Antigenic Matching of rHVT-H5 via CRISPR/Cas9 Confers Complete Protection Against Novel H5N1 Clade 2.3.4.4b in Chicken

Simple Summary

The rapid and continuous evolution of clade 2.3.4.4b H5N1 highly pathogenic avian influenza (HPAI) poses a severe threat to the global poultry industry and public health. While vaccination is a key control strategy, traditional vaccine development often lags behind the rapid antigenic changes in the virus. In this study, we utilized an advanced CRISPR/Cas9 gene-editing platform to rapidly develop a new recombinant turkey herpesvirus (rHVT-H5) vaccine that is precisely matched to the currently circulating 2.3.4.4b strains. Our results demonstrate that this vaccine provides 100% protection against lethal infection in chickens and significantly suppresses the shedding of the virus into the environment. These findings are highly significant as they offer a rapid-response solution to poultry disease management, providing a technological platform for quickly updating vaccines to halt the spread of emerging viral variants and safeguard food security.

Abstract

The widespread panzootic of clade 2.3.4.4b highly pathogenic avian influenza (HPAI) H5N1 necessitates the development of vaccine platforms capable of rapid adaptation to emerging antigenic variants. Although commercial recombinant turkey herpesvirus (rHVT) vaccines are available, they often utilize heterologous inserts that may fail to optimally limit viral shedding of novel field strains. Here, we report the rapid construction of a homologous rHVT-H5 vaccine expressing the hemagglutinin (HA) gene of a representative clade 2.3.4.4b isolate via CRISPR/Cas9-mediated non-homologous end joining (NHEJ). In vitro characterization confirmed stable HA surface expression and growth kinetics comparable to the parental virus. In specific-pathogen-free (SPF) chickens, rHVT-H5 elicited robust hemagglutination inhibition (HI) antibody titers. Following lethal challenge with a homologous clade 2.3.4.4b H5N1 virus, the vaccine conferred 100% protection against mortality and clinical signs while significantly reduced oropharyngeal sheddings and completely inhibited viral shedding in cloacal samples. These findings demonstrate that an antigenically matched rHVT-H5 constitutes a promising strategy for mitigating the ongoing global threat posed by clade 2.3.4.4b HPAI H5N1.

1. Introduction

Since the emergence of the A/goose/Guangdong/1/1996 (Gs/GD) lineage of highly pathogenic avian influenza (HPAI) H5N1 viruses, the virus has diversified into distinct phylogenetic clades (0–9), with multiple subclades evolving over time [1,2]. This continuous diversification of the H5-subtype hemagglutinin (HA) gene, coupled with reassortment events between wild bird-origin low pathogenic avian influenza viruses (LPAIV) and HPAI H5Nx viruses, has driven the emergence of the novel variant clade 2.3.4.4b HPAI H5N1 [3]. Since the initial detection of clade 2.3.4.4b HPAI H5N1 in Europe (Netherlands) in 2020, the virus has spread across continents, causing significant economic losses and posing a substantial public health threat [4]. More recently, the unprecedented spillover events into dairy cattle and other mammalian species during 2024–2025 have further intensified global concerns regarding the virus’s expanding host range and zoonotic urgency [5,6,7].

Vaccination of poultry remains a critical strategy for controlling HPAI outbreaks and mitigating public health risks [8,9]. While whole inactivated virus vaccines have been widely deployed, their efficacy is often compromised by the genetic diversity of circulating field strains, interference from maternally derived antibodies (MDA) in chicks, and a reliance primarily on humoral immunity [8,9]. In contrast, recombinant herpesvirus of turkeys (rHVT) vectors have gained prominence due to their favorable safety profile, ability to break through MDA, and capacity to induce robust cellular immunity. Indeed, rHVT vaccines have demonstrated effective protection against H9N2, H5Nx, and H7Nx avian influenza viruses [10,11].

