A Molecular Study on Hepatitis E Virus (HEV) in Pigs in Bulgaria
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Molecular Screening
2.3. Sequence Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kamar, N.; Selves, J.; Mansuy, J.M.; Ouezzani, L.; Péron, J.M.; Guitard, J.; Cointault, O.; Esposito, L.; Abravanel, F.; Danjoux, M.; et al. Hepatitis E virus and chronic hepatitis in organ-transplant recipients. N. Engl. J. Med. 2008, 358, 811–817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pischke, S.; Hartl, J.; Pas, S.D.; Lohse, A.W.; Jacobs, B.C.; Van der Eijk, A.A. Hepatitis E virus: Infection beyond the liver? J. Hepatol. 2017, 66, 1082–1095. [Google Scholar] [CrossRef] [Scilit]
- Nagashima, S.; Takahashi, M.; Kobayashi, T.; Tanggis; Nishizawa, T.; Nishiyama, T.; Primadharsini, P.P.; Okamoto, H. Characterization of the Quasi-Enveloped Hepatitis E Virus Particles Released by the Cellular Exosomal Pathway. J. Virol. 2017, 91, e00822-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, M.; Yamada, K.; Hoshino, Y.; Takahashi, H.; Ichiyama, K.; Tanaka, T.; Okamoto, H. Monoclonal antibodies raised against the ORF3 protein of hepatitis E virus (HEV) can capture HEV particles in culture supernatant and serum but not those in feces. Arch. Virol. 2008, 153, 1703–1713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Purdy, M.A.; Harrison, T.J.; Jameel, S.; Meng, X.J.; Okamoto, H.; Van der Poel, W.H.M.; Smith, D.B.; Ictv Report Consortium. ICTV Virus Taxonomy Profile: Hepeviridae. J. Gen. Virol. 2017, 98, 2645–2646. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Meng, X.J. Hepatitis E virus: Host tropism and zoonotic infection. Curr. Opin. Microbiol. 2021, 59, 8–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sooryanarain, H.; Meng, X.J. Hepatitis E virus: Reasons for emergence in humans. Curr. Opin. Virol. 2019, 34, 10–17. [Google Scholar] [CrossRef] [Scilit]
- Baymakova, M.; Terzieva, K.; Popov, R.; Grancharova, E.; Kundurzhiev, T.; Pepovich, R.; Tsachev, I. Seroprevalence of Hepatitis E Virus Infection among Blood Donors in Bulgaria. Viruses 2021, 13, 492. [Google Scholar] [CrossRef] [Scilit]
- Baymakova, M.; Popov, G.T.; Pepovich, R.; Tsachev, I. Hepatitis E Virus Infection in Bulgaria: A Brief Analysis of the Situation in the Country. Open Access Maced. J. Med. Sci. 2019, 7, 458–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bruni, R.; Villano, U.; Equestre, M.; Chionne, P.; Madonna, E.; Trandeva-Bankova, D.; Peleva-Pishmisheva, M.; Tenev, T.; Cella, E.; Ciccozzi, M.; et al. Hepatitis E virus genotypes and subgenotypes causing acute hepatitis, Bulgaria, 2013–2015. PLoS ONE 2018, 13, e0198045. [Google Scholar] [CrossRef] [Scilit]
- Pishmisheva, M.; Baymakova, M.; Golkocheva-Markova, E.; Kundurzhiev, T.; Pepovich, R.; Popov, G.T.; Tsachev, I. First serological study of hepatitis E virus infection in pigs in Bulgaria. Comptes Rendus de l’Academie Bulg. des Sci. 2018, 71, 1001–1008. [Google Scholar] [CrossRef] [Scilit]
- Tsachev, I.; Baymakova, M.; Ciccozzi, M.; Pepovich, R.; Kundurzhiev, T.; Marutsov, P.; Dimitrov, K.K.; Gospodinova, K.; Pishmisheva, M.; Pekova, L. Seroprevalence of Hepatitis E Virus Infection in Pigs from Southern Bulgaria. Vector Borne Zoonotic Dis. 2019, 19, 767–772. [Google Scholar] [CrossRef] [Scilit]
