Antiviral Activity of Diltiazem HCl Against Pseudorabies Virus Infection In Vitro
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, Chemicals, and Antibodies
2.2. Cytotoxicity Assay
2.3. Nucleic Isolation and Quantitative Real-Time PCR Assessment
2.4. Virus Titration
2.5. Indirect Immunofluorescent Assay (IFA)
2.6. Antiviral Activity Analysis
2.7. Inhibitory Action Assay
2.7.1. Inactivation Assay
2.7.2. Pre-Treatment Assay
2.7.3. Viral Attachment Assay
2.7.4. Viral Entry Assay
2.7.5. Virus Replication Assay
2.7.6. Virus Release Assay
2.8. Assessment of the Effect of Intracellular Ca2+ on PRV Infection
2.9. Experiment Design, cDNA Library Construction, and Sequence Date Analysis
2.10. Statistical Analysis
3. Results
3.1. Cytotoxicity of DTZ on Different Cell Lines
3.2. DTZ Significantly Inhibits PRV-HuN-LD Infection in Both Vero and PK15 Cell Lines
3.3. DTZ Inhibits PRV-HuN-LD Infection by Targeting Viral Replication Stage
3.4. DTZ Exhibits Antiviral Efficacy Against PRV and HSV-1
3.5. Transcription Analysis of PK15 Cells Infected with PRV Co-Treated with DTZ
3.6. Validation of Transcriptional Levels of DEGs Using RT-qPCR
3.7. Ca2+ Uptake Is Essential for PRV Infection In Vitro
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tan, L.; Wang, K.; Bai, P.; Zhang, S.; Zuo, M.; Shu, X.; Wang, A.; Yao, J. Host cellular factors involved in pseudorabies virus attachment and entry: A mini review. Front. Vet. Sci. 2023, 10, 1314624. [Google Scholar] [CrossRef] [PubMed]
- Tan, L.; Yao, J.; Yang, Y.; Luo, W.; Yuan, X.; Yang, L.; Wang, A. Current status and challenge of pseudorabies virus infection in China. Virol. Sin. 2021, 36, 588–607. [Google Scholar] [CrossRef]
- Chen, H.; Fan, J.; Sun, X.; Xie, R.; Song, W.; Zhao, Y.; Yang, T.; Cao, Y.; Yu, S.; Wei, C.; et al. Characterization of pseudorabies virus associated with severe respiratory and neuronal signs in old pigs. Transbound. Emerg. Dis. 2023, 2023, 8855739. [Google Scholar] [CrossRef]
- Liu, Q.; Kuang, Y.; Li, Y.; Guo, H.; Zhou, C.; Guo, S.; Tan, C.; Wu, B.; Chen, H.; Wang, X. The epidemiology and variation in pseudorabies virus: A continuing challenge to pigs and humans. Viruses 2022, 14, 1463. [Google Scholar] [CrossRef]
- Liu, Q.; Wang, X.; Xie, C.; Ding, S.; Yang, H.; Guo, S.; Li, J.; Qin, L.; Ban, F.; Wang, D.; et al. A novel human acute encephalitis caused by pseudorabies virus variant strain. Clin. Infect. Dis. 2021, 73, e3690–e3700. [Google Scholar] [CrossRef]
- Wei, L.; Hu, Y.; Bai, L.; Xiao, C.; Liu, Z.; You, Y.; Wang, K.; Huang, Y.; Zhu, J.; Weng, J.; et al. Design of the inhibitors for pseudorabies virus replication by reinforcement learning from HSV-1 DNA polymerase inhibitors. ACS Omega 2025, 10, 3389–3397. [Google Scholar] [CrossRef]
- Panyasing, Y.; Kedkovid, R.; Kittawornrat, A.; Ji, J.; Zimmerman, J.; Thanawongnuwech, R. Detection of Aujeszky’s disease virus DNA and antibody in swine oral fluid specimens. Transbound. Emerg. Dis. 2018, 65, 1828–1835. [Google Scholar] [CrossRef]
- Mahmoud, H.Y.; Suzuki, K.; Tsuji, T.; Yokoyama, M.; Shimojima, M.; Maeda, K. Pseudorabies virus infection in wild boars in Japan. J. Vet. Med. Sci. 2011, 73, 1535–1537. [Google Scholar] [CrossRef] [PubMed]