Although commercially available HVT vector vaccines provide high-level protection against historical HPAI H5Nx strains, recent studies indicate that they may offer only partial clinical protection and fail to fully suppress viral shedding against the currently circulating clade 2.3.4.4b viruses due to antigenic mismatch [12,13,14]. Furthermore, the traditional generation of rHVT vaccines via homologous recombination is often labor-intensive and time-consuming, hindering the rapid update of vaccine antigens. Consequently, there is an urgent need for a flexible platform to rapidly develop antigenically matched vaccines against emerging variants. To address the need for both speed and antigenic precision, we employed the CRISPR/Cas9-mediated non-homologous end joining (NHEJ) system. This approach allowed us to rapidly generate an rHVT vector vaccine expressing the HA gene derived from a representative clade 2.3.4.4b HPAI H5N1 isolate. In this study, we describe the construction of this homologous rHVT-H5 candidate and evaluate its protective efficacy in specific-pathogen-free (SPF) chickens, highlighting its potential as a superior platform for rapid vaccine adaptation.

2. Materials and Methods

2.1. Cell Culture and Viruses

Primary chick embryo fibroblasts (CEFs) were prepared from 10-day-old embryos and cultured in M199 medium (Gibco, Grand Island, NY, USA) supplemented with 1% antibiotics and 2–5% fetal bovine serum (FBS) at 37 °C in 5% CO₂. The HVT FC126 strain (NCBI: AF291866.1) was used as the vector backbone. The clade 2.3.4.4b HPAI H5N1 strain A/Spot-billed/Korea/1114/2022 (H5N1/2022) was propagated in 9-day-old specific-pathogen-free (SPF) embryonated eggs [15].

2.2. Construction of Cas9/gRNA Expression Plasmid and Donor Plasmid

Cas9/gRNA expression plasmids targeting the HVT US2 region and SgB sequences (PX459-US2-gRNA and PX459-SgB-gRNA) were constructed as previously described [15]. For the donor plasmid, the HA gene (1695 bp) from the representative clade 2.3.4.4b HPAI H5N1 A/Herring-gull/France/22P015977/2022 (GISAID: EPI_ISL_13519451) was synthesized (Bionics, Seoul, Korea) with a modified monobasic cleavage site (RETR↓GLF) to ensure safety [16,17]. This strain was selected as a representative Clade 2.3.4.4b isolate available during the European outbreak at the time of vector construction. Furthermore, the synthesized HA sequence shares high nucleotide homology (97.5%) with the Korean challenge strain (H5N1/2022) used in this study. The modified H5HA gene was cloned into the mCMV expression cassette of the pGEM-SgB-LoxN-RFP plasmid using SfiI restriction sites to generate pGEM-SgB-LoxN-RFP-H5HA. In the present study, the modified H5HA gene was cloned into the murine cytomegalovirus (mCMV) expression cassette in pGEM-SgB-LoxN-RFP by SfiI restriction sites, and pGEM-SgB-LoxN-RFP-H5HA was used in the generation of recombinant rHVT-H5 viruses.

2.3. Generation of Recombinant rHVT-H5

The rHVT-H5 was generated via NHEJ-CRISPR/Cas9 as previously described [15]. CEFs were co-transfected with 0.2 μg of each gRNA plasmid and 0.5 μg of donor plasmid using Lipofectamine^® 3000 (Invitrogen, Carlsbad, CA, USA). Cells were treated with puromycin (1 μg/mL) 24 h post-transfection and infected with HVT (0.01 MOI) 3 days later. Recombinant viruses were purified by sorting RFP-expressing cells using a BD FACS Aria™ III (BD Biosciences, Ann Arbor, MI, USA), followed by plaque purification. Insertion purity and orientation were verified by PCR using primers listed in

Table 1. List of primers used in this study.

Primer	Sequence (5′-3′)	Reference
US2-gRNA-F	CACCACACAAATTGCGTTTAGGTG	[15]
US2-gRNA-R	AAACCACCTAAACGCAATTTGTGT
SgB-gRNA-F	CACCGAAGTCGAGTTCGGCTAGAC
SgB-gRNA-R	AAACGTCTAGCCGAACTCGACTTC
HVT-US2-F	CTGTGATACACTTGGGAGCC
HVT-US2-R	GACGTTTCCGATCTTCCACA
RFP-internal-R	ACTCCTTGATGACGTCCTCG

.

2.4. Virus Growth Kinetics

To evaluate viral replication characteristics, CEF monolayers in 24-well plates were infected with 100 PFU of either rHVT-H5 or the parental HVT strain. Infected cells were collected at specified intervals (24, 48, 72, 96, and 120 h post-infection). Genomic DNA isolation was performed using the Viral RNA/DNA Extraction Kit (iNtRON Biotechnology, Kirkland, WA, USA) according to the manufacturer’s guidelines. Subsequently, viral genome copy numbers per 10⁴ cells were determined via qPCR using the Brilliant III Ultra-Fast SYBR Green Master Mix (Agilent Technologies, Santa Clara, CA, USA) [18,19].

