Development of Real-Time and Lateral Flow Dipstick Recombinase Polymerase Amplification Assays for the Rapid Field Diagnosis of MGF-505R Gene-Deleted Mutants of African Swine Fever Virus
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Virus Strains, Reference DNA, and Clinical Samples
2.3. Design of Primers and Probes
2.4. Screening the Primer Recombinations for ASFV Real-Time RPA and RPA-LFD Assays
2.5. Reaction Systems and Reaction Conditions for ASFV Real-Time RPA and RPA-LFD Assays
2.6. Sensitivity and Specificity of ASFV Real-Time RPA and RPA-LFD Assays
2.7. ASFV Real-Time RPA and RPA-LFD Assays on Clinical Samples
3. Results
3.1. Primers Design and Screening
3.2. Sensitivity and Specificity of Real-Time RPA and RPA-LFD Assays
3.3. Repetitiveness Test for Real-Time RPA
3.4. Performance of Real-Time RPA and RPA-LFD Assay on Clinical Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| ASF | African swine fever |
| ASFV | African swine fever virus |
| LFD | Lateral flow dipstick |
| RPA | Recombinase polymerase amplification |
| WOAH | World Organisation for Animal Health |
| CPA | Cross-priming amplification |
| LAMP | Loop-Mediated Isothermal Amplification |
| LMTIA | Ladder-shape melting temperature isothermal amplification |
| LOD | Limits of detection |
References
- Montgomery, R.E. On A Form of Swine Fever Occurring in British East Africa (Kenya Colony). J. Comp. Pathol. Ther. 1921, 34, 159–191. [Google Scholar] [CrossRef]
- Michaud, V.; Randriamparany, T.; Albina, E. Comprehensive phylogenetic reconstructions of African swine fever virus: Proposal for a new classification and molecular dating of the virus. PLoS ONE 2013, 8, e69662. [Google Scholar] [CrossRef] [PubMed]
- Mur, L.; Atzeni, M.; Martínez-López, B.; Feliziani, F.; Rolesu, S.; Sanchez-Vizcaino, J.M. Thirty-Five-Year Presence of African Swine Fever in Sardinia: History, Evolution and Risk Factors for Disease Maintenance. Transbound. Emerg. Dis. 2014, 63, e165–e177. [Google Scholar] [CrossRef]
- Rowlands, R.J.; Michaud, V.; Heath, L.; Hutchings, G.; Oura, C.; Vosloo, W.; Dwarka, R.; Onashvili, T.; Albina, E.; Dixon, L.K. African swine fever virus isolate, Georgia, 2007. Emerg. Infect. Dis. 2008, 14, 1870–1874. [Google Scholar] [CrossRef]
- Revilla, Y.; Pérez-Núñez, D.; Richt, J.A. African Swine Fever Virus Biology and Vaccine Approaches. Adv. Virus Res. 2018, 100, 41–74. [Google Scholar] [CrossRef]
- Zhou, X.; Li, N.; Luo, Y.; Liu, Y.; Miao, F.; Chen, T.; Zhang, S.; Cao, P.; Li, X.; Tian, K.; et al. Emergence of African Swine Fever in China, 2018. Transbound. Emerg. Dis. 2018, 65, 1482–1484. [Google Scholar] [CrossRef]
- Sun, E.; Huang, L.; Zhang, X.; Zhang, J.; Shen, D.; Zhang, Z.; Wang, Z.; Huo, H.; Wang, W.; Huangfu, H.; et al. Genotype I African swine fever viruses emerged in domestic pigs in China and caused chronic infection. Emerg. Microbes Infect. 2021, 10, 2183–2193. [Google Scholar] [CrossRef]
- Zhao, D.; Sun, E.; Huang, L.; Ding, L.; Zhu, Y.; Zhang, J.; Shen, D.; Zhang, X.; Zhang, Z.; Ren, T.; et al. Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs. Nat. Commun. 2023, 14, 3096. [Google Scholar] [CrossRef]
