Rapid and Sensitive One-Tube Detection of Getah Virus Using RT-LAMP Combined with Pyrococcus furiosus Argonaute
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Viruses
2.2. RT-LAMP Assay
2.3. PfAgo Cleavage
2.4. One-Tube RT-LAMP-PfAgo Assay Development
2.5. Validation and Field Testing
2.6. Statistical Analysis
3. Results
3.1. Principle of the LAMP-PfAgo Method
3.2. Optimization of LAMP Assay for Detection of GETV
3.3. Optimization of LAMP-PfAgo Reaction
3.4. Sensitivity and Specificity of the LAMP-PfAgo
3.5. Validation and Clinical Sample Detection
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, Y.Y.; Liu, H.; Fu, S.H.; Li, X.L.; Guo, X.F.; Li, M.H.; Feng, Y.; Chen, W.X.; Wang, L.H.; Lei, W.W.; et al. From discovery to spread: The evolution and phylogeny of Getah virus. Infect. Genet. Evol. 2017, 55, 48–55. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Mukhopadhyay, S.; Merits, A.; Bolling, B.; Nasar, F.; Coffey, L.L.; Powers, A.; Weaver, S.C. Ictv Report Consortium. ICTV Virus Taxonomy Profile: Togaviridae. J. Gen. Virol. 2018, 99, 761–762. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Zhai, X.; Li, X.; Wang, Y.; He, W.T.; Jiang, Z.; Veit, M.; Su, S. Attenuation of Getah Virus by a Single Amino Acid Substitution at Residue 253 of the E2 Protein that Might Be Part of a New Heparan Sulfate Binding Site on Alphaviruses. J. Virol. 2022, 96, e0175121. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Wang, H.; Liang, G. Getah Virus (Alphavirus): An Emerging, Spreading Zoonotic Virus. Pathogens 2022, 11, 945. [Google Scholar] [CrossRef] [PubMed]
- Kanamitsu, M.; Taniguchi, K.; Urasawa, S.; Ogata, T.; Wada, Y.; Wada, Y.; Saroso, J.S. Geographic distribution of arbovirus antibodies in indigenous human populations in the Indo-Australian archipelago. Am. J. Trop. Med. Hyg. 1979, 28, 351–363. [Google Scholar] [CrossRef]
- Sanderson, C.J. A serologic survey of Queensland cattle for evidence of arbovirus infections. Am. J. Trop. Med. Hyg. 1969, 18, 433–439. [Google Scholar] [CrossRef] [PubMed]
- Shortridge, K.F.; Mason, D.K.; Watkins, K.L.; Aaskov, J.G. Serological evidence for the transmission of Getah virus in Hong Kong. Vet. Rec. 1994, 134, 527–528. [Google Scholar] [CrossRef]
- Sugiyama, I.; Shimizu, E.; Nogami, S.; Suzuki, K.; Miura, Y.; Sentsui, H. Serological survey of arthropod-borne viruses among wild boars in Japan. J. Vet. Med. Sci. 2009, 71, 1059–1061. [Google Scholar] [CrossRef]
- Li, Y.; Fu, S.; Guo, X.; Li, X.; Li, M.; Wang, L.; Gao, X.; Lei, W.; Cao, L.; Lu, Z.; et al. Serological Survey of Getah Virus in Domestic Animals in Yunnan Province, China. Vector Borne Zoonotic Dis. 2019, 19, 59–61. [Google Scholar] [CrossRef]
- Zhao, J.; Dellicour, S.; Yan, Z.; Veit, M.; Gill, M.S.; He, W.T.; Zhai, X.; Ji, X.; Suchard, M.A.; Lemey, P.; et al. Early Genomic Surveillance and Phylogeographic Analysis of Getah Virus, a Reemerging Arbovirus, in Livestock in China. J. Virol. 2023, 97, e0109122. [Google Scholar] [CrossRef]
- Shi, N.; Zhu, X.; Qiu, X.; Cao, X.; Jiang, Z.; Lu, H.; Jin, N. Origin, genetic diversity, adaptive evolution and transmission dynamics of Getah virus. Transbound. Emerg. Dis. 2022, 69, e1037–e1050. [Google Scholar] [CrossRef] [PubMed]