- Truong, Q.L.; Seo, T.W.; Yoon, B.I.; Kim, H.C.; Han, J.H.; Hahn, T.W. Prevalence of swine viral and bacterial pathogens in rodents and stray cats captured around pig farms in Korea. J. Vet. Med. Sci. 2013, 75, 1647–1650. [Google Scholar] [CrossRef] [PubMed]
- Papageorgiou, K.; Stoikou, A.; Papadopoulos, D.K.; Tsapouri-Kanoula, E.; Giantsis, I.A.; Papadopoulos, D.; Stamelou, E.; Sofia, M.; Billinis, C.; Karapetsiou, C.; et al. Pseudorabies Virus Prevalence in Lung Samples of Hunted Wild Boars in Northwestern Greece. Pathogens 2024, 13, 929. [Google Scholar] [CrossRef]
- Ferrara, G.; Pagnini, U.; Parisi, A.; Amoroso, M.G.; Fusco, G.; Iovane, G.; Montagnaro, S. A pseudorabies outbreak in hunting dogs in Campania region (Italy): A case presentation and epidemiological survey. BMC Vet. Res. 2024, 20, 323. [Google Scholar] [CrossRef]
- Konjević, D.; Sučec, I.; Turk, N.; Barbić, L.; Prpić, J.; Krapinec, K.; Bujanić, M.; Jemeršić, L.; Keros, T. Epidemiology of Aujeszky disease in wild boars (Sus scrofa L.) in Croatia. Vet. Res. Commun. 2023, 47, 631–639. [Google Scholar] [CrossRef]
- Cano-Terriza, D.; Martínez, R.; Moreno, A.; Pérez-Marín, J.E.; Jiménez-Ruiz, S.; Paniagua, J.; Borge, C.; García-Bocanegra, I. Survey of Aujeszky’s Disease Virus in Hunting Dogs from Spain. Ecohealth 2019, 16, 351–355. [Google Scholar] [CrossRef]
- Serena, M.S.; Cappuccio, J.; Fossaroli, M.; Williman, M.M.; Dibarbora, M.; Brizzio, R.; Metz, G.; Aspitia, C.; Perez, A.; Carpinetti, B.; et al. Characterization of new strains of Pseudorabies virus in Argentina: Detection of interspecies transmission. Open Vet. J. 2023, 13, 419–426. [Google Scholar] [CrossRef] [PubMed]
- Kmetiuk, L.B.; Cassaro Villalobos, E.M.; do Carmo Custódio de Souza Hunold Lara, M.; Machado, F.P.; Lipinski, L.C.; Dos Santos, A.P.; de Barros Filho, I.R. Serosurvey for Pseudorabies (Aujeszky’s Disease) in Free-Range Wild Boars (Sus scrofa) of Brazil. J. Wildl. Dis. 2020, 56, 959–961. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Auclert, L.Z.; Zhai, X.; Wong, G.; Zhang, C.; Zhu, H.; Xing, G.; Wang, S.; He, W.; Li, K.; et al. Interspecies Transmission, Genetic Diversity, and Evolutionary Dynamics of Pseudorabies Virus. J. Infect. Dis. 2019, 219, 1705–1715. [Google Scholar] [CrossRef] [PubMed]
- Bagur, R.; Hajnóczky, G. Intracellular Ca2+ sensing: Its role in calcium homeostasis and signaling. Mol. Cell 2017, 66, 780–788. [Google Scholar] [CrossRef]
- Berlansky, S.; Sallinger, M.; Grabmayr, H.; Humer, C.; Bernhard, A.; Fahrner, M.; Frischauf, I. Calcium signals during SARS-CoV-2 infection: Assessing the potential of emerging therapies. Cells 2022, 11, 253. [Google Scholar] [CrossRef]
- Cheshenko, N.; Del Rosario, B.; Woda, C.; Marcellino, D.; Satlin, L.M.; Herold, B.C. Herpes simplex virus triggers activation of calcium-signaling pathways. J. Cell Biol. 2003, 163, 283–293. [Google Scholar] [CrossRef]
- Doñate-Macián, P.; Jungfleisch, J.; Pérez-Vilaró, G.; Rubio-Moscardo, F.; Perálvarez-Marín, A.; Diez, J.; Valverde, M.A. The TRPV4 channel links calcium influx to DDX3X activity and viral infectivity. Nat. Commun. 2018, 9, 2307. [Google Scholar] [CrossRef]
- Chen, X.; Cao, R.; Zhong, W. Host calcium channels and pumps in viral infections. Cells 2019, 9, 94. [Google Scholar] [CrossRef]