- Agüero, M.; Fernández, J.; Romero, L.; Sánchez Mascaraque, C.; Arias, M.; Sánchez-Vizcaíno, J.M. Highly sensitive PCR assay for routine diagnosis of African swine fever virus in clinical samples. J. Clin. Microbiol. 2003, 41, 4431–4434. [Google Scholar] [CrossRef]
- King, D.P.; Reid, S.M.; Hutchings, G.H.; Grierson, S.S.; Wilkinson, P.J.; Dixon, L.K.; Bastos, A.D.; Drew, T.W. Development of a TaqMan PCR assay with internal amplification control for the detection of African swine fever virus. J. Virol. Methods 2003, 107, 53–61. [Google Scholar] [CrossRef]
- Zsak, L.; Borca, M.V.; Risatti, G.R.; Zsak, A.; French, R.A.; Lu, Z.; Kutish, G.F.; Neilan, J.G.; Callahan, J.D.; Nelson, W.M.; et al. Preclinical diagnosis of African swine fever in contact-exposed swine by a real-time PCR assay. J. Clin. Microbiol. 2005, 43, 112–119. [Google Scholar] [CrossRef] [PubMed]
- Piepenburg, O.; Haber, J.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA Detection Using Recombination Proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Liu, L.B.; Chen, J.; Fu, Q.; Chen, Z.M.; Wang, J.F.; Sun, X.X.; Ai, L.F.; Xu, X.D.; Wang, J.C. Rapid authentication of characteristic milk powders by recombinase polymerase amplification assays. Food Chem. 2024, 443, 138540. [Google Scholar] [CrossRef] [PubMed]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef]
- Cai, L.L.; Tian, Q.; Meng, Q.Q.; Bao, X.Y.; Xu, P.D.; Liu, J.; Zhao, W.J.; Wang, H. Recombinase Polymerase Amplification Assay for Rapid Field Diagnosis of Stewart’s Wilt of Corn Pathogen Pantoea stewartii subsp. stewartii. Agriculture 2023, 13, 1982. [Google Scholar] [CrossRef]
- Lilley, E.; Isbrucker, R.; Holmes, A. Integrating 3Rs approaches in WHO guidelines for the batch release testing of biologicals: Reports from a series of NC3Rs stakeholder workshops. Biologicals 2025, 89, 101777. [Google Scholar] [CrossRef]
- Wang, N.; Zhao, D.; Wang, J.; Zhang, Y.; Wang, M.; Gao, Y.; Li, F.; Wang, J.; Bu, Z.; Rao, Z.; et al. Architecture of African swine fever virus and implications for viral assembly. Science 2019, 366, 640–644. [Google Scholar] [CrossRef]
- Liu, Q.; Ma, B.; Qian, N.; Zhang, F.; Tan, X.; Lei, J.; Xiang, Y. Structure of the African swine fever virus major capsid protein p72. Cell Res. 2019, 29, 953–955. [Google Scholar] [CrossRef]
- Bastos, A.D.; Penrith, M.L.; Cruciere, C.; Edrich, J.L.; Hutchings, G.; Roger, F.; Couacy-Hymann, E.; Thomson, G.R. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch. Virol. 2003, 148, 693–706. [Google Scholar] [CrossRef]
- Wang, G.; Xie, M.; Wu, W.; Chen, Z. Structures and Functional Diversities of ASFV Proteins. Viruses 2021, 13, 2124. [Google Scholar] [CrossRef]
- Gomez-Puertas, P.; Rodriguez, F.; Oviedo, J.M.; Ramiro-Ibanez, F.; Ruiz-Gonzalvo, F.; Alonso, C.; Escribano, J.M. Neutralizing antibodies to different proteins of African swine fever virus inhibit both virus attachment and internalization. J. Virol. 1996, 70, 5689–5694. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Shi, K.; Liu, H.; Yin, Y.; Zhao, J.; Long, F.; Lu, W.; Si, H. Development of a multiplex qRT-PCR assay for detection of African swine fever virus, classical swine fever virus and porcine reproductive and respiratory syndrome virus. J. Vet. Sci. 2021, 22, e87. [Google Scholar] [CrossRef]