2.5. Immunofluorescence Assay (IFA)

To identify the expression of H5-HA proteins in the rHVT-H5, IFA analysis was carried out as previously described [20]. Briefly, CEFs infected with rHVT-H5 or parental HVT (0.01 MOI) were fixed with 4% paraformaldehyde at 3 dpi and permeabilized with 0.1% PBS-Tween 20 (PBS-T). Cells were incubated with chicken anti-H5N1/2022 polyclonal antibody (1:200) for 1 h at 37 °C, followed by FITC-conjugated goat anti-chicken IgG (1:200; Jackson ImmunoResearch, West Grove, PA, USA). After incubation, each well was washed 3 times with PBS-T. The results were observed by fluorescence inverse microscopy (ECLIPSE Ti-U, Nikon Instruments Inc., Tokyo, Japan) [20].

2.6. Genetic Stability of rHVT-H5

The stability of rHVT-H5 was assessed over 20 passages in CEF cells. The stable integration of inserted H5HA cassette in US2 region of rHVT-H5 and purity of rHVT-H5 was verified at every fifth passage through PCR, using DNA samples extracted from the cells, and stability of expressed H5HA protein was examined via IFA.

2.7. Animal Experiments and Evaluation of Protective Efficacy

Thirty-seven 1-day-old SPF white leghorn chicks were purchased (Namduk SPF, Icheon, Republic of Korea) and were divided into 5 groups (G1–5) to evaluate the protective efficacy of rHVT-H5. G1 (n = 8) and G3 (n = 5) received subcutaneous vaccination in the neck with 2000 PFU/0.2 mL of rHVT-H5 and parental HVT, respectively. G2 (n = 8) received intramuscular vaccination with inactivated H5N1/2022 (10^8.2 EID₅₀/0.2 mL) with commercial oil adjuvant; MontanideTM ISA 70VG (SEPPIC, Courbevoie, France) at a ratio of 3:7 (w/w). Each bird received a final injection volume of 0.2 mL (containing 0.06 mL antigen and 0.14 mL adjuvant) via the subcutaneous route. The control groups, G4; positive (n = 8) and G5; negative (n = 8) received subcutaneous injections of PBS in a 200 µL. Sera (approx. 0.5 mL) were collected weekly (1–4 WPV) to quantify antibody titers via hemagglutination inhibition (HI) assays [21]. At 4 WPV, chickens in 4 groups (G1–4) were challenged intranasally with 200 µL of 10^6.0 EID₅₀ of H5N1/2022. Daily monitoring for clinical symptoms and mortality was conducted. To assess viral shedding, oropharyngeal (OP) and cloacal (CL) swabs were obtained at 2 and 5 days post-challenge (DPC). Surviving birds were humanely euthanized at the experiment’s conclusion (7 DPC). To assess virus shedding, oropharyngeal and cloacal swabs collected at 2 and 5 DPC were inoculated into 10-day-old SPF embryonated eggs (4 eggs per dilution) to determine EID₅₀ titers. Viral growth was confirmed by hemagglutination (HA) assay using 1% chicken red blood cells. Viral titers were calculated using the Reed-Muench method and expressed as log₁₀ EID₅₀/mL, the theoretical limit of detection was 1EID.

2.8. Statistical Analysis

Data were analyzed using one-way ANOVA in SPSS version 21.0 (SPSS Inc., Chicago, IL, USA). Viral titers and hemagglutination inhibition (HI) titers were log₁₀-transformed to ensure normal distribution before statistical comparison. The normality of the data distribution was assessed using the Shapiro-Wilk test. Differences between experimental groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s post-hoc test for multiple comparisons. Survival rates were analyzed using Kaplan-Meier survival curves, and differences between groups were determined using the log-rank test. Data are presented as mean ± standard deviation (SD). Statistical significance was defined at * p < 0.05, ** p < 0.01, and *** p < 0.001.