- Takova, K.; Koynarski, T.; Minkov, I.; Ivanova, Z.; Toneva, V.; Zahmanova, G. Increasing Hepatitis E Virus Seroprevalence in Domestic Pigs and Wild Boar in Bulgaria. Animals 2020, 10, 1521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsachev, I.; Baymakova, M.; Marutsov, P.; Gospodinova, K.; Kundurzhiev, T.; Petrov, V.; Pepovich, R. Seroprevalence of Hepatitis E Virus Infection among Wild Boars in Western Bulgaria. Vector Borne Zoonotic Dis. 2021, 21, 441–445. [Google Scholar] [CrossRef] [Scilit]
- Tsachev, I.; Baymakova, M.; Pepovich, R.; Palova, N.; Marutsov, P.; Gospodinova, K.; Kundurzhiev, T.; Ciccozzi, M. High Seroprevalence of Hepatitis E Virus Infection Among East Balkan Swine (Sus scrofa) in Bulgaria: Preliminary Results. Pathogens 2020, 9, 911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jothikumar, N.; Cromeans, T.L.; Robertson, B.H.; Meng, X.J.; Hill, V.R. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J. Virol. Methods 2006, 131, 65–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Profio, F.; Melegari, I.; Sarchese, V.; Robetto, S.; Marruchella, G.; Bona, M.C.; Orusa, R.; Martella, V.; Marsilio, F.; Di Martino, B. Detection and genetic characterization of hepatitis E virus (HEV) genotype 3 subtype c in wild boars in Italy. Arch. Virol. 2016, 161, 2829–2834. [Google Scholar] [CrossRef] [Scilit]
- Drexler, J.F.; Seelen, A.; Corman, V.M.; Fumie Tateno, A.; Cottontail, V.; Melim Zerbinati, R.; Gloza-Rausch, F.; Klose, S.M.; Adu-Sarkodie, Y.; Oppong, S.K.; et al. Bats worldwide carry hepatitis E virus-related viruses that form a putative novel genus within the family Hepeviridae. J. Virol. 2012, 86, 9134–9147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, X.J.; Purcell, R.H.; Halbur, P.G.; Lehman, J.R.; Webb, D.M.; Tsareva, T.S.; Haynes, J.S.; Thacker, B.J.; Emerson, S.U. A novel virus in swine is closely related to the human hepatitis E virus. Proc. Natl. Acad. Sci. USA 1997, 94, 9860–9865. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicot, F.; Jeanne, N.; Roulet, A.; Lefebvre, C.; Carcenac, R.; Manno, M.; Dubois, M.; Kamar, N.; Lhomme, S.; Abravanel, F.; et al. Diversity of hepatitis E virus genotype 3. Rev. Med. Virol. 2018, 28, e1987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pas, S.D.; de Man, R.A.; Mulders, C.; Balk, A.H.; van Hal, P.T.; Weimar, W.; Koopmans, M.P.; Osterhaus, A.D.; van der Eijk, A.A. Hepatitis E virus infection among solid organ transplant recipients, the Netherlands. Emerg. Infect. Dis. 2012, 18, 869–872. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliveira-Filho, E.F.; König, M.; Thiel, H.J. Genetic variability of HEV isolates: Inconsistencies of current classification. Vet. Microbiol. 2013, 165, 148–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, D.B.; Izopet, J.; Nicot, F.; Simmonds, P.; Jameel, S.; Meng, X.J.; Norder, H.; Okamoto, H.; van der Poel, W.H.M.; Reuter, G.; et al. Update: Proposed reference sequences for subtypes of hepatitis E virus (species Orthohepevirus A). J. Gen. Virol. 2020, 101, 692–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicot, F.; Dimeglio, C.; Migueres, M.; Jeanne, N.; Latour, J.; Abravanel, F.; Ranger, N.; Harter, A.; Dubois, M.; Lameiras, S.; et al. Classification of the Zoonotic Hepatitis E Virus Genotype 3 Into Distinct Subgenotypes. Front. Microbiol. 2021, 11, 634430. [Google Scholar] [CrossRef] [Scilit]
- Cella, E.; Golkocheva-Markova, E.; Sagnelli, C.; Scolamacchia, V.; Bruni, R.; Villano, U.; Ciccaglione, A.R.; Equestre, M.; Sagnelli, E.; Angeletti, S.; et al. Human hepatitis E virus circulation in Bulgaria: Deep Bayesian phylogenetic analysis for viral spread control in the country. J. Med. Virol. 2019, 91, 132–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Oligonucleotide | Position | Sequence (5′ to 3′) | Sense | Reference |
