Development of a Loop-Mediated Isothermal Amplification (LAMP) Assay Targeting the Citrate Synthase Gene for Detection of Ehrlichia canis in Dogs
Abstract
1. Introduction
2. Materials and Methods
2.1. Blood Samples and DNA Extraction
2.2. Conventional PCR for E. canis and Sequence Analysis
2.3. LAMP Primer Design and Optimization of LAMP Condition
2.4. LAMP Reproducibility and Detection Limit
2.5. Data Analysis
3. Results
3.1. PCR and Sequence Analysis
3.2. Optimum LAMP Temperature and Time
3.3. LAMP Reproducibility and Detection Limit
3.4. LAMP Sensitivity, Specificity, and Accuracy
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fourie, J.J.; Stanneck, D.; Luus, H.G.; Beugnet, F.; Wijnveld, M.; Jongejan, F. Transmission of Ehrlichia canis by Rhipicephalus sanguineus ticks feeding on dogs and on artificial membranes. Vet. Parasitol. 2013, 197, 595–603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dantas-Torres, F.; Otranto, D. Further thoughts on the taxonomy and vector role of Rhipicephalus sanguineus group ticks. Vet. Parasitol. 2015, 208, 9–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrus, S.; Waner, T. Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia canis): An overview. Vet. J. 2011, 187, 292–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shipov, A.; Klement, E.; Reuveni-Tager, L.; Waner, T.; Harrus, S. Prognostic indicators for canine monocytic ehrlichiosis. Vet. Parasitol. 2008, 153, 131–138. [Google Scholar] [CrossRef] [Scilit]
- Irwin, P.J.; Jefferies, R. Arthropod-transmitted diseases of companion animals in Southeast Asia. Trends Parasitol. 2004, 20, 27–34. [Google Scholar] [CrossRef] [Scilit]
- Piratae, S.; Pimpjong, K.; Vaisusuk, K.; Chatan, W. Molecular detection of Ehrlichia canis, Hepatozoon canis and Babesia canis vogeli in stray dogs in Mahasarakham province, Thailand. Ann. Parasitol. 2015, 61, 183–187. [Google Scholar] [PubMed]
- Koh, F.X.; Panchadcharam, C.; Tay, S.T. Vector-Borne Diseases in Stray Dogs in Peninsular Malaysia and Molecular Detection of Anaplasma and Ehrlichia spp. from Rhipicephalus sanguineus (Acari: Ixodidae) Ticks. J. Med. Entomol. 2016, 53, 183–187. [Google Scholar] [CrossRef] [Scilit]
- Inpankaew, T.; Hii, S.F.; Chimnoi, W.; Traub, R.J. Canine vector-borne pathogens in semi-domesticated dogs residing in northern Cambodia. Parasit. Vectors 2016, 9, 253. [Google Scholar] [CrossRef] [Scilit]
- Galay, R.L.; Manalo, A.A.L.; Dolores, S.L.D.; Aguilar, I.P.M.; Sandalo, K.A.C.; Cruz, K.B.; Divina, B.P.; Andoh, M.; Masatani, T.; Tanaka, T. Molecular detection of tick-borne pathogens in canine population and Rhipicephalus sanguineus (sensu lato) ticks from southern Metro Manila and Laguna, Philippines. Parasit. Vectors 2018, 11, 643. [Google Scholar] [CrossRef] [Scilit]
- Kaewmongkol, G.; Lukkana, N.; Yangtara, S.; Kaewmongkol, S.; Thengchaisri, N.; Sirinarumitr, T.; Jittapalapong, S.; Fenwick, S.G. Association of Ehrlichia canis, Hemotropic Mycoplasma spp. and Anaplasma platys and severe anemia in dogs in Thailand. Vet. Microbiol. 2017, 201, 195–200. [Google Scholar] [CrossRef] [Scilit]
- Piratae, S.; Senawong, P.; Chalermchat, P.; Harnarsa, W.; Sae-Chue, B. Molecular evidence of Ehrlichia canis and Anaplasma platys and the association of infections with hematological responses in naturally infected dogs in Kalasin, Thailand. Vet. World 2019, 12, 131–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrus, S.; Kass, P.H.; Klement, E.; Waner, T. Canine monocytic ehrlichiosis: A retrospective study of 100 cases, and an epidemiological investigation of prognostic indicators for the disease. Vet. Rec. 1997, 141, 360–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iqbal, Z.; Chaichanasiriwithaya, W.; Rikihisa, Y. Comparison of PCR with other tests for early diagnosis of canine ehrlichiosis. J. Clin. Microbiol. 1994, 32, 1658–1662. [Google Scholar] [CrossRef] [Scilit]