3. Results

3.1. Generation and Verification of rHVT-H5

Construction of rHVT-H5 involved the co-transfection of CEFs with the donor plasmid (pGEM-SgB-LoxN-RFP-H5HA) and two gRNA vectors (PX459-US2-gRNA and PX459-SgB-gRNA). Twenty-four hours post-transfection, the cells were treated with puromycin for three days, followed by infection with the parental HVT FC126 strain (0.01 MOI). Successful integration of the RFP-H5HA cassette into the HVT US2 locus was evidenced by the appearance of RFP-positive plaques at 3 dpi, visualized using a Cy3 filter (Figure 1). Approximately 200 RFP-positive plaques were observed in a transfected well containing 4 × 10⁵ CEF cells, indicating a recombination efficiency of approximately 0.05%. PCR screening was conducted to verify insertion orientation: the primer pairs HVT-US2-F/RFP-internal-R identified RFP-H5HA cassettes were inserted in forward orientation in rHVT-H5, yielding target bands of 769 bp, respectively. For insertion in the reverse orientation, primer pairs RFP-internal-R/HVT-US2-R were used with target bands of 1373bp, respectively. Gel electrophoresis confirmed each target size of bands and additional sequencing results confirmed that RFP-H5HA cassettes were successfully integrated into HVT genome in both forward and reverse orientations (Figure S1).

3.2. Purification of Recombinant rHVT-H5

The rHVT-H5 was generated by co-transfecting CEFs with gRNA plasmids and the donor plasmid, followed by puromycin selection and HVT infection. RFP-expressing plaques observed at 3 dpi confirmed the successful insertion of the RFP-H5HA cassette into the HVT US2 region (Figure 1). PCR analysis and sequencing verified that the cassette was integrated in both forward (769 bp) and reverse (1373 bp) bands (Figure 2). After purification of rHVT-H5, inserted RFP cassettes were excised by using Cre-Lox systems. Following 2–3 rounds of purification by non-RFP-expressing HVT plaques, RFP excised rHVT-H5 was purified.

3.3. Comparative Growth Kinetics

The growth kinetics of rHVT-H5 were evaluated to determine whether the insertion of the H5HA cassette into the US2 region of parental HVT influenced the viral replication property of the recombinant virus. The growth property between rHVT-H5 and parental HVT showed no significant differences (p > 0.05) through all tested time points (24-, 48-, 72-, 96-, and 120-h post-infection) (Figure 3).

3.4. Genetic Stability

The genetic stability of the inserted H5HA cassette in rHVT-H5 was evaluated by serially passaging in CEF cells across 20 passages. Every fifth passage (5, 10, 15, and 20), stable integration of the H5HA cassette in the US2 region of the HVT genome was confirmed by PCR. For the purity of rHVT-H5, the recurrence of parental HVT was not identified by PCR using primer sets HVT-US2-F/HVT-US2-R (Figure S2). Followed by IFA results, the H5HA protein can be stably expressed on HVT-H5-infected cells. These results indicate stable integration and expression of the H5HA cassette into the US2 region of the HVT genome after 20 passages (Figure 4).

3.5. Humoral Immune Response

To evaluate the immunogenic potential of rHVT-H5 in SPF chickens, serum samples were collected weekly post-vaccination to monitor antibody levels via HI assay. HI titers in G1 (rHVT-H5) and G2 (Inactivated H5N1/2022) were detected from two weeks post vaccination (WPV). By the third week (3 WPV), both vaccinated groups achieved a 100% seroconversion rate, displaying mean Log₂ HI titers of 5.4 ± 1.5 and 5.9 ± 2.3, respectively. Before challenge (4 WPV), the seropositivity rate of both groups reached 100%, with mean Log₂ HI titers of 6.3 ± 1.7 and 6.9 ± 2.0, respectively, without statistically significant differences in mean Log₂ HI titers (p > 0.05). No seroconversion was observed in other groups (Figure 5).