- Liu, H.; Shi, K.; Zhao, J.; Yin, Y.; Chen, Y.; Si, H.; Qu, S.; Long, F.; Lu, W. Development of a one-step multiplex qRT-PCR assay for the detection of African swine fever virus, classical swine fever virus and atypical porcine pestivirus. BMC Vet. Res. 2022, 18, 43. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.; Lu, H.; Wu, Z.; Zhu, S. A duplex fluorescent quantitative PCR assay to distinguish the genotype I and II strains of African swine fever virus in Chinese epidemic strains. Front. Vet. Sci. 2022, 9, 998874. [Google Scholar] [CrossRef] [PubMed]
- Dixon, L.K.; Bristow, C.; Wilkinson, P.J.; Sumption, K.J. Identification of a variable region of the African swine fever virus genome that has undergone separate DNA rearrangements leading to expansion of minisatellite-like sequences. J. Mol. Biol. 1990, 216, 677–688. [Google Scholar] [CrossRef]
- Dixon, L.K.; Chapman, D.A.G.; Netherton, C.L.; Upton, C. African swine fever virus replication and genomics. Virus Res. 2013, 173, 3–14. [Google Scholar] [CrossRef]
- Rodríguez, J.M.; Salas, M.L.; Viñuela, E. Intermediate class of mRNAs in African swine fever virus. J. Virol. 1996, 70, 8584–8589. [Google Scholar] [CrossRef]
- O’Donnell, V.; Holinka, L.G.; Sanford, B.; Krug, P.W.; Carlson, J.; Pacheco, J.M.; Reese, B.; Risatti, G.R.; Gladue, D.P.; Borca, M.V. African swine fever virus Georgia isolate harboring deletions of 9GL and MGF360/505 genes is highly attenuated in swine but does not confer protection against parental virus challenge. Virus Res. 2016, 221, 8–14. [Google Scholar] [CrossRef]
- Burrage, T.G.; Lu, Z.; Neilan, J.G.; Rock, D.L.; Zsak, L. African swine fever virus multigene family 360 genes affect virus replication and generalization of infection in Ornithodoros porcinus ticks. J. Virol. 2004, 78, 2445–2453. [Google Scholar] [CrossRef]
- O’Donnell, V.; Holinka, L.G.; Gladue, D.P.; Sanford, B.; Krug, P.W.; Lu, X.; Arzt, J.; Reese, B.; Carrillo, C.; Risatti, G.R.; et al. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus. J. Virol. 2015, 89, 6048–6056. [Google Scholar] [CrossRef]
- Frączyk, M.; Woźniakowski, G.; Kowalczyk, A.; Niemczuk, K.; Pejsak, Z. Development of cross-priming amplification for direct detection of the African Swine Fever Virus, in pig and wild boar blood and sera samples. Lett. Appl. Microbiol. 2016, 62, 386–391. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, B.; Xu, D.; Zhang, M.; Zhang, X.; Wang, D. Development of a ladder-shape melting temperature isothermal amplification (LMTIA) assay for detection of African swine fever virus (ASFV). J. Vet. Sci. 2022, 23, 4. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Yu, J.; Wang, Y.; Zhang, M.; Li, P.; Liu, M.; Liu, Y. Development of a real-time loop-mediated isothermal amplification (LAMP) assay and visual LAMP assay for detection of African swine fever virus (ASFV). J. Virol. Methods 2020, 276, 113775. [Google Scholar] [CrossRef] [PubMed]