- Kamada, M.; Wada, R.; Kumanomido, T.; Imagawa, H.; Sugiura, T.; Fukunaga, Y. Effect of viral inoculum size on appearance of clinical signs in equine Getah virus infection. J. Vet. Med. Sci. 1991, 53, 803–806. [Google Scholar] [CrossRef][Green Version]
- Yang, T.; Li, R.; Hu, Y.; Yang, L.; Zhao, D.; Du, L.; Li, J.; Ge, M.; Yu, X. An outbreak of Getah virus infection among pigs in China, 2017. Transbound. Emerg. Dis. 2018, 65, 632–637. [Google Scholar] [CrossRef] [PubMed]
- Shibata, I.; Hatano, Y.; Nishimura, M.; Suzuki, G.; Inaba, Y. Isolation of Getah virus from dead fetuses extracted from a naturally infected sow in Japan. Vet. Microbiol. 1991, 27, 385–391. [Google Scholar] [CrossRef]
- Shi, N.; Liu, H.; Li, L.X.; Hu, B.; Zhang, L.; Zhao, C.F.; Deng, X.Y.; Li, X.T.; Xue, X.H.; Bai, X.; et al. Development of a TaqMan probe-based quantitative reverse transcription PCR assay for detection of Getah virus RNA. Arch. Virol. 2018, 163, 2877–2881. [Google Scholar] [CrossRef] [PubMed]
- Nie, M.; Deng, H.; Zhou, Y.; Sun, X.; Huang, Y.; Zhu, L.; Xu, Z. Development of a reverse transcription recombinase-aided amplification assay for detection of Getah virus. Sci. Rep. 2021, 11, 20060. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Li, L.X.; Bu, Y.P.; Liu, Y.; Sun, X.T.; Shi, N.; Deng, X.Y.; Lu, R.G.; Hu, B.; Jin, N.Y.; et al. Rapid Visual Detection of Getah Virus Using a Loop-Mediated Isothermal Amplification Method. Vector Borne Zoonotic Dis. 2019, 19, 741–746. [Google Scholar] [CrossRef]
- Sun, Q.; Xie, Y.; Guan, Z.; Zhang, Y.; Li, Y.; Yang, Y.; Zhang, J.; Li, Z.; Qiu, Y.; Li, B.; et al. Seroprevalence of Getah virus in Pigs in Eastern China Determined with a Recombinant E2 Protein-Based Indirect ELISA. Viruses 2022, 14, 2173. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zhang, X.; Li, L.X.; Shi, N.; Sun, X.T.; Liu, Q.; Jin, N.Y.; Si, X.K. First isolation and characterization of Getah virus from cattle in northeastern China. BMC Vet. Res. 2019, 15, 320. [Google Scholar] [CrossRef]
- Qiu, X.; Cao, X.; Shi, N.; Zhang, H.; Zhu, X.; Gao, Y.; Mai, Z.; Jin, N.; Lu, H. Development and application of an indirect ELISA for detecting equine IgG antibodies against Getah virus with recombinant E2 domain protein. Front. Microbiol. 2022, 13, 1029444. [Google Scholar] [CrossRef]
- Liu, H.; Hu, J.; Li, L.X.; Lu, Z.S.; Sun, X.T.; Lu, H.J.; Jin, N.Y.; Zhang, L.; Zhang, L.N. Seroepidemiological investigation of Getah virus in the China-Myanmar border area from 2022–2023. Front. Microbiol. 2023, 14, 1309650. [Google Scholar] [CrossRef]
- Cao, X.; Qiu, X.; Shi, N.; Ha, Z.; Zhang, H.; Xie, Y.; Wang, P.; Zhu, X.; Zhao, W.; Zhao, G.; et al. Establishment of a reverse transcription real-time quantitative PCR method for Getah virus detection and its application for epidemiological investigation in Shandong, China. Front. Microbiol. 2022, 13, 1009610. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Chen, H.; Hu, A.; Cui, X.; Shi, C.; Lu, Z.; Meng, F.; Lv, F.; Zhao, H.; Bie, X. Establishment of LAMP-CRISPR/Cas12a for rapid detection of Escherichia coli O157:H7 and one-pot detection. Food Microbiol. 2024, 124, 104622. [Google Scholar] [CrossRef]
