; Lewis, B. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [Scilit]
- Jafari, S.; Meng, G.Y.; Rajion, M.A.; Jahromi, M.F.; Ebrahimi, M. Manipulation of rumen microbial fermentation by polyphenol rich solvent fractions from papaya leaf to reduce green-house gas methane and biohydrogenation of C18 PUFA. J. Agric. Food Chem. 2016, 64, 4522–4530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jafari, S.; Goh, Y.M.; Rajion, M.A.; Jahromi, M.F.; Ahmad, Y.H.; Ebrahimi, M. Papaya (Carica papaya) leaf methanolic extract modulates in vitro rumen methanogenesis and rumen biohydrogenation. Anim. Sci. J. 2017, 88, 267–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.L.; Liang, J.B.; Jahromi, M.F.; Abdullah, N.; Ho, Y.W.; Tufarelli, V. Enzyme treatment enhances release of prebiotic oligosaccharides from palm kernel expeller. BioResources 2015, 10, 196–209. [Google Scholar] [CrossRef] [Scilit]
- Faseleh Jahromi, M.; Liang, J.B.; Mohamad, R.; Goh, Y.M.; Shokryazdan, P.; Ho, Y.W. Lovastatin-enriched rice straw enhances biomass quality and suppresses ruminal methanogenesis. BioMed Res. Int. 2013, 2013, 397934. [Google Scholar] [CrossRef] [Scilit]
- Oskoueian, E.; Abdullah, N.; Oskoueian, A. Effects of Flavonoids on Rumen Fermentation Activity, Methane Production and Microbial Population. BioMed Res. Int. 2013, 2013, 349129. [Google Scholar] [CrossRef] [Scilit]
- Ørskov, E.; McDonald, I. The estimation of protein degradability in the rumen from incubation measurements weighted according to rate of passage. J. Agric. Sci. 1979, 92, 499–503. [Google Scholar] [CrossRef] [Scilit]
- SAS. SAS, Statistical Analysis Institute (Version 9.1.3); SAS Institute Inc.: Cary, NC, USA, 2003. [Google Scholar]
- Oskoueian, E. Dose-response Effects of Phorbol Esters Isolated from Jatropha Meal on Rumen Microbial Activities. Asian J. Anim. Vet. Adv. 2013, 9, 37–46. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.; Penner, G.B.; Hernandez-Sanabria, E.; Oba, M.; Guan, L.L. Effects of sampling location and time, and host animal on assessment of bacterial diversity and fermentation parameters in the bovine rumen. J. Appl. Microbiol. 2009, 107, 1924–1934. [Google Scholar] [CrossRef] [Scilit]
- Saha, U.K.; Sonon, L.S.; Hancock, D.W.; Hill, N.S.; Stewart, L.; Heusner, G.L.; Kissel, D.E. Common Terms Used in Animal Feeding and Nutrition; The University of Georgia: Athens, GA, USA, 2010. [Google Scholar]
- Chen, L.; Yuan, X.; Li, J.; Dong, Z.; Wang, S.; Guo, G.; Shao, T. Effects of applying lactic acid bacteria and propionic acid on fermentation quality, aerobic stability and in vitro gas production of forage-based total mixed ration silage in Tibet. Anim. Prod. Sci. 2019, 59, 376–383. [Google Scholar] [CrossRef] [Scilit]