- Berridge, M.J.; Bootman, M.D.; Roderick, H.L. Calcium signalling: Dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol. 2003, 4, 517–529. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhang, L.K.; Li, S.F.; Zhang, S.F.; Wan, W.W.; Zhang, Y.L.; Xin, Q.L.; Dai, K.; Hu, Y.Y.; Wang, Z.B.; et al. Calcium channel blockers reduce severe fever with thrombocytopenia syndrome virus (SFTSV) related fatality. Cell Res. 2019, 29, 739–753. [Google Scholar] [CrossRef] [PubMed]
- Fujioka, Y.; Nishide, S.; Ose, T.; Suzuki, T.; Kato, I.; Fukuhara, H.; Fujioka, M.; Horiuchi, K.; Satoh, A.O.; Nepal, P.; et al. A sialylated voltage-dependent Ca2+ channel binds hemagglutinin and mediates influenza A virus entry into mammalian cells. Cell Host Microbe 2018, 23, 809–818. [Google Scholar] [CrossRef]
- Lavanya, M.; Cuevas, C.D.; Thomas, M.; Cherry, S.; Ross, S.R. siRNA screen for genes that affect Junín virus entry uncovers voltage-gated calcium channels as a therapeutic target. Sci. Transl. Med. 2013, 5, 204ra131. [Google Scholar] [CrossRef]
- Li, L.; Wang, J.; Chen, L.; Ren, Q.; Akhtar, M.F.; Liu, W.; Wang, C.; Cao, S.; Liu, W.; Zhao, Q.; et al. Diltiazem HCl suppresses porcine reproductive and respiratory syndrome virus infection in susceptible cells and in swine. Vet. Microbiol. 2024, 292, 110054. [Google Scholar] [CrossRef]
- Bai, D.; Fang, L.; Xia, S.; Ke, W.; Wang, J.; Wu, X.; Fang, P.; Xiao, S. Porcine deltacoronavirus (PDCoV) modulates calcium influx to favor viral replication. Virology 2020, 539, 38–48. [Google Scholar] [CrossRef]
- Xiong, K.; Tan, L.; Yi, S.; Wu, Y.; Hu, Y.; Wang, A.; Yang, L. Low-concentration T-2 toxin attenuates pseudorabies virus replication in porcine kidney 15 cells. Toxins 2022, 14, 121. [Google Scholar] [CrossRef]
- Tan, L.; Zhu, P.; Getu, Z.; Yang, X.; Zheng, S.; Duan, Y.; Wang, J.; Wang, J.; Zhou, Y.; Hu, Y.; et al. Antiviral activity of nitazoxanide against pseudorabies virus infection in vitro. Front. Vet. Sci. 2025, 12, 1623545. [Google Scholar] [CrossRef] [PubMed]
- Rosales, C.; Brown, E.J. Calcium channel blockers nifedipine and diltiazem inhibit Ca2+ release from intracellular stores in neutrophils. J. Biol. Chem. 1992, 267, 1443–1448. [Google Scholar] [CrossRef]
- Zhao, M.; Chen, J.; Luo, S.; Zhang, P.; Chen, J.; Sun, C.; Ren, Z.; Huang, Y.; Zhang, X.; Xiang, H.; et al. Epidemiological investigation, related factors, spatial-temporal cluster analysis of pseudorabies virus seroprevalence in Guangdong Province of China. Front. Vet. Sci. 2025, 12, 1581043. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Shi, M.; Yang, H.; Zhang, X.; Zhang, Y.; Liu, R.; Li, L.; Li, S.; Zhou, X.; Li, Y.; et al. Molecular epidemiology and genetic characteristics of pseudorabies virus between 2021 and 2023 in Henan Province of China. J. Vet. Sci. 2025, 26, e26. [Google Scholar] [CrossRef] [PubMed]
- Song, C.; Ye, H.; Zhang, X.; Zhang, Y.; Li, Y.; Yao, J.; Gao, L.; Wang, S.; Yu, Y.; Shu, X. Isolation and characterization of Yunnan variants of the pseudorabies virus and their pathogenicity in rats. Viruses 2024, 16, 233. [Google Scholar] [CrossRef]