- Kropocheva, E.V.; Lisitskaya, L.A.; Agapov, A.A.; Musabirov, A.A.; Kulbachinskiy, A.V.; Esyunina, D.M. Prokaryotic Argonaute Proteins as a Tool for Biotechnology. Mol. Biol. 2022, 56, 854–873. [Google Scholar] [CrossRef] [PubMed]
- Swarts, D.C.; Hegge, J.W.; Hinojo, I.; Shiimori, M.; Ellis, M.A.; Dumrongkulraksa, J.; Terns, R.M.; Terns, M.P.; van der Oost, J. Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease that targets cognate DNA. Nucleic Acids Res. 2015, 43, 5120–5129. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.Y.; Jung, Y.; Lim, D. Argonaute system of Kordia jejudonensis is a heterodimeric nucleic acid-guided nuclease. Biochem. Biophys. Res. Commun. 2020, 525, 755–758. [Google Scholar] [CrossRef] [PubMed]
- He, R.; Wang, L.; Wang, F.; Li, W.; Liu, Y.; Li, A.; Wang, Y.; Mao, W.; Zhai, C.; Ma, L. Pyrococcus furiosus Argonaute-mediated nucleic acid detection. Chem. Commun. 2019, 55, 13219–13222. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.; Zhou, H.; Guo, X.; Liu, D.; Li, Z.; Sun, J.; Huang, J.; Liu, T.; Zhao, P.; Xu, H.; et al. Argonaute-integrated isothermal amplification for rapid, portable, multiplex detection of SARS-CoV-2 and influenza viruses. Biosens. Bioelectron. 2022, 207, 114169. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhou, C.; Guo, B.; Yang, X.; Wang, H. Pyrococcus furiosus Argonaute-mediated porcine epidemic diarrhea virus detection. Appl. Microbiol. Biotechnol. 2024, 108, 137. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, T.; Zhou, C.; Guo, B.; Wang, H. Pyrococcus furiosus Argonaute Based Detection Assays for Porcine Deltacoronavirus. ACS Synth. Biol. 2024, 13, 1323–1331. [Google Scholar] [CrossRef] [PubMed]
- Han, R.; Wang, F.; Chen, W.; Ma, L. A Fast and Sensitive One-Tube SARS-CoV-2 Detection Platform Based on RTX-PCR and Pyrococcus furiosus Argonaute. Biosensors 2024, 14, 245. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Xia, W.; Zhao, W.; Hao, P.; Wang, Z.; Yu, X.; Shentu, X.; Sun, K. RT-RPA-PfAgo System: A Rapid, Sensitive, and Specific Multiplex Detection Method for Rice-Infecting Viruses. Biosensors 2023, 13, 941. [Google Scholar] [CrossRef]
- Zhou, X.; Zhang, T.; Song, D.; Huang, T.; Peng, Q.; Chen, Y.; Li, A.; Zhang, F.; Wu, Q.; Ye, Y.; et al. Comparison and evaluation of conventional RT-PCR, SYBR green I and TaqMan real-time RT-PCR assays for the detection of porcine epidemic diarrhea virus. Mol. Cell Probes. 2017, 33, 36–41. [Google Scholar] [CrossRef]
- Rattanatumhi, K.; Prasertsincharoen, N.; Naimon, N.; Kuwata, R.; Shimoda, H.; Ishijima, K.; Yonemitsu, K.; Minami, S.; Supriyono; Tran, N.T.B.; et al. A serological survey and characterization of Getah virus in domestic pigs in Thailand, 2017–2018. Transbound. Emerg. Dis. 2022, 69, 913–918. [Google Scholar] [CrossRef]
- Lu, G.; Ou, J.; Ji, J.; Ren, Z.; Hu, X.; Wang, C.; Li, S. Emergence of Getah Virus Infection in Horse with Fever in China, 2018. Front. Microbiol. 2019, 10, 1416. [Google Scholar]