- Ceruti, A.; Kobialka, R.M.; Ssekitoleko, J.; Okuni, J.B.; Blome, S.; Abd El Wahed, A.; Truyen, U. Rapid Extraction and Detection of African Swine Fever Virus DNA Based on Isothermal Recombinase Polymerase Amplification Assay. Viruses 2021, 13, 1731. [Google Scholar] [CrossRef]
- Wang, J.; Wang, J.; Geng, Y.; Yuan, W. A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus. Can. J. Vet. Res. 2017, 81, 308–312. [Google Scholar]
- Fan, X.; Li, L.; Zhao, Y.; Liu, Y.; Liu, C.; Wang, Q.; Dong, Y.; Wang, S.; Chi, T.; Song, F.; et al. Clinical Validation of Two Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of African Swine Fever Virus. Front. Microbiol. 2020, 11, 1696. [Google Scholar] [CrossRef]
- Qi, C.; Zhang, Y.; Wang, Z.; Li, J.; Hu, Y.; Li, L.; Ge, S.; Wang, Q.; Wang, Y.; Wu, X.; et al. Development and application of a TaqMan-based real-time PCR method for the detection of the ASFV MGF505-7R gene. Front. Vet. Sci. 2023, 10, 1093733. [Google Scholar] [CrossRef]
- Trinh, T.B.N.; Truong, T.; Nguyen, V.T.; Vu, X.D.; Dao, L.A.; Nguyen, T.L.; Ambagala, A.; Babiuk, S.; Oh, J.; Song, D.; et al. Development of a novel real-time PCR assay targeting p54 gene for rapid detection of African swine fever virus (ASFV) strains circulating in Vietnam. Vet. Med. Sci. 2021, 7, 2268–2272. [Google Scholar] [CrossRef]
- Zou, T.; Deng, J.; Li, X.; Zhang, S.; Chen, L.; Hao, L.; Zhuang, J.; Wang, H.; Zhang, G.; Ge, S.; et al. Development of a fluorescent probe hydrolysis-insulated isothermal PCR for rapid and sensitive on-site detection of African swine fever virus. Virol. Sin. 2022, 37, 462–464. [Google Scholar] [CrossRef]
- Li, L.; Du, N.; Chen, J.; Zhang, K.; Tong, W.; Zheng, H.; Zhao, R.; Tong, G.; Gao, F. Establishment and Application of a Quantitative PCR Method for E248R Gene of African Swine Fever Virus. Vet. Sci. 2022, 9, 417. [Google Scholar] [CrossRef]
- Wang, Z.H.; Li, P.; Lin, X.; Jia, H.; Jiang, Y.T.; Wang, X.J.; Hou, S.H. Application of portable real-time recombinase-aided amplification (rt-RAA) assay in the clinical diagnosis of ASFV and prospective DIVA diagnosis. Appl. Microbiol. Biotechnol. 2021, 105, 3249–3264. [Google Scholar] [CrossRef] [PubMed]
- Li, J.S.; Hao, Y.Z.; Hou, M.L.; Zhang, X.; Zhang, X.G.; Cao, Y.X.; Li, J.M.; Ma, J.; Zhou, Z.X. Development of a Recombinase-aided Amplification Combined With Lateral Flow Dipstick Assay for the Rapid Detection of the African Swine Fever Virus. Biomed. Environ. Sci. 2022, 35, 133–140. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Yu, D.; Bao, M.; Korensky, G.; Chen, J.; Shin, M.; Kim, J.; Park, M.; Qin, P.; Du, K. High-throughput and all-solution phase African Swine Fever Virus (ASFV) detection using CRISPR-Cas12a and fluorescence based point-of-care system. Biosens. Bioelectron. 2020, 154, 112068. [Google Scholar] [CrossRef] [PubMed]
- Wei, N.; Zheng, B.; Niu, J.; Chen, T.; Ye, J.; Si, Y.; Cao, S. Rapid Detection of Genotype II African Swine Fever Virus Using CRISPR Cas13a-Based Lateral Flow Strip. Viruses 2022, 14, 179. [Google Scholar] [CrossRef]






| Name | Sequence (5′–3′) | Location (MK333180.1) |
|---|---|---|