- Ni, K.; Wang, Y.; Li, D.; Cai, Y.; Pang, H. Characterization, identification and application of lactic acid bacteria isolated from forage paddy rice silage. PLoS ONE 2015, 10, e0121967. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.G.; Ham, J.S.; Li, Y.W.; Park, H.S.; Huh, C.-S.; Park, B.-C. Development of a new lactic acid bacterial inoculant for fresh rice straw silage. Asian Australas. J. Anim. Sci. 2017, 30, 950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Xu, W.; Yang, J.; Zhao, H.; Pan, C.; Ding, X.; Zhang, Y. Effects of applying lactic acid bacteria to the fermentation on a mixture of corn steep liquor and air-dried rice straw. Anim. Nutr. 2016, 2, 229–233. [Google Scholar] [CrossRef] [Scilit]
- Baek, Y.C.; Kim, M.S.; Reddy, K.E.; Oh, Y.K.; Jung, Y.H.; Yeo, J.M.; Choi, H. Rumen fermentation and digestibility of spent mushroom (Pleurotus ostreatus) substrate inoculated with Lactobacillus brevis for Hanwoo steers. Revista Colombiana de Ciencias Pecuarias 2017, 30, 267–277. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Zhang, P.; Ye, J.; Wu, Y.; Fang, W.; Gou, X.; Zeng, G. Improvement of methane production from rice straw with rumen fluid pretreatment: A feasibility study. Int. Biodeterior. Biodegrad. 2016, 113, 9–16. [Google Scholar] [CrossRef] [Scilit]
- El Tawab, A.M.A.; Hassan, A.A.M.; Khattab, M.S.A.E.; Matloup, O.H.; Farahat, E.S.A.; Khalel, M.S.; Morsy, T.A.; Fouad, M.T. Productive performance of lactating frisian cows fed sugar beet leaves silage treated with lactic acid bacteria. Int. J. Zool. Res. 2017, 13, 74–82. [Google Scholar] [CrossRef] [Scilit]
- Fang, J.; Matsuzaki, M.; Suzuki, H.; Cai, Y.; Horiguchi, K.i.; Takahashi, T. Effects of lactic acid bacteria and urea treatment on fermentation quality, digestibility and ruminal fermentation of roll bale rice straw silage in wethers. Grassl. Sci. 2012, 58, 73–78. [Google Scholar] [CrossRef] [Scilit]
- Weinberg, Z.; Muck, R.; Weimer, P. The survival of silage inoculant lactic acid bacteria in rumen fluid. J. Appl. Microbiol. 2003, 94, 1066–1071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, L.; Ren, A.; Zhou, C.; Tan, Z. Effects of Lactobacillus acidophilus supplementation for improving in vitro rumen fermentation characteristics of cereal straws. Ital. J. Anim. Sci. 2017, 16, 52–60. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.; Yao, D.; Li, D.; Lin, Y.; Bureenok, S.; Ni, K.; Yang, F. Effects of Lactic Acid Bacteria Isolated From Rumen Fluid and Feces of Dairy Cows on Fermentation Quality, Microbial Community, and in vitro Digestibility of Alfalfa Silage. Front. Microbiol. 