Xenotransplantation of Cryopreserved Calf Testicular Tissues
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bovine Testes and Chemicals
2.2. Experimental Design, Recipient Castration, and Tissue Xenografting
2.3. Hematoxylin and Eosin (HE) Staining
2.4. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.5. Statistical Analysis
3. Results
3.1. Surgery and Angiogenesis in the Xenografts
3.2. Histological Examination of the Xenografts
3.3. Gene Expressions in the Xenografts
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Honaramooz, A.; Snedaker, A.; Boiani, M.; Schöler, H.; Dobrinski, I.; Schlatt, S. Sperm from neonatal mammalian testes grafted in mice. Nature 2002, 418, 778–781. [Google Scholar] [CrossRef] [PubMed]
- Kilcoyne, K.R.; Mitchell, R.T. Fertility Preservation: Testicular transplantation for fertility preservation: Clinical potential and current challenges. Reproduction 2019, 158, F1–F14. [Google Scholar] [CrossRef] [PubMed]
- Pelzman, D.L.; Orwig, K.E.; Hwang, K. Progress in translational reproductive science: Testicular tissue transplantation and in vitro spermatogenesis. Fertil. Steril. 2020, 113, 500–509. [Google Scholar] [CrossRef] [PubMed]
- Nikmahzar, A.; Khadivi, F.; Abbasi, M.; Mahdavinezhad, F.; Abbasi, Y.; Daneshi, E. Testicular tissue vitrification: A promising strategy for male fertility preservation. Reprod. Sci. 2023, 30, 1687–1700. [Google Scholar] [CrossRef]
- Vermeulen, M.; Poels, J.; de Michele, F.; des Rieux, A.; Wyns, C. Restoring fertility with cryopreserved prepubertal testicular tissue: Perspectives with hydrogel encapsulation, nanotechnology, and bioengineered scaffold. Ann. Biomed. Eng. 2017, 45, 1770–1781. [Google Scholar] [CrossRef]
- Shinohara, T.; Inoue, K.; Ogonuki, N.; Kanatsu-Shinohara, M.; Miki, H.; Nakata, K.; Kurome, M.; Nagashima, H.; Toyokuni, S.; Kogishi, K.; et al. Birth of offspring following transplantation of cryopreserved immature testicular pieces and in vitro microinsemination. Hum. Reprod. 2002, 17, 3039–3045. [Google Scholar] [CrossRef]
- Abrishami, M.; Anzar, M.; Yang, Y.; Honaramooz, A. Cryopreservation of immature porcine testis tissue to maintain its developmental potential after xenografting into recipient mice. Theriogenology 2010, 73, 86–96. [Google Scholar] [CrossRef]
- Kaneko, H.; Kikuchi, K.; Nakai, M.; Somfai, T.; Noguchi, J.; Tanihara, F.; Ito, J.; Kashiwazaki, N. Generation of live piglets for the first time using sperm retrieved from immature testicular tissue cryopreserved and grafted into nude mice. PLoS ONE 2013, 8, e70989. [Google Scholar] [CrossRef]
- Kaneko, H.; Kikuchi, K.; Men, N.T.; Dang-Nguyen, T.Q.; Oyadomari, M.; Touma, S.; Suzuki, N.; Katagiri, Y. Embryo production by intracytoplasmic injection of sperm retrieved from neonatal testicular tissue of Agu pigs after cryopreservation and grafting into nude mice. Anim. Sci. J. 2020, 91, e13479. [Google Scholar] [CrossRef]
- Kaneko, H.; Kikuchi, K.; Men, N.T.; Noguchi, J. Embryo production by intracytoplasmic injection of sperm retrieved from Meishan neonatal testicular tissue cryopreserved and grafted into nude mice. Anim. Sci. J. 2019, 90, 158–166. [Google Scholar] [CrossRef]
- Liu, Z.; Nie, Y.H.; Zhang, C.C.; Cai, Y.J.; Wang, Y.; Lu, H.P.; Li, Y.Z.; Cheng, C.; Qiu, Z.L.; Sun, Q. Generation of macaques with sperm derived from juvenile monkey testicular xenografts. Cell Res. 2016, 26, 139–142. [Google Scholar] [CrossRef] [PubMed]
- Ntemou, E.; Kadam, P.; Van Saen, D.; Wistuba, J.; Mitchell, R.T.; Schlatt, S.; Goossens, E. Complete spermatogenesis in intratesticular testis tissue xenotransplants from immature non-human primate. Hum. Reprod. 2019, 34, 403–413. [Google Scholar] [CrossRef] [PubMed]
- Arregui, L.; Rathi, R.; Megee, S.O.; Honaramooz, A.; Gomendio, M.; Roldan, E.R.; Dobrinski, I. Xenografting of sheep testis tissue and isolated cells as a model for preservation of genetic material from endangered ungulates. Reproduction 2008, 136, 85–93. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Sosa, J.R.; Foster, R.A.; Hahnel, A. Development of strips of ovine testes after xenografting under the skin of mice and co-transplantation of exogenous spermatogonia with grafts. Reproduction 2010, 139, 227–235. [Google Scholar] [CrossRef]