|---|---|---|---|---|
| JHEV FW | 5285–5302 | GGTGGTTTCTGGGGTGAC | + | [16] |
| JHEV REV | 5337–5354 | AGGGGTTGGTTGGATGAA | - | [16] |
| JHEV P | 5308–5325 | FAM-TGATTCTCAGCCCTTCGC-BHQ | + | [16] |
| HEV-F4228 | 4279–4307 | ACYTTYTGTGCYYTITTTGGTCCITGGTT | + | [18] |
| HEV-R4598 | 4627–4649 | GCCATGTTCCAGAYGGTGTTCCA | - | [18] |
| HEV-R4565 | 4591–4616 | CCGGGTTCRCCIGAGTGTTTCTTCCA | - | [18] |
| HEVestFW | 5711–5732 | AAYTATGCWCAGTACCGGGTTG | + | [19] |
| HEVestREV | 6419–6441 | CCCTTATCCTGCTGAGCATTCTC | - | [19] |
| HEVintFW | 5986–6017 | GTYATGYTYTGCATACATGGCT | + | [19] |
| HEVintREV | 6324–6343 | AGCCGACGAAATYAATTCTGTC | - | [19] |
| Animal Collections | No. of Animals Tested | Positive/Total (%) | |||
|---|---|---|---|---|---|
| qRT-PCR ORF3 [16] | Heminested RT-PCR RdRp [18] | RT-PCR ORF2 [19] | Nested PCR ORF2 [19] | ||
| Swine Northern Bulgaria | 10 | 10/10 (100.0) | 9/10 (90.0) | 3/10 (30.0) | 4/10 (40.0) |
| Swine Southern Bulgaria | 10 | 1/10 (10.0) | 0/10 (0.0) | 0/10 (0.0) | 0/10 (0.0) |
| Swine Eastern Bulgaria | 9 | 0/9 (0.0) | 0/9 (0.0) | 0/9 (0.0) | 0/9 (0.0) |
| Wild boars | 10 | 0/10 (0.0) | 0/10 (0.0) | 0/10 (0.0) | 0/10 (0.0) |
| Total | 39 | 11/39 (28.2) | 9/39 (23.1) | 3/39 (7.7) | 4/39 (10.2) |
| HEV Gt3 Subtype | Strain Name | MZ555941 SNB2 | MZ555942 SNB6 | MZ555944 SNB8 | GenBank Accession No. |
|---|---|---|---|---|---|
| 3c | ISS2/Sof2013 | 93.9% | 93.8% | 92.3% | MH203165 |
| ISS76/Dob2014 | 93.5% | 93.5% | 92.0% | MH203204 | |
| ISS75/Plov2014 | 89.4% | 89.6% | 88.5% | MH203203 | |
| ISS92/Sof2014 | 88.2% | 88.1% | 87.4% | MH203213 | |
| ISS91/Paz2014 | 86.1% | 86.2% | 86.2% | MH203212 | |
| 3e | ISS83/Paz2014 | 81.6% | 81.9% | 80.8% | MH203208 |
| ISS51/Paz2014 | 81.2% | 81.5% | 80.5% | MH203190 | |
| ISS20/Plov2013 | 80.8% | 81.2% | 80.1% | MH203172 | |
| ISS60/Plov2014 | 80.6% | 80.5% | 80.5% | MH203195 | |
| ISS87/Sof2014 | 80.6% | 81.5% | 80.8% | MH203211 | |
| 3f | ISS98/Paz2014 | 84.9% | 85.0% | 83.5% | MH203218 |
| ISS104/Bur2014 | 84.9% | 84.6% | 82.4% | MH203223 | |
| ISS79/Sof2014 | 84.5% | 84.2% | 82.0% | MH203207 | |
| ISS32/Jam2013 | 82.4% | 82.3% | 80.1% | MH203178 | |
| ISS85/Paz2014 | 82.5% | 82.8% | 80.9% | MH203210 | |
| 3i | ISS62/Paz2014 | 87.5% | 87.4% | 87.1% | MH203197 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Palombieri, A.; Tsachev, I.; Sarchese, V.; Fruci, P.; Di Profio, F.; Pepovich, R.; Baymakova, M.; Marsilio, F.; Martella, V.; Di Martino, B. A Molecular Study on Hepatitis E Virus (HEV) in Pigs in Bulgaria. Vet. Sci. 2021, 8, 267. https://doi.org/10.3390/vetsci8110267
Palombieri A, Tsachev I, Sarchese V, Fruci P, Di Profio F, Pepovich R, Baymakova M, Marsilio F, Martella V, Di Martino B. A Molecular Study on Hepatitis E Virus (HEV) in Pigs in Bulgaria. Veterinary Sciences. 2021; 8(11):267. https://doi.org/10.3390/vetsci8110267
Chicago/Turabian StylePalombieri, Andrea, Ilia Tsachev, Vittorio Sarchese, Paola Fruci, Federica Di Profio, Roman Pepovich, Magdalena Baymakova, Fulvio Marsilio, Vito Martella, and Barbara Di Martino. 2021. "A Molecular Study on Hepatitis E Virus (HEV) in Pigs in Bulgaria" Veterinary Sciences 8, no. 11: 267. https://doi.org/10.3390/vetsci8110267
APA StylePalombieri, A., Tsachev, I., Sarchese, V., Fruci, P., Di Profio, F., Pepovich, R., Baymakova, M., Marsilio, F., Martella, V., & Di Martino, B. (2021). A Molecular Study on Hepatitis E Virus (HEV) in Pigs in Bulgaria. Veterinary Sciences, 8(11), 267. https://doi.org/10.3390/vetsci8110267