- Guth, S.; Hanley, K.A.; Althouse, B.M.; Boots, M. Ecological processes underlying the emergence of novel enzootic cycles: Arboviruses in the neotropics as a case study. PLoS Negl. Trop. Dis. 2020, 14, e0008338. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, L.; Zhang, Z.; Zhang, R.; Xu, J.; Yang, P.; Sun, Y.; Chen, Y.; Xie, C.; Lin, M.; et al. Development and application of a novel recombinase polymerase amplification-Pyrococcus furiosus argonaute system for rapid detection of goose parvovirus. Poult. Sci. 2024, 103, 104141. [Google Scholar] [CrossRef]
- Yu, Z.; Shi, D.; Dong, Y.; Shao, Y.; Chen, Z.; Cheng, F.; Zhang, Y.; Wang, Z.; Tu, J.; Song, X. Pyrococcus furiosus argonaute combined with loop-mediated isothermal amplification for rapid, ultrasensitive, and visual detection of fowl adenovirus serotype 4. Poult. Sci. 2024, 103, 103729. [Google Scholar] [CrossRef] [PubMed]
- Xun, G.; Liu, Q.; Chong, Y.; Guo, X.; Li, Z.; Li, Y.; Fei, H.; Li, K.; Feng, Y. Argonaute with stepwise endonuclease activity promotes specific and multiplex nucleic acid detection. Bioresour. Bioprocess. 2021, 8, 46. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Yang, L.; Zhang, X.; Tang, Y.; Wang, Y.; Shao, X.; Gao, S.; Liu, X.; Wang, P. Rapid and Sensitive Genotyping of SARS-CoV-2 Key Mutation L452R with an RPA-PfAgo Method. Anal. Chem. 2022, 94, 17151–17159. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, Y.; Wu, W.; Kang, T.; Sun, J.; Jiang, H. Rapid and sensitive detection of Mycoplasma synoviae using RPA combined with Pyrococcus furiosus Argonaute. Poult. Sci. 2024, 103, 103244. [Google Scholar] [CrossRef]
Name | Sequence (5′-3′) |
---|---|
GETV-FIP | GGATGGTGACGCCTGTTGGAACAGCATTTTCGCATCTGGCTA |
GETV-BIP | CACCTACCACTGCATCTGCCCAGCTTTCGAGCGTAATTCGC |
GETV-F3 | ACAGCAGGTCACACCGAA |
GETV-B3 | CAGTCCCCGATGCTTTCG |
GETV-LB | GAAAAGTGCGGAAGACCCAGA |
gDNA1 | TGGTCAGACATCAACC |
gDNA2 | TCCTTGCGGGTGCACT |
gDNA3 | GGGTAGTGCACCCGCA |
probe | 6-FAM-TCAACCTCCTTGCGGGT-BHQ1 |
GETV-NSP1-F | ATGGCGGACGTGTGACATCA |
GETV-NSP1-R | CACAGCGTATACGTCCTGGT |
qPCR-F | AGCATTTTCGCATCTGGCTAC |
qPCR-R | TCTGGGTCTTCCGCACTTTT |
Results | RT-qPCR (Positive/Total) | RT-LAMP-PfAgo (Positive/Total) |
---|---|---|
Number of positive samples | 70/86 | 70/86 |
Positive rate | 81.4% | 81.4% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Z.; Yang, F.; Fang, M.; Wu, Q.; Fan, K.; Huang, D.; Ye, Y.; Wan, G.; Song, D. Rapid and Sensitive One-Tube Detection of Getah Virus Using RT-LAMP Combined with Pyrococcus furiosus Argonaute. Vet. Sci. 2025, 12, 93. https://doi.org/10.3390/vetsci12020093
Liu Z, Yang F, Fang M, Wu Q, Fan K, Huang D, Ye Y, Wan G, Song D. Rapid and Sensitive One-Tube Detection of Getah Virus Using RT-LAMP Combined with Pyrococcus furiosus Argonaute. Veterinary Sciences. 2025; 12(2):93. https://doi.org/10.3390/vetsci12020093
Chicago/Turabian StyleLiu, Zhong, Fosheng Yang, Mengtao Fang, Qi Wu, Ke Fan, Dongyan Huang, Yu Ye, Gen Wan, and Deping Song. 2025. "Rapid and Sensitive One-Tube Detection of Getah Virus Using RT-LAMP Combined with Pyrococcus furiosus Argonaute" Veterinary Sciences 12, no. 2: 93. https://doi.org/10.3390/vetsci12020093
APA StyleLiu, Z., Yang, F., Fang, M., Wu, Q., Fan, K., Huang, D., Ye, Y., Wan, G., & Song, D. (2025). Rapid and Sensitive One-Tube Detection of Getah Virus Using RT-LAMP Combined with Pyrococcus furiosus Argonaute. Veterinary Sciences, 12(2), 93. https://doi.org/10.3390/vetsci12020093