2020, 10, 2998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiao, P.; Liu, F.; Beauchemin, K.; Yang, W. Impact of strain and dose of lactic acid bacteria on in vitro ruminal fermentation with varying media pH levels and feed substrates. Anim. Feed Sci. Technol. 2017, 224, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Weinberg, Z.; Chen, Y.; Volchinski, V.; Sela, S.; Ogunade, I.; Adesogan, A. An in vitro model to study interactions between Escherichia coli and lactic acid bacterial inoculants for silage in rumen fluid. Lett. Appl. Microbiol. 2016, 63, 60–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doyle, N.; Mbandlwa, P.; Kelly, W.J.; Attwood, G.; Li, Y.; Ross, R.P.; Stanton, C.; Leahy, S. Use of Lactic Acid Bacteria to Reduce Methane Production in Ruminants, a Critical Review. Front. Microbiol. 2019, 10, 2207. [Google Scholar] [CrossRef] [Scilit]
- Callaway, T.R.; De Melo, A.M.C.; Russell, J.B. The Effect of Nisin and Monensin on Ruminal Fermentations In Vitro. Curr. Microbiol. 1997, 35, 90–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santoso, B.; Mwenya, B.; Sar, C.; Gamo, Y.; Kobayashi, T.; Morikawa, R.; Kimura, K.; Mizukoshi, H.; Takahashi, J. Effects of supplementing galacto-oligosaccharides, Yucca schidigera or nisin on rumen methanogenesis, nitrogen and energy metabolism in sheep. Livest. Prod. Sci. 2004, 91, 209–217. [Google Scholar] [CrossRef] [Scilit]
- Astuti, W.D.; Wiryawa, K.G.; Wina, E.; Widyastuti, Y.; Suharti, S.; Ridwan, R. Effects of Selected Lactobacillus plantarum as Probiotic on In vitro Ruminal Fermentation and Microbial Population. Pak. J. Nutr. 2018, 17, 131–139. [Google Scholar] [CrossRef] [Scilit]
- Cao, Y.; Cai, Y.; Takahashi, T.; Yoshida, N.; Tohno, M.; Uegaki, R.; Nonaka, K.; Terada, F. Effect of lactic acid bacteria inoculant and beet pulp addition on fermentation characteristics and in vitro ruminal digestion of vegetable residue silage. J. Dairy Sci. 2011, 94, 3902–3912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Y.; Takahashi, T.; Horiguchi, K.-I.; Yoshida, N.; Cai, Y. Methane emissions from sheep fed fermented or non-fermented total mixed ration containing whole-crop rice and rice bran. Anim. Feed. Sci. Technol. 2010, 157, 72–78. [Google Scholar] [CrossRef] [Scilit]
- Lengowski, M.B.; Zuber, K.H.; Witzig, M.; Möhring, J.; Boguhn, J.; Rodehutscord, M. Changes in Rumen microbial community composition during adaption to an in vitro system and the impact of different forages. PLoS ONE 2016, 11, e0150115. [Google Scholar] [CrossRef] [Scilit]