- Chen, Y.C.; Wu, C.T.; Chen, J.H.; Tsai, C.F.; Wu, C.Y.; Chang, P.C.; Yeh, W.L. Diltiazem inhibits breast cancer metastasis via mediating growth differentiation factor 15 and epithelial-mesenchymal transition. Oncogenesis 2022, 11, 48. [Google Scholar] [CrossRef]
- Siegel, J.D.; Ko, C.J. Diltiazem-associated photodistributed hyperpigmentation. Yale J. Biol. Med. 2020, 93, 45–47. [Google Scholar]
- McAuley, B.J.; Schroeder, J.S. The use of diltiazem hydrochloride in cardiovascular disorders. Pharmacotherapy 1982, 2, 121–133. [Google Scholar] [CrossRef]
- Dunn, D.M.; Munger, J. Interplay between calcium and AMPK signaling in human cytomegalovirus infection. Front. Cell Infect. Microbiol. 2020, 10, 384. [Google Scholar] [CrossRef]
- Qu, Y.; Wang, S.; Jiang, H.; Liao, Y.; Qiu, X.; Tan, L.; Song, C.; Nair, V.; Yang, Z.; Sun, Y.; et al. Newcastle disease virus infection induces parthanatos in tumor cells via calcium waves. PLoS Pathog. 2024, 20, e1012737. [Google Scholar] [CrossRef]
- Wang, X.; Luo, J.; Wen, Z.; Shuai, L.; Wang, C.; Zhong, G.; He, X.; Cao, H.; Liu, R.; Ge, J.; et al. Diltiazem inhibits SARS-CoV-2 cell attachment and internalization and decreases the viral infection in mouse lung. PLoS Pathog. 2022, 18, e1010343. [Google Scholar] [CrossRef]
- Zhu, L.; Huang, L.; Zhu, Y.; Ding, X.; Zhu, G. Calcium signaling involved in bovine herpesvirus 1 replication in MDBK cells. Acta Virol. 2017, 64, 487–491. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Jiang, P.; Xu, X.; Lu, W.; Yang, C.; Li, L.; Zhou, P.; Liu, S. T-type calcium channels blockers inhibit HSV-2 infection at the late stage of genome replication. Eur. J. Pharmacol. 2021, 892, 173782. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.; Xu, B.; Bao, M.; Gao, Y.; Zhang, Q.; Zhang, X.; Liu, R. Identification of potential biomarkers and pathways associated with carotid atherosclerotic plaques in type 2 diabetes mellitus: A transcriptomics study. Front. Endocrinol. 2022, 13, 981100. [Google Scholar] [CrossRef]
- He, B.; Sun, H.; Bao, M.; Li, H.; He, J.; Tian, G.; Wang, B. A cross-cohort computational framework to trace tumor tissue-of-origin based on RNA sequencing. Sci. Rep. 2023, 13, 15356. [Google Scholar] [CrossRef] [PubMed]
- He, B.; Zhang, Y.; Zhou, Z.; Wang, B.; Liang, Y.; Lang, J.; Lin, H.; Bing, P.; Yu, L.; Sun, D.; et al. A neural network framework for predicting the tissue-of-origin of 15 common cancer types based on RNA-seq data. Front. Bioeng. Biotechnol. 2020, 8, 737. [Google Scholar] [CrossRef]
- Deng, L.; Min, W.; Guo, S.; Deng, J.; Wu, X.; Tong, D.; Yuan, A.; Yang, Q. Interference of pseudorabies virus infection on functions of porcine granulosa cells via apoptosis modulated by MAPK signaling pathways. Virol. J. 2024, 24, 25. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Tao, Q.; Zhang, Y.; Lee, F.-Q.; Xu, T.; Deng, L.-S.; Jian, Z.J.; Zhao, J.; Lai, S.Y.; Zhou, Y.C.; et al. The host cells suppress the proliferation of pseudorabies virus by regulating the PI3K/Akt/mTOR pathway. Microbiol. Spectr. 2024, 12, e0135124. [Google Scholar] [CrossRef]
- Hu, H.; Hu, Z.; Zhang, Y.; Wan, H.; Yin, Z.; Li, L.; Liang, X.; Zhao, X.; Yin, L.; Ye, G.; et al. Myricetin inhibits pseudorabies virus infection through direct inactivation and activating host antiviral defense. Front. Microbiol. 2022, 13, 985108. [Google Scholar] [CrossRef]
