Measurement of the Adipose Stem Cells Cell Sheets Transmittance
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Engineering of the ASC Cell Sheets (ASCCS)
2.3. Differentiation of the ASC
2.4. RNA Extraction and cDNA Synthesis
2.5. Real-Time PCR
2.6. Genomic Extraction and Estimation of Cell’s Number per ASCCS
2.7. Hematoxylin and Eosin Staining
2.8. Immunocytochemistry Staining
2.9. Device to Measure the Transmittance of the ASCCS
2.10. Measurement of the ASCCS Transmittance and Their Harvesting
2.11. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
6. Patent
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Katagiri, H.; Muneta, T.; Tsuji, K.; Horie, M.; Koga, H.; Ozeki, N.; Kobayashi, E.; Sekiya, I. Transplantation of aggregates of synovial mesenchymal stem cells regenerates meniscus more effectively in a rat massive meniscal defect. Biochem. Biophys. Res. Commun. 2013, 435, 603–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamdi, H.; Planat-Benard, V.; Bel, A.; Puymirat, E.; Geha, R.; Pidial, L.; Nematalla, H.; Bellamy, V.; Bouaziz, P.; Peyrard, S.; et al. Epicardial adipose stem cell sheets results in greater post-infarction survival than intramyocardial injections. Cardiovasc. Res. 2011, 91, 483–491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Honjo, K.; Yamamoto, T.; Adachi, T.; Amemiya, T.; Mazda, O.; Kanamura, N.; Kita, M. Evaluation of a dental pulp-derived cell sheet cultured on amniotic membrane substrate. Biomed Mater. Eng. 2015, 25, 203–212. [Google Scholar] [CrossRef] [Scilit]
- Takazawa, R.; Yamato, M.; Kageyama, Y.; Okano, T.; Kihara, K. Mesothelial cell sheets cultured on fibrin gel prevent adhesion formation in an intestinal hernia model. Tissue Eng. 2005, 11, 618–625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yazdani, M.; Shahdadfar, A.; Jackson, C.J.; Utheim, T.P. A Hyaluronan hydrogel scaffold for culture of human oral mucosal epithelial cells in limbal stem-cell therapy. Bioengineering 2019, 6, 97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qian, Z.; Ross, D.; Jia, W.; Xing, Q.; Zhao, F. Bioactive polydimethylsiloxane surface for optimal human mesenchymal stem cell sheet culture. Bioact. Mater. 2018, 3, 167–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamato, M.; Utsumi, M.; Kushida, A.; Konno, C.; Kikuchi, A.; Okano, T. Thermo-responsive culture dishes allow the intact harvest of multilayered keratinocyte sheets without dispase by reducing temperature. Tissue Eng. 2001, 7, 473–480. [Google Scholar] [CrossRef] [Scilit]
- Oliva, J.; Florentino, A.; Bardag-Gorce, F.; Niihara, Y. Engineering, differentiation and harvesting of human adipose-derived stem cell multilayer cell sheets. Regen Med. 2019, 14, 151–163. [Google Scholar] [CrossRef] [Scilit]
- Venugopal, B.; Shenoy, S.J.; Mohan, S.; Anil Kumar, P.R.; Kumary, T.V. Bioengineered corneal epithelial cell sheet from mesenchymal stem cells-A functional alternative to limbal stem cells for ocular surface reconstruction. J. Biomed Mater. Res. B Appl. Biomater. 2020, 108, 1033–1045. [Google Scholar] [CrossRef] [Scilit]
- Tatsumi, K.; Okano, T. Hepatocyte transplantation: Cell sheet technology for liver cell transplantation. Curr. Transpl. Rep. 2017, 4, 184–192. [Google Scholar] [CrossRef] [Scilit]
- Miyagawa, S.; Domae, K.; Yoshikawa, Y.; Fukushima, S.; Nakamura, T.; Saito, A.; Sakata, Y.; Hamada, S.; Toda, K.; Pak, K.; et al. Phase I clinical trial of autologous stem cell-sheet transplantation therapy for treating cardiomyopathy. J. Am. Heart Assoc. 2017, 6, e003918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imashiro, C.; Shimizu, T. Fundamental technologies and recent advances of cell-sheet-based tissue engineering. Int. J. Mol. Sci. 2021, 22, 425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sukho, P.; Cohen, A.; Hesselink, J.W.; Kirpensteijn, J.; Verseijden, F.; Bastiaansen-Jenniskens, Y.M. Adipose tissue-derived stem cell sheet application for tissue healing in vivo: A systematic review. Tissue Eng. Part. B Rev. 2018, 24, 37–52. [Google Scholar] [CrossRef] [Scilit]
- McLaughlin, M.M.; Marra, K.G. The use of adipose-derived stem cells as sheets for wound healing. Organogenesis 2013, 9, 79–81. [Google Scholar] [CrossRef] [Scilit]
- Sekine, H.; Shimizu, T.; Sakaguchi, K.; Dobashi, I.; Wada, M.; Yamato, M.; Kobayashi, E.; Umezu, M.; Okano, T. In vitro fabrication of functional three-dimensional tissues with perfusable blood vessels. Nat. Commun. 2013, 4, 1399. [Google Scholar] [CrossRef] [Scilit]