- Ebrahimi, M.; Rajion, M.A.; Jafari, S.; Jahromi, M.F.; Oskoueian, E.; Sazili, A.Q.; Goh, Y.M.; Ghaffari, M.H. Effects of dietary n-6: N-3 polyunsaturated fatty acid ratios on meat quality, carcass characteristics, tissue fatty acid profiles, and expression of lipogenic genes in growing goats. PLoS ONE 2018, 13, e0188369. [Google Scholar] [CrossRef] [Scilit]
| Ingredients (/kg DM) | g/kg DM |
|---|---|
| Alfalfa Hay | 314.1 |
| Corn, grain | 170.0 |
| Soybean meal | 133.0 |
| Palm kernel cake | 251.1 |
| Rice bran | 81.8 |
| Sunflower oil | 20.0 |
| Mineral premix | 5.0 |
| Vitamin premix | 5.0 |
| Ammonium chloride | 10.0 |
| Limestone | 10.0 |
| Chemical composition | g/kg DM |
| DM | 850.2 |
| CP | 208.3 |
| EE | 52.5 |
| NDF | 419.0 |
| ADF | 253.0 |
| Target Microorganism | Primer Sequences (5′–3′) |
|---|---|
| Fibrobacter succinogenes F | GGTATGGGATGAGCTTGC |
| Fibrobacter succinogenes R | GCCTGCCCCTGAACTATC |
| Ruminococcus albus F | CCCTAAAAGCAGTCTTAGTTCG |
| Ruminococcus albus R | CCTCCTTGCGGTTAGAACA |
| Ruminococcus flavefaciens F | CGAACGGAGATAATTTGAGTTTACTTAGG |
| Ruminococcus flavefaciens R | CGGTCTCTGTATGTTATGAGGTATTACC |
| General bacteria F | CGGCAACGAGCGCAACCC |
| General bacteria R | CCATTGTAGCACGTGTGTAGCC |
| General anaerobic fungi F | GAGGAAGTAAAAGTCGTAACAAGGTTTC |
| General anaerobic fungi R | CAAATTCACAAAGGGTAGGATGATT |
| Total protozoa F | GCTTTCGWTGGTAGTGTATT |
| Total protozoa R | CTTGCCCTCYAATCGTWCT |
| Total methanogens F | GCTCAGTAACACGTGG |
| Total methanogens R | CGGTGTGTGCAAGGAG |
| Total archaea F | ATTAGATACCCSBGTAGTCC |
| Total archaea R | GCCATGCACCWCCTCT |
| Treatments | Day | DM (%) | CP (%) | NDF (%) | ADF (%) | GE (Kcal) | Glucose 1 | Fructose 1 | Xylose 1 |
|---|---|---|---|---|---|---|---|---|---|
| Control | 15 | 34.8 a | 9.3 c | 69.2 a | 56.2 a | 15.7 | 5.3 a | 0.4 a | 0.4 |
| 30 | 33.6 a | 9.8 c | 70.2 a | 56.8 a | 15.9 | 4.8 b | 0.4 a | 0.4 | |
| L. plantarum | 15 | 30.5 bc | 11.8 b | 66.8 c | 53.3 b | 15.5 | 3.5 c | 0.3 ab | 0.4 |
| 30 | 29.2 c | 12.7 a | 64.1 d | 49.4 c | 14.8 | 1.2 h | 0.1 c | 0.3 | |
| L. salivarius | 15 | 33.2 a | 11.2 b | 68.9 a | 53.8 b | 15.7 | 3.6 c | 0.3 ab | 0.4 |
| 30 | 32.8 ab | 12.1 ab | 66.6 c | 51.9 c | 15.5 | 2.5 f | 0.2 b | 0.4 | |
| L. reuteri | 15 | 32.5 ab | 10.9 bc | 67.6 b | 53.7 b | 15.9 | 3.2 d | 0.3 ab | 0.4 |
| 30 | 31.3 b | 10.9 bc | 66.6 c | 52.5 bc | 15.0 | 2.4 f | 0.2 b | 0.3 | |
| L. brevis | 15 | 33.4 a | 10.6 bc | 66.9 c | 52.9 bc | 15.3 | 3.3 d | 0.3 ab | 0.4 |
| 30 | 32.4 ab | 10.9 bc | 66.6 c | 50.6 c | 15.1 | 3.0 e | 0.2 b | 0.3 | |
| S. bovis | 15 | 32.6 ab | 12.4 a | 67.5 b | 52.1 bc | 15.7 | 3.4 cd | 0.3 ab | 0.3 |
| 30 | 31.5 b | 12.5 a | 64.8 d | 50.8 c | 15.3 | 1.9 g | 0.2 b | 0.3 | |