3.6. Protective Efficacy in Chickens

Throughout the 7-day observation period, all chickens in G3 (parental HVT) and G4 (positive control) died within 2 days, and the mean time of death (MDT) of each group was 1.4 and 1.8 days, respectively. In vaccinated group G1 (rHVT-H5) and G2 (Inactivated H5N1/2022), all chickens remained healthy and exhibited no clinical symptoms of HPAI H5N1 for 7 days. G3 and G4 showed the highest virus shedding in oropharyngeal (OP) swab with Log₁₀ EID₅₀/mL titers of 6.8 ± 0.5 and 6.9 ± 0.7, respectively. Compared with G3 and G4, vaccinated group G1 and G2 showed lower virus shedding with Log₁₀ EID₅₀ titers of 2.3 ± 0.5 and 3.0 ± 0.5, respectively (p < 0.001). In 5 DPC, virus shedding in G1 and G2 showed similar levels, Log₁₀ EID₅₀ titers of 3.1 ± 0.1 and 2.8 ± 0.9, respectively (p > 0.05). For the virus shedding in cloacal (CL) swab, G3 and G4 showed the highest virus shedding with Log₁₀ EID₅₀/mL titers of 5.2 ± 0.6 and 5.9 ± 0.3, respectively. No virus shedding was observed in G1 and G2 on 2 DPC. In 5 DPC, no infectious viruses were detected on G1. Compared with G1, virus shedding in two chickens in G2 on 5 DPC showed Log₁₀ EID₅₀/mL titers of 0.4 ± 0.7. (

Table 2. Protective efficacy of rHVT-H5 against H5N1/2022 challenge.

Group	Vaccination	Mortality a (% Positive)	Virus Shedding (Log10 EID50/mL; % Positive)				PI b
			2 DPC		5 DPC
			OP	CL	OP	CL
G1	rHVT-H5	0/8 (0)	2.3 ± 0.5 (100)	- (0)	3.1 ± 0.1 (100)	- (0)	100
G2	Inactivated H5N1/2022	0/8 (0)	3.0 ± 0.5 (100)	- (0)	2.8 ± 0.9 (75)	0.4 ± 0.7 (25)	100
G3	Parental HVT	5/5 (100)	6.8 ± 0.5 (100)	5.2 ± 0.6 (100)	N/A c	N/A	0
G4	Positive control	8/8 (100)	6.9 ± 0.7 (100)	5.9 ± 0.3 (100)	N/A	N/A	-
G5	Negative control	0/8 (0)	-	-	-	-	-

^a Mortality: No. Dead/total No. of birds. ^b PI: protection index = % survival. ^c N/A: Not applicable, all birds in groups died before 5 DPC.

and Table S1). It is noteworthy that while the rHVT-H5 vaccine (G1) completely inhibited cloacal shedding, the inactivated vaccine group (G2) exhibited detectable cloacal shedding in 25% of the birds at 5 DPC, despite conferring protection against mortality.

4. Discussion

The global dissemination and recurrent outbreaks of the novel clade 2.3.4.4b highly pathogenic avian influenza (HPAI) H5N1 virus have caused extensive economic losses in the poultry industry and led to mass mortality among various free-living mammalian species [3,22]. While AIVs typically exhibit a high degree of genetic conservation in their natural reservoirs—such as wild waterfowl, gulls, and shorebirds—transmission to aberrant hosts like domestic poultry often drives significant genetic and antigenic divergence [2]. Consequently, for a vaccine to be effective, it is imperative that the seed strain shares high genetic and antigenic homology with circulating field viruses. Given the rapid evolution of the virus, selecting an antigenically matched vaccine strain is critical for effective outbreak control [8,9]. Addressing this urgent need, this study demonstrates the utility of the CRISPR/Cas9-mediated non-homologous end joining (NHEJ) platform for the rapid generation of a vaccine targeting the currently circulating clade 2.3.4.4b H5N1 variants.

The HVT vector has been widely applied as a viral backbone for vaccines against various avian pathogens, including infectious bursal disease virus (IBDV), Newcastle disease virus (NDV), and infectious laryngotracheitis virus (ILTV) [23]. Building upon our previous work, we constructed an HVT vector-based vaccine using the non-homologous end joining (NHEJ)-CRISPR/Cas9 system to rapidly generate recombinant vaccine strains against emerging poultry diseases, including Y280-lineage LPAI H9N2 and G2d-lineage variant IBDV circulating in Korea [15,24,25]. In this study, the purification of recombinant rHVT from mixed viral pools containing both recombinant and parental HVT was efficiently achieved using fluorescence-activated cell sorting (FACS) with removable fluorescent markers such as RFP or GFP, which were subsequently excised via the Cre-Lox system [26]. The combination of NHEJ-CRISPR/Cas9-mediated genome editing and FACS-based purification represents a rapid and effective strategy for generating recombinant HVTs, as confirmed in previous studies [15,24,25]. Moreover, our results demonstrated that the rHVT-H5 generated by this approach maintained stable integration of the insert and consistent expression of H5HA after 20 serial passages in chicken embryo fibroblast (CEF) cells. These findings indicate high genetic stability, consistent with the stability profiles reported for constructs generated via the bacterial artificial chromosome (BAC) system [27,28]. Taken together, these findings confirm that the CRISPR/Cas9-based approach provides a fast, flexible, and genetically stable platform for developing recombinant avian vaccines [15,24,25,29].