- Ishii, M.; Shibata, R.; Shimizu, Y.; Yamamoto, T.; Kondo, K.; Inoue, Y.; Ouchi, N.; Tanigawa, T.; Kanemura, N.; Ito, A.; et al. Multilayered adipose-derived regenerative cell sheets created by a novel magnetite tissue engineering method for myocardial infarction. Int. J. Cardiol. 2014, 175, 545–553. [Google Scholar] [CrossRef] [Scilit]
- Ito, A.; Hayashida, M.; Honda, H.; Hata, K.; Kagami, H.; Ueda, M.; Kobayashi, T. Construction and harvest of multilayered keratinocyte sheets using magnetite nanoparticles and magnetic force. Tissue Eng. 2004, 10, 873–880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neo, P.Y.; See, E.Y.; Toh, S.L.; Goh, J.C. Temporal profiling of the growth and multi-lineage potentiality of adipose tissue-derived mesenchymal stem cells cell-sheets. J. Tissue Eng. Regen Med. 2016, 10, 564–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagase, K.; Yamato, M.; Kanazawa, H.; Okano, T. Poly(N-isopropylacrylamide)-based thermoresponsive surfaces provide new types of biomedical applications. Biomaterials 2018, 153, 27–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braunstein, R.E.; Jain, S.; McCally, R.L.; Stark, W.J.; Connolly, P.J.; Azar, D.T. Objective measurement of corneal light scattering after excimer laser keratectomy. Ophthalmology 1996, 103, 439–443. [Google Scholar] [CrossRef] [Scilit]
- Fantes, F.E.; Hanna, K.D.; Waring, G.O., 3rd; Pouliquen, Y.; Thompson, K.P.; Savoldelli, M. Wound healing after excimer laser keratomileusis (photorefractive keratectomy) in monkeys. Arch. Ophthalmol. 1990, 108, 665–675. [Google Scholar] [CrossRef] [Scilit]
- Bocheux, R.; Pernot, P.; Borderie, V.; Plamann, K.; Irsch, K. Quantitative measures of corneal transparency, derived from objective analysis of depth-resolved corneal images, demonstrated with full-field optical coherence tomographic microscopy. PLoS ONE 2019, 14, e0221707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parekh, M.; Ferrari, S.; Ruzza, A.; Pugliese, M.; Ponzin, D.; Salvalaio, G. A portable device for measuring donor corneal transparency in eye banks. Cell Tissue Bank. 2014, 15, 7–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ventura, L.; Jesus, G.T.; Oliveira, G.C.; Sousa, S.J. Portable light transmission measuring system for preserved corneas. Biomed. Eng. Online 2005, 4, 70. [Google Scholar] [CrossRef] [Scilit]
- Ventura, L.; Sousa, S.J.; Messias, A.M.; Bispo, J.M. System for measuring the transmission spectrum of ‘in vitro’ corneas. Physiol. Meas. 2000, 21, 197–207. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.; Tu, Y.K.; Tang, Y.B.; Cheng, N.C. Stemness and transdifferentiation of adipose-derived stem cells using L-ascorbic acid 2-phosphate-induced cell sheet formation. Biomaterials 2014, 35, 3516–3526. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.C.; Grahovac, T.; Oh, S.J.; Ieraci, M.; Rubin, J.P.; Marra, K.G. Evaluation of a multi-layer adipose-derived stem cell sheet in a full-thickness wound healing model. Acta Biomater. 2013, 9, 5243–5250. [Google Scholar] [CrossRef] [Scilit]
- Haraguchi, Y.; Shimizu, T.; Mizuuchi, K.; Kawata, H.; Kobayashi, M.; Hirai, Y.; Iwana, S.I. Noninvasive cross-sectional observation of three-dimensional cell sheet-tissue-fabrication by optical coherence tomography. Biochem. Biophys. Rep. 2015, 2, 57–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chopra, R.; Wagner, S.K.; Keane, P.A. Optical coherence tomography in the 2020s-outside the eye clinic. Eye 2021, 35, 236–243. [Google Scholar] [CrossRef] [Scilit]
- Alexandrushkina, N.; Nimiritsky, P.; Eremichev, R.; Popov, V.; Arbatskiy, M.; Danilova, N.; Malkov, P.; Akopyan, Z.; Tkachuk, V.; Makarevich, P. Cell sheets from adipose tissue MSC Induce healing of pressure ulcer and prevent fibrosis via trigger effects on granulation tissue growth and vascularization. Int. J. Mol. Sci. 2020, 21, 5567. [Google Scholar] [CrossRef] [Scilit]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [Scilit]
- Takemitsu, H.; Zhao, D.; Yamamoto, I.; Harada, Y.; Michishita, M.; Arai, T. Comparison of bone marrow and adipose tissue-derived canine mesenchymal stem cells. BMC Vet. Res. 2012, 8, 150. [Google Scholar] [CrossRef] [Scilit]
- Ohishi, I.; Hayashi, K.; Sakaguchi, G.; Tokuchi, M. Toxicities of Clostridium botulinum type C toxins of different molecular sizes in geese. Infect. Immun. 1981, 33, 623–624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matic, I.; Antunovic, M.; Brkic, S.; Josipovic, P.; Mihalic, K.C.; Karlak, I.; Ivkovic, A.; Marijanovic, I. Expression of OCT-4 and SOX-2 in bone marrow-derived human mesenchymal stem cells during osteogenic differentiation. Open Access Maced. J. Med. Sci. 2016, 4, 9–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sato, M.; Kawase-Koga, Y.; Yamakawa, D.; Fujii, Y.; Chikazu, D. Bone regeneration potential of human