| SEM 2 | - | 0.60 | 0.43 | 0.46 | 0.97 | 0.65 | 0.83 | 0.05 | 0.08 |
| Treatments | Day | pH | Lactic Acid (g/Kg DM) | Acetic Acid (g/Kg DM) | Propionic Acid (g/Kg DM) | Butyric Acid (g/Kg DM) | NH3-N (%) | LAB (log cfu/g) |
|---|---|---|---|---|---|---|---|---|
| Control | 15 | 5.6 a | 5.1 f | 10.5 e | 1.3 b | 5.5 a | 0.05 | 5.2 c |
| 30 | 5.6 a | 9.4 e | 11.6 e | 1.6 b | 4.6 a | 0.05 | 5.8 c | |
| L. plantarum | 15 | 5.2 ab | 19.6 c | 20.8 b | 1.9 ab | 1.7 cd | 0.04 | 6.6 bc |
| 30 | 4.4 b | 36.9 a | 24.1 a | 2.9 a | 1.7 cd | 0.05 | 8.8 a | |
| L. salivarius | 15 | 5.4 a | 14.6 d | 13.4 d | 1.2 b | 3.3 b | 0.05 | 6.5 bc |
| 30 | 4.8 b | 22.4 bc | 19.1 bc | 1.3 b | 2.4 b | 0.05 | 7.3 b | |
| L. reuteri | 15 | 5.5 a | 15.5 d | 14.2 d | 1.5 b | 2.2 c | 0.05 | 6.4 bc |
| 30 | 4.8 b | 26.6 b | 17.4 c | 2.1 ab | 2.1 c | 0.06 | 7.1 b | |
| L. brevis | 15 | 5.3 a | 16.9 c | 14.4 d | 1.4 b | 2.6 b | 0.05 | 6.6 bc |
| 30 | 4.9 b | 24.1 b | 18.1 c | 1.7 b | 2.1 c | 0.05 | 7.3 b | |
| S. bovis | 15 | 5.3 a | 19.9 c | 19.5 bc | 1.6 b | 1.7 cd | 0.04 | 6.8 bc |
| 30 | 4.3 b | 35.7 a | 22.5 ab | 2.5 a | 1.2 d | 0.05 | 8.2 ab | |
| SEM 1 | - | 0.31 | 1.14 | 0.88 | 0.53 | 1.01 | 0.004 | 0.48 |
| Treatments | Day | DMD | Total Gas 1 | pH | NH3-N | Total VFA (mM) | Acetic Acid | Propionic Acid | CH4 | CH4/Total Gas |
|---|---|---|---|---|---|---|---|---|---|---|
| Control | 15 | 21.4 f | 45.5 a | 6.9 | 14.3 | 65.6 g | 45.5 g | 13.6 a | 7.8 a | 0.17 a |
| 30 | 22.2 f | 45.0 a | 6.9 | 15.6 | 67.5 ef | 44.5 g | 12.7 ab | 7.9 a | 0.18 a | |
| L. plantarum | 15 | 25.4 de | 42.0 bc | 6.9 | 15.3 | 74.7 c | 46.1 fg | 12.4 b | 4.2 c | 0.10 cd |
| 30 | 29.4 a | 37.5 c | 6.9 | 15.9 | 79.7 a | 54.4 a | 12.9 ab | 4.1 c | 0.11 cd | |
| L. salivarius | 15 | 22.4 f | 43.5 b | 6.8 | 15.2 | 68.8 e | 47.0 f | 12.4 b | 6.1 b | 0.14 b |
| 30 | 26.4 cd | 41.0 c | 6.8 | 15.8 | 76.1 b | 49.7 d | 13.0 ab | 5.9 b | 0.14 b | |
| L. reuteri | 15 | 22.4 f | 40.5 c | 6.8 | 14.9 | 70.6 d | 46.7 f | 13.3 a | 4.5 c | 0.11 cd |
| 30 | 26.4 cd | 40.0 cd | 6.8 | 15.5 | 74.5 c | 51.6 c | 13.2 a | 4.6 c | 0.12 c | |
| L. brevis | 15 | 22.1 f | 43.0 b | 6.8 | 15.3 | 67.2 ef | 48.3 de | 12.5 b | 5.2 b | 0.12 c |
| 30 | 27.4 bc | 42.0 bc | 6.8 | 15.6 | 78.3 ab | 52.7 b | 13.6 a | 5.4 b | 0.13 bc | |
| S. bovis | 15 | 24.4 ef | 40.5 c | 6.8 | 15.1 | 74.5 c | 49.2 d | 13.8 a | 5.7 b | 0.14 b |
| 30 | 28.4 ab | 39.5 cd | 6.8 | 15.7 | 78.9 a | 53.5 ab | 13.3 a | 5.2 b | 0.13 bc | |
| SEM 2 | - | 0.68 | 0.84 | 0.03 | 0.48 | 1.07 | 0.48 | 0.32 | 0.26 | 0.004 |
| Treatment 1 | Day | Fibrobacter succinogenes | Butyrivibrio fibrisolvens | Ruminococcus flavafaciences | Total Bacteria | Total Fungi | Total Protozoa | Total Methanogens | Total Archaea |