- Pinhanelli, V.C.; Costa, P.N.M.; Silva, G.; Aguiar, D.M.; Silva, C.M.L.; Fachin, A.L.; Marins, M. Development and evaluation of a loop-mediated isothermal amplification assay for detection of Ehrlichia canis DNA in naturally infected dogs using the p30 gene. Genet. Mol. Res. 2015, 14, 17885–17892. [Google Scholar] [CrossRef] [Scilit]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayashida, K.; Kajino, K.; Hachaambwa, L.; Namangala, B.; Sugimoto, C. Direct blood dry LAMP: A rapid, stable, and easy diagnostic tool for Human African Trypanosomiasis. PLoS Negl. Trop. Dis. 2015, 9, e0003578. [Google Scholar] [CrossRef] [Scilit]
- Faggion, S.A.; Salvador, A.R.; Jacobino, K.; Bortolotto, L.; Lopes, M.B.; Silva, M.; Santos, E.V.; Fachin, A.L.; Franca, S.C.; Marins, M. Loop-mediated isothermal amplification assay for the detection of Ehrlichia canis DNA in blood samples from dogs. Arch. de Med. 2013, 45, 197–201. [Google Scholar] [CrossRef] [Scilit]
- Muangchuen, A.; Chaumpluk, P.; Suriyasomboon, A.; Ekgasit, S. Colorimetric detection of Ehrlichia canis via nucleic acid hybridization in gold nano-colloids. Sensors 2014, 14, 14472–14487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inokuma, H.; Brouqui, P.; Drancourt, M.; Raoult, D. Citrate synthase gene sequence: A new tool for phylogenetic analysis and identification of Ehrlichia. J. Clin. Microbiol. 2001, 39, 3031–3039. [Google Scholar] [CrossRef] [Scilit]
- Dantas-Torres, F. Biology and ecology of the brown dog tick, Rhipicephalus sanguineus. Parasit. Vectors 2010, 3, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perez, M.; Bodor, M.; Zhang, C.; Xiong, Q.; Rikihisa, Y. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann. N. Y. Acad. Sci. 2006, 1078, 110–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Baena, C.; Cárdenas, M.F.; Ramón, J.F. Cerebral haemorrhage as a clinical manifestation of human ehrlichiosis. BMJ Case Rep. 2017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bouza-Mora, L.; Dolz, G.; Solórzano-Morales, A.; Romero-Zuñiga, J.J.; Salazar-Sánchez, L.; Labruna, M.B.; Aguiar, D.M. Novel genotype of Ehrlichia canis detected in samples of human blood bank donors in Costa Rica. Ticks Tick Borne Dis. 2017, 8, 36–40. [Google Scholar] [CrossRef] [Scilit]
- Sainz, Á.; Roura, X.; Miró, G.; Estrada-Peña, A.; Kohn, B.; Harrus, S.; Solano-Gallego, L. Guideline for veterinary practitioners on canine ehrlichiosis and anaplasmosis in Europe. Parasit. Vectors 2015, 8, 75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marsilio, F.; Di Martino, B.; Meridiani, I.; Bianciardi, P. Direct identification of Ehrlichia canis by a novel polymerase chain reaction method and molecular analysis of the citrate synthase (gltA) gene from various Italian strains. J. Vet. Diagn. Investig. 2006, 18, 215–217. [Google Scholar] [CrossRef] [Scilit]
- Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.-I. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques 2009, 46, 167–172. [Google Scholar] [CrossRef] [Scilit]