The rHVT-H5 vaccine induced humoral immune responses comparable to those of inactivated H5N1 vaccines, exceeding the hemagglutination inhibition (HI) protective titer of 40 HI titers, which is generally regarded as the minimum protective antibody level against avian influenza virus (AIV) [30]. Upon challenge with clade 2.3.4.4b HPAI H5N1, vaccinated chickens exhibited 100% protection and no clinical signs of disease. Interestingly, even in individuals with pre-challenge HI titers below the protective level (4–5 log₂), full protection was observed. This discrepancy implies that serum HI titers alone may not fully capture the vaccine’s protective efficacy. Previous studies have reported that HVT-vectored vaccines can induce robust cell-mediated immune (CMI) responses, which are critical for protection against influenza viruses [31,32]. Although CMI parameters were not directly measured in the present study, the protection observed in birds with lower antibody titers suggests that cellular immunity induced by the HVT vector may have contributed to the overall protective outcome, consistent with the established immunogenic profile of HVT-based platforms [32]. These results highlight that the rHVT-H5 vaccine would elicit a comprehensive immune response, in which both humoral and cellular immunity act synergistically to provide robust and durable protection.

Viral shedding analysis further demonstrated that oropharyngeal (OP) shedding was reduced by approximately 10,000-fold compared with the positive control, and cloacal (CL) shedding was completely absent throughout the study period. These findings meet the vaccine efficacy standards established by the World Organization for Animal Health (WOAH) [8], which require vaccines to confer high protection against mortality (typically > 80%) and provide a significant reduction in viral shedding to prevent the “silent spread” of the virus in vaccinated flocks. The complete inhibition of viral replication in the intestinal tract suggests that the rHVT-H5 vaccine induces strong systemic immunity capable of blocking fecal–oral transmission—a major pathway for viral spread in poultry farms [8]. Similar suppression of viral shedding has also been reported for other rHVT-H5 constructs [31,32,33]. Therefore, the ability of rHVT-H5 to prevent both clinical disease and viral shedding in cloacal highlights its potential to significantly reduce environmental contamination and interrupt transmission cycles in the field [8,32,33].

Despite the robust protective efficacy observed in our rHVT-H5 candidate, this study remains subject to certain limitations. In commercial poultry production, maternally derived antibodies (MDA) are a significant hurdle for traditional inactivated vaccines [8,9]. Future trials in commercial broilers or layers with MDA are necessary to evaluate the rHVT-H5 vaccine’s performance under field-representative conditions [8,9]. In addition, while our animal experiment suggests a potential for cell-mediated immunity (CMI), we did not perform a comprehensive functional assessment of T-cell responses. The underlying mechanism of the synergistic humoral and cellular protection requires further studies [31,32]. Furthermore, although viral shedding was significantly suppressed, the absence of sentinel birds in our challenge model means that the vaccine’s ability to completely interrupt horizontal transmission cannot be definitively concluded [8]. Additionally, the current study utilized a single homologous challenge virus; thus, the potential for heterologous cross-protection against other divergent Clade 2.3.4.4b subclades remains to be assessed. Moreover, due to the short observation period, the long-term duration of immunity (DOI) conferred by the vaccine was not evaluated. Lastly, the early onset of immunity—critical for emergency intervention—remains to be elucidated in trials following a shorter post-vaccination interval [8,23].

5. Conclusions

To summarize, this study describes the successful generation of a homologous rHVT-H5 vector harboring the clade 2.3.4.4b HPAI H5N1 HA gene, utilizing the NHEJ-CRISPR/Cas9 platform coupled with FACS purification. Immunization of SPF chickens with this candidate induced potent humoral immunity, characterized by elevated HI titers, and provided complete clinical protection against lethal challenge with the homologous H5N1 variant. These findings indicate that the antigenically matched rHVT-H5 developed in this study represents a highly effective and practical strategy for controlling the current global threat posed by clade 2.3.4.4b HPAI H5N1 in poultry.