| MGF505R-RPA-F | CATGTAAAGATCATAATTATGAAGTTATTAA | 28255-28285 |
| MGF505R-RPA-R | ATCTAAATGATGATACTTATCGGGTACGATTC | 28396-28427 |
| MGF505R-RPA-R2 | TATGTAGGAGTTGTAGGCTTGAAAGCATGCG | 28431-28461 |
| MGF505R-RPA-F1 | CACTCATTTACTTATTGAAAAGGCATGTAA | 28232-28261 |
| MGF505R-RPA-R1 | AGGATAAAATCTAAGTATCCTTTGGCTGCCA | 28465-28495 |
| MGF505R-RPA-P | ATGTGCTATTGCCCATAAGGATCTACATCTA/i6FAMdT/A/idSp//iBHQ1dT/GTTTGGGGTATAGA/iSpC3/ | 28334-28382 |
| MGF505R-LFA-F | GAAAACCTACATATCTACAATATGATAGATACC | 28296-28328 |
| MGF505R-LFA-F1 | AGATACCTTTGAATGTGCTATTGCCCATAAGG | 28322-28353 |
| MGF505R-LFA-R | 5′Biotin-CATGCGAATATCTAAATGATGATACTTATCGGG | 28404-28436 |
| MGF505R-LFA-F2 | AATGGATATATGAAAACCTACATATCTAC | 28285-28313 |
| MGF505R-LFA-R2 | 5′Biotin-TCCTTTGGCTGCCACCTTATGTAGGAGTTGT | 28448-28478 |
| MGF505R-LFA-P | 5′FAM-ATGTGCTATTGCCCATAAGGATCTACATCTATA/idSp/TGTTTGGGGTATAGA/iSpC3/ | 28334-28382 |
| B646L-RPA-F | TGAAAGCTTATCTCTGCGTGGTGAGTGGGCTGC | 104033-104065 |
| B646L-RPA-R | AACTAATGTCTGCTCTTAAATGGCCCATTGA | 104168-104198 |
| B646L-RPA-F1 | TATCCTGAAAGCTTATCTCTGCGTGGTGAGTGG | 104028-104060 |
| B646L-RPA-R1 | TGTCTGCTCTTAAATGGCCCATTGAATATATG | 104161-104192 |
| B646L-RPA-F2 | GCGTCTGGAAGAGCTGTATCTCTATCCTGAAAGC | 104006-104039 |
| B646L-RPA-R2 | AGGTGACCCACACCAACAATAACCACCACGATG | 104202-104234 |
| B646L-RPA-P | TGGCGTTAACAACATGTCCGAACTTGTGCCAA/iVICdT/T/idSp//iBHQ1dT/CGGTGTTGATGAGGA/iSpC3 | 104070-104119 |
| B646L-LFA-F | TGAGGATTTTGATCGGAGATGTTCCAGGTAGGT | 104114-104146 |
| B646L-LFA-R | 5′Biotin-AACGCGTTCGCTTTTCGCTGATACGTGTCCAT | 104242-104273 |
| B646L-LFA-F1 | TGTTGATGAGGATTTTGATCGGAGATGTTCCA | 104108-104139 |
| B646L-LFA-R1 | 5′Biotin-ACCTGTTTGTAACCCCTGAAATACACAACCT | 104282-104312 |
| B646L-LFA-F2 | GAACTTGTGCCAATCTCGGTGTTGATGAGGA | 104089-104119 |
| B646L-LFA-R2 | 5′Biotin-TTTACATCAATAACCTGTTTGTAACCCCTGA | 104294-104324 |
| B646L-LFA-P | 5′FAM-AGCAGACATTAGTTTTTCATCGTGGTGGTTATT/idSp/TTGGTGTGGGTCACCT/iSpC3/ | 104185-104234 |
| Serial Number | GenBank ACCESSION Number | Virus Strains | Genotype | Isolation Location/Host |
|---|---|---|---|---|
| 1 | AF449461 | Madrid/62 | I | Spain/domestic pig |
| 2 | AF301543 | Malta/78 | I | Malta/wild boar Sus scrofa |
| 3 | AF301537 | Lisbon/57 | I | Portugal/wild boar Sus scrofa |
| 4 | FJ174367 | Ori93 | I | Italy/domestic pig |
| 5 | AM999764 | Georgia 2007 | II | Georgia/domestic pig |
| 6 | MH713612 | CN-SY18 | II | China/domestic pig |
| 7 | MK189456 | JILIN2018 | II | China/wild boar Sus scrofa |
| 8 | JF260952 | Rostov-08-10 | II | Russia/domestic pig |
| 9 | KJ627217 | Pol14/Sz | II | Poland/European wild boar |
| 10 | AY351517 | MOZ/2002/1 | II | Mozambique/wild boar Sus scrofa |
| 11 | AF504886 | BOT/1/99 | Ⅲ | Botswana/domestic pig |
| 12 | JX294722 | RSA 2011/01 | Ⅲ | South Africa/domestic pig |
| 13 | DQ250124 | RSA/5/95 | IV | South Africa/domestic pig |
| 14 | JX467630 | RSA 99.1 | IV | South Africa/domestic pig |
| 15 | AF301541 | Tengani | V | Malawi/wsarthog |
| 16 | AF270711 | MOZ/94/1 | VI | Mozambique/domestic pig |
| 17 | AF302818 | RSA/1/9 | VII | South Africa/domestic pig |
| 18 | AY274457 | MOZ-62/98 | VⅢ | Mozambique/domestic pig |