- Nambooppha, B.; Rittipornlertrak, A.; Tattiyapong, M.; Tangtrongsup, S.; Tiwananthagorn, S.; Chung, Y.-T.; Sthitmatee, N. Two different genogroups of Ehrlichia canis from dogs in Thailand using immunodominant protein genes. Infect. Genet. Evol. 2018, 63, 116–125. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Luo, T.; Keysary, A.; Baneth, G.; Miyashiro, S.; Strenger, C.; Waner, T.; McBride, J.W. Genetic and antigenic diversities of major immunoreactive proteins in globally distributed Ehrlichia canis strains. Clin. Vaccine Immunol. 2008, 15, 1080–1088. [Google Scholar] [CrossRef] [Scilit]
- Nakao, R.; Stromdahl, E.Y.; Magona, J.W.; Faburay, B.; Namangala, B.; Malele, I.; Inoue, N.; Geysen, D.; Kajino, K.; Jongejan, F.; et al. Development of loop-mediated isothermal amplification (LAMP) assays for rapid detection of Ehrlichia ruminantium. BMC Microbiol. 2010, 10, 296. [Google Scholar] [CrossRef] [Scilit]
- Ma, M.; Liu, Z.; Sun, M.; Yang, J.; Guan, G.; Li, Y.; Luo, J.; Yin, H. Development and evaluation of a loop-mediated isothermal amplification method for rapid detection of Anaplasma ovis. J. Clin. Microbiol. 2011, 49, 2143–2146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, X.B.; Jiang, H.T.; Zhang, Y.L.; Lang, X.Y.; Liu, J.; Ni, H.B. Rapid and sensitive diagnosis of cattle anaplasmosis by loop-mediated isothermal amplification (LAMP). Pak. Vet. J. 2016, 36, 174–178. [Google Scholar]

| Method | Primer Name | Sequence (5′ → 3′) | Reference |
|---|---|---|---|
| PCR | Ecanis Fw | TTATCTGTTTGTGTTATATAAGC | [20] |
| Ecanis Rev | CAGTACCTATGCATATCAATCC | ||
| LAMP | Ecanis F3 | GCTGATCATGAGCAAAATGC | This study |
| Ecanis B3 | GCCTCGTACTTTTATTACCATCT | ||
| Ecanis FIP | TCCCTGCTACCAAACAAGCAAGCTACTGTTAGGTTGGCTG | ||
| Ecanis BIP | AGCTCATGGTGGTGCTAATGAATTGAATAAACTGCTTTACGTTAC | ||
| Ecanis LF | ATAAGTCAGCACCAGAAGAAC | ||
| Ecanis LB | GCTGTGATTAATATGTTAATGGCA |
| Sample ID | PCR Result | LAMP Temperature (°C) | ||||||
|---|---|---|---|---|---|---|---|---|
| 60 | 61 | 62 | 63 | 64 | 65 | |||
| 1 | BESC5 | + | + | + | + | + | + | − |
| 2 | BBV3 | + | + | + | + | + | + | − |
| 3 | PSY20 | + | + | + | + | + | + | − |
| 4 | D8 | + | + | + | + | + | + | − |
| 5 | D25 | + | + | + | + | + | + | + |
| 6 | D26 | + | + | + | + | + | + | − |
| 7 | BHK2 | − | − | − | − | − | − | − |
| 8 | D45 | − | − | − | + | + | − | − |
| 9 | Neg Control | − | − | − | − | − | − | − |
| PCR Positive | PCR Negative | Total | |
|---|---|---|---|
| LAMP positive | 37 | 0 | 37 |
| LAMP negative | 3 | 10 | 13 |
| Total | 40 | 10 | 50 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chua, A.P.B.; Galay, R.L.; Tanaka, T.; Yamazaki, W. Development of a Loop-Mediated Isothermal Amplification (LAMP) Assay Targeting the Citrate Synthase Gene for Detection of Ehrlichia canis in Dogs. Vet. Sci. 2020, 7, 156. https://doi.org/10.3390/vetsci7040156
Chua APB, Galay RL, Tanaka T, Yamazaki W. Development of a Loop-Mediated Isothermal Amplification (LAMP) Assay Targeting the Citrate Synthase Gene for Detection of Ehrlichia canis in Dogs. Veterinary Sciences. 2020; 7(4):156. https://doi.org/10.3390/vetsci7040156
Chicago/Turabian StyleChua, Angela Patricia B., Remil L. Galay, Tetsuya Tanaka, and Wataru Yamazaki. 2020. "Development of a Loop-Mediated Isothermal Amplification (LAMP) Assay Targeting the Citrate Synthase Gene for Detection of Ehrlichia canis in Dogs" Veterinary Sciences 7, no. 4: 156. https://doi.org/10.3390/vetsci7040156
APA StyleChua, A. P. B., Galay, R. L., Tanaka, T., & Yamazaki, W. (2020). Development of a Loop-Mediated Isothermal Amplification (LAMP) Assay Targeting the Citrate Synthase Gene for Detection of Ehrlichia canis in Dogs. Veterinary Sciences, 7(4), 156. https://doi.org/10.3390/vetsci7040156