- Reddy, N.; Mahla, R.S.; Thathi, R.; Suman, S.K.; Jose, J.; Goel, S. Gonadal status of male recipient mice influences germ cell development in immature buffalo testis tissue xenograft. Reproduction 2012, 143, 59–69. [Google Scholar] [CrossRef]
- Oatley, J.M.; de Avila, D.M.; Reeves, J.J.; McLean, D.J. Spermatogenesis and germ cell transgene expression in xenografted bovine testicular tissue. Biol. Reprod. 2004, 71, 494–501. [Google Scholar] [CrossRef]
- Oatley, J.M.; Reeves, J.J.; McLean, D.J. Establishment of spermatogenesis in neonatal bovine testicular tissue following ectopic xenografting varies with donor age. Biol. Reprod. 2005, 72, 358–364. [Google Scholar] [CrossRef]
- Schmidt, J.A.; de Avila, J.M.; McLean, D.J. Grafting period and donor age affect the potential for spermatogenesis in bovine ectopic testis xenografts. Biol. Reprod. 2006, 75, 160–166. [Google Scholar] [CrossRef]
- Schmidt, J.A.; de Avila, J.M.; McLean, D.J. Effect of vascular endothelial growth factor and testis tissue culture on spermatogenesis in bovine ectopic testis tissue xenografts. Biol. Reprod. 2006, 75, 167–175. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhu, W.Q.; Zhu, X.C.; Cai, N.N.; Yang, R.; Cai, H.; Zhang, X.M. Cryopreservation of calf testicular tissues with knockout serum replacement. Cryobiology 2020, 92, 255–257. [Google Scholar] [CrossRef]
- Zhu, W.Q.; Cai, N.N.; Jiang, Y.; Yang, R.; Shi, J.Z.; Zhu, C.L.; Zhang, B.Y.; Tang, B.; Zhang, X.M. Survivable potential of germ cells after trehalose cryopreservation of bovine testicular tissues. Cryobiology 2021, 101, 105–114. [Google Scholar] [CrossRef] [PubMed]
- Abbasi, S.; Honaramooz, A. Xenografting of testis tissue from bison calf donors into recipient mice as a strategy for salvaging genetic material. Theriogenology 2011, 76, 607–614. [Google Scholar] [CrossRef] [PubMed]
- Fayomi, A.P.; Peters, K.; Sukhwani, M.; Valli-Pulaski, H.; Shetty, G.; Meistrich, M.L.; Houser, L.; Robertson, N.; Roberts, V.; Ramsey, C.; et al. Autologous grafting of cryopreserved prepubertal rhesus testis produces sperm and offspring. Science 2019, 363, 1314–1319. [Google Scholar] [CrossRef] [PubMed]
- Poels, J.; Abou-Ghannam, G.; Decamps, A.; Leyman, M.; des Rieux, A.; Wyns, C. Transplantation of testicular tissue in alginate hydrogel loaded with VEGF nanoparticles improves spermatogonial recovery. J. Control. Release 2016, 234, 79–89. [Google Scholar] [CrossRef]
- Li, H.; Bian, Y.L.; Schreurs, N.; Zhang, X.G.; Raza, S.H.A.; Fang, Q.; Wang, L.Q.; Hu, J.H. Effects of five cryoprotectants on proliferation and differentiation-related gene expression of frozen-thawed bovine calf testicular tissue. Reprod. Domest. Anim. 2018, 53, 1211–1218. [Google Scholar] [CrossRef]
- Anvari, A.; Movahedin, M.; Hamzeh, M. Optimizing immature testicular tissue and cell transplantation results: Comparing transplantation sites and scaffolds. Int. J. Fertil. Steril. 2024, 18, 12–19. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GAPDH | CGGCACAGTCAAGGCAGAGAAC | CGGCACAGTCAAGGCAGAGAAC |
GFRα-1 | TGGCCCTGCTTGTTTTCCTCT | ACAGGTATGCACGCTTGTGT |
C-Kit | TGTCTGCACTGCTCAGCGAATC | TTGATGGCTGCCCGCACTTTC |
Sycp3 | CCGGGAAGTTGGCAAAACCA | GGCATCCTCCTCTGAACCACT |
Sox9 | AGGAGAGCGAGGAGGACAAGTTC | ACCAGCGTCCAGTCGTAGCC |
Acta2 | GATGGTGGGAATGGGACAGAAAGAC | GGTGATGATGCCGTGCTCTATCG |
Star | AAGACCCTCTCTACAGCGACCAAG | GGATCACTTTACTCAGCACCTCGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Y.; Zhu, W.; Yang, R.; Zhang, B.; Tang, B.; Zhang, X. Xenotransplantation of Cryopreserved Calf Testicular Tissues. Vet. Sci. 2025, 12, 247. https://doi.org/10.3390/vetsci12030247
Zhao Y, Zhu W, Yang R, Zhang B, Tang B, Zhang X. Xenotransplantation of Cryopreserved Calf Testicular Tissues. Veterinary Sciences. 2025; 12(3):247. https://doi.org/10.3390/vetsci12030247
Chicago/Turabian StyleZhao, Yansen, Wenqian Zhu, Rui Yang, Boyang Zhang, Bo Tang, and Xueming Zhang. 2025. "Xenotransplantation of Cryopreserved Calf Testicular Tissues" Veterinary Sciences 12, no. 3: 247. https://doi.org/10.3390/vetsci12030247
APA StyleZhao, Y., Zhu, W., Yang, R., Zhang, B., Tang, B., & Zhang, X. (2025). Xenotransplantation of Cryopreserved Calf Testicular Tissues. Veterinary Sciences, 12(3), 247. https://doi.org/10.3390/vetsci12030247