- Yuan, X.; Wang, H.; Zhao, Z.; Li, C.; Wang, X.; Liu, Y.; Zhou, Y.; Zhu, Z.; Zhang, Z. Paeonol inhibits the replication of bovine herpesvirus type 1 in vitro through regulating the PI3K/AKT pathway. Curr. Microbiol. 2025, 82, 110. [Google Scholar] [CrossRef]









| Gene | Sequence (3′–5′) | GenBank Accession Number |
|---|---|---|
| q-PRV-gB-F | GTCCGTGAAGCGGTTCGTGAT | OP879616 |
| q-PRV-gB-R | CTCCATCATGAAGTGCGACGT | |
| q-HSV-gB-F | GGACATCAAGGCGGAGAACA | MH999849 |
| q-HSV-gB-R | TTCTCCTTGAAGACCACCGC | |
| q-GAPDH-F | ACCACAGTCCATGCCATCAC | OZ289217 |
| q-GAPDH-R | TCCACCACCCTGTTGCTGTA | |
| EMILIN2-qPCR-F | CGCCAGGAACAAGAACTGGTG | NC_010448 |
| EMILIN2-qPCR-R | GCACAGTTGTACTGAGCCTGA | |
| ND2-qPCR-F | AATCCACAGCTCAGCAACCA | MK688993 |
| ND2-qPCR-R | TTAGGCTTGTGATGACGGGT | |
| ND3-qPCR-F | AACCCTAGCCTCCCTACTCG | MK688993 |
| ND3-qPCR-R | GAGGCGTGCTGATCCTATGG | |
| SLC37A2-qPCR-F | TGTGGTCAAGAGTCGTCTGC | XM_021063086 |
| SLC37A2-qPCR-R | ATGCCGATAGCATAGGCCAC | |
| COX3-qPCR-F | ACCACTTACCGGAGCCCTAT | MK688993 |
| COX3-qPCR-R | ATGTGTGGTGGCCTTGGAAA | |
| COL17A1-qPCR-F | TCCTTACCACCAAAAGGGGG | XM_071611703 |
| COL17A1-qPCR-R | AACTGGAGGTGGAGGCATTG | |
| CLDN4-qPCR-F | TGGATGATGAGAGCGCCAAG | NM_001161637 |
| CLDN4-qPCR-R | GGGATTGTAGAAGTCGCGGA | |
| CAPG-qPCR-F | GACTCAGAGCTGCTAGCCTT | AK238228 |
| GAPG-qPCR-R | TGCTGTTTCCAGATCTCCTCC | |
| EMP1-qPCR-F EMP1-qPCR-R | CATGCTGTTCGTTTGCACCA ACTTGAGGGCATCTTCACCG | AK391109 |
| CACNB2-qPCR-F | GTCACCTGATGAGGAGTCTGC | XM_021064820 |
| CACNB2-qPCR-R | AGTGTCAGACGAAGTGCTCC | |
| ATP2B4-qPCR-F | CGAGATTGACCACGCAGAGA | XM_021063199 |
| ATP2B4-qPCR-R | GCTCCCGTCTGGAATGTGTT | |
| SA100A6-qPCR-F | ATGCCCTCTGGATCAGGCTA | AY610306 |
| SA100A6-qPCR-R | GCCCCAATGGTGAGTTCCTT | |
| S100A10-qPCR-F | AAAAGACCCTCTGGCTGTGG | AC277996 |
| S100A10-qPCR-R | GCCCAGCGATTAGCGAAAAG |
| Compound | Cell Lines | CC50 (μM) | IC50 (μM) | SI |
|---|---|---|---|---|
| DTZ | Vero | 341.77 ± 10.80 | 25.53 ± 2.59 | 13.38 |
| PK15 | 478.26 ± 12.27 | 39.28 ± 1.33 | 12.17 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zuo, M.; Xiang, D.; Zhang, Z.-X.; Yang, X.; Duan, Y.; Li, J.; Zeng, B.; Dong, L.; Wu, G.; Zhou, Y.; et al. Antiviral Activity of Diltiazem HCl Against Pseudorabies Virus Infection In Vitro. Vet. Sci. 2025, 12, 864. https://doi.org/10.3390/vetsci12090864
Zuo M, Xiang D, Zhang Z-X, Yang X, Duan Y, Li J, Zeng B, Dong L, Wu G, Zhou Y, et al. Antiviral Activity of Diltiazem HCl Against Pseudorabies Virus Infection In Vitro. Veterinary Sciences. 2025; 12(9):864. https://doi.org/10.3390/vetsci12090864
Chicago/Turabian StyleZuo, Mengting, Decai Xiang, Zhen-Xing Zhang, Xi Yang, Yuqing Duan, Juan Li, Bangquan Zeng, Lu Dong, Guoquan Wu, Yi Zhou, and et al. 2025. "Antiviral Activity of Diltiazem HCl Against Pseudorabies Virus Infection In Vitro" Veterinary Sciences 12, no. 9: 864. https://doi.org/10.3390/vetsci12090864
APA StyleZuo, M., Xiang, D., Zhang, Z.-X., Yang, X., Duan, Y., Li, J., Zeng, B., Dong, L., Wu, G., Zhou, Y., Tan, L., & Duan, B. (2025). Antiviral Activity of Diltiazem HCl Against Pseudorabies Virus Infection In Vitro. Veterinary Sciences, 12(9), 864. https://doi.org/10.3390/vetsci12090864