| 19 | AF270707 | Malawi/1978 | VⅢ | Malawi/* |
| 20 | HQ645943 | Con09/Ni16 | IX | Congo/domestic pig |
| 21 | AF449475 | UGA/1/1995 | IX | Kenya/domestic pig |
| 22 | AF449463 | BUR 1/1984 | X | Burundi/domestic pigs |
| 23 | AY351522 | KAB/62 | XI | Zambia/tick |
| 24 | AY351543 | MZI/1/92 | XII | Malawi/wild boar |
| 25 | AY351542 | SUM/1411 | XⅢ | Zambia/tick |
| 26 | AY351555 | NYA/12 | XIV | Zambia/tick |
| 27 | AY494552 | TAN/1/01 | XV | Tanzania/domestic pig |
| 28 | AY494551 | TAN/2003/2 | XVI | Tanzania/domestic pig |
| 29 | DQ250119 | ZIM/92/1 | XVII | Zimbabwe/domestic pig |
| 30 | DQ250122 | NAM/1/95 | XVⅢ | Namibia/domestic pig |
| 31 | DQ250127 | RSA/3/96 | XIX | South Africa/domestic pig |
| 32 | DQ250109 | lillie | XX | South Africa/domestic pig |
| 33 | DQ250125 | RSA/1/96 | XXI | South Africa/domestic pig |
| 34 | DQ250117 | SPEC/245 | XXII | South Africa/domestic pig |
| 35 | KT795360 | ETH/3 | XXⅢ | Ethiopia/wild boar Sus scrofa |
| 36 | KY353989 | MOZ/10/2006 | XXIV | Mozambique/soft tick |
| Clinical Sample Type | Real-Time PCR (qPCR) | Real-Time RPA/RPA-LFD Assays | ||
|---|---|---|---|---|
| MGF-505R (Positive/Total Samples) | B646L (Positive/Total Samples) | MGF-505R (Positive/Total Samples) | B646L (Positive/Total Samples) | |
| Pig feces | 1/9 | 1/9 | 1/9 | 1/9 |
| Pig hams | 74/107 | 74/107 | 74/107 | 74/107 |
| Fresh pork | 81/178 | 81/178 | 81/178 | 81/178 |
| Pig blood | 10/105 | 10/105 | 10/105 | 10/105 |
| Cooked pig viscera | 2/7 | 2/7 | 2/7 | 2/7 |
| Pig viscera | 5/8 | 5/8 | 5/8 | 5/8 |
| Cooked pork | 18/39 | 18/39 | 18/39 | 18/39 |
| Total | 191/453 | 191/453 | 191/453 | 191/453 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, J.; Deng, J.; Lin, Y.; Chen, D.; Yuan, X.; Wei, F.; Wang, C.; Xu, X.; Wu, S. Development of Real-Time and Lateral Flow Dipstick Recombinase Polymerase Amplification Assays for the Rapid Field Diagnosis of MGF-505R Gene-Deleted Mutants of African Swine Fever Virus. Vet. Sci. 2025, 12, 193. https://doi.org/10.3390/vetsci12030193
Lv J, Deng J, Lin Y, Chen D, Yuan X, Wei F, Wang C, Xu X, Wu S. Development of Real-Time and Lateral Flow Dipstick Recombinase Polymerase Amplification Assays for the Rapid Field Diagnosis of MGF-505R Gene-Deleted Mutants of African Swine Fever Virus. Veterinary Sciences. 2025; 12(3):193. https://doi.org/10.3390/vetsci12030193
Chicago/Turabian StyleLv, Jizhou, Junhua Deng, Yu Lin, Dongjie Chen, Xiangfen Yuan, Fang Wei, Caixia Wang, Xiaolin Xu, and Shaoqiang Wu. 2025. "Development of Real-Time and Lateral Flow Dipstick Recombinase Polymerase Amplification Assays for the Rapid Field Diagnosis of MGF-505R Gene-Deleted Mutants of African Swine Fever Virus" Veterinary Sciences 12, no. 3: 193. https://doi.org/10.3390/vetsci12030193
APA StyleLv, J., Deng, J., Lin, Y., Chen, D., Yuan, X., Wei, F., Wang, C., Xu, X., & Wu, S. (2025). Development of Real-Time and Lateral Flow Dipstick Recombinase Polymerase Amplification Assays for the Rapid Field Diagnosis of MGF-505R Gene-Deleted Mutants of African Swine Fever Virus. Veterinary Sciences, 12(3), 193. https://doi.org/10.3390/vetsci12030193