|---|---|---|---|---|---|---|---|---|---|
| Control | 15 | 1.54 b | 0.40 c | 1.20 c | 0.53 b | 0.76 b | 3.93 a | 7.62 a | 5.78 a |
| 30 | 1.61 b | 0.72 c | 1.31 bc | 1.05 ab | 0.78 b | 3.99 a | 7.57 a | 5.78 a | |
| L. plantarum | 15 | 1.82 ab | 1.28 b | 1.91 b | 1.42 a | 1.07 ab | 3.62 ab | 7.34 ab | 5.34 ab |
| 30 | 2.50 a | 2.32 a | 2.68 a | 1.56 a | 1.37 a | 3.49 b | 7.11 b | 4.91 b | |
| L. salivarius | 15 | 1.64 b | 1.12 c | 1.33 bc | 1.36 ab | 0.83 b | 3.84 a | 7.41 a | 5.50 a |
| 30 | 1.89 ab | 1.88 ab | 2.19 ab | 1.43 a | 1.15 a | 3.74 ab | 7.29 ab | 5.25 ab | |
| L. reuteri | 15 | 1.64 b | 0.94 c | 1.31 bc | 1.33 ab | 0.83 b | 3.86 a | 7.47 a | 5.35 ab |
| 30 | 1.89 ab | 1.35 b | 2.07 ab | 1.42 a | 1.12 a | 3.66 ab | 7.36 ab | 5.01 b | |
| L. brevis | 15 | 1.71 b | 1.13 c | 1.35 bc | 1.39 ab | 0.96 ab | 3.79 ab | 7.51 a | 5.43 ab |
| 30 | 2.12 a | 1.91 ab | 2.29 a | 1.44 a | 1.23 a | 3.66 ab | 7.43 a | 5.11 b | |
| S. bovis | 15 | 1.77 b | 1.16 bc | 1.80 b | 1.42 a | 0.97 ab | 3.62 ab | 7.44 a | 5.22 ab |
| 30 | 2.24 a | 2.13 a | 2.55 a | 1.47 a | 1.34 a | 3.53 b | 7.22 b | 4.99 b | |
| SEM 2 | - | 0.15 | 0.14 | 0.13 | 0.15 | 0.22 | 0.28 | 0.48 | 0.23 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oskoueian, E.; Jahromi, M.F.; Jafari, S.; Shakeri, M.; Le, H.H.; Ebrahimi, M. Manipulation of Rice Straw Silage Fermentation with Different Types of Lactic Acid Bacteria Inoculant Affects Rumen Microbial Fermentation Characteristics and Methane Production. Vet. Sci. 2021, 8, 100. https://doi.org/10.3390/vetsci8060100
Oskoueian E, Jahromi MF, Jafari S, Shakeri M, Le HH, Ebrahimi M. Manipulation of Rice Straw Silage Fermentation with Different Types of Lactic Acid Bacteria Inoculant Affects Rumen Microbial Fermentation Characteristics and Methane Production. Veterinary Sciences. 2021; 8(6):100. https://doi.org/10.3390/vetsci8060100
Chicago/Turabian StyleOskoueian, Ehsan, Mohammad Faseleh Jahromi, Saeid Jafari, Majid Shakeri, Hieu Huu Le, and Mahdi Ebrahimi. 2021. "Manipulation of Rice Straw Silage Fermentation with Different Types of Lactic Acid Bacteria Inoculant Affects Rumen Microbial Fermentation Characteristics and Methane Production" Veterinary Sciences 8, no. 6: 100. https://doi.org/10.3390/vetsci8060100
APA StyleOskoueian, E., Jahromi, M. F., Jafari, S., Shakeri, M., Le, H. H., & Ebrahimi, M. (2021). Manipulation of Rice Straw Silage Fermentation with Different Types of Lactic Acid Bacteria Inoculant Affects Rumen Microbial Fermentation Characteristics and Methane Production. Veterinary Sciences, 8(6), 100. https://doi.org/10.3390/vetsci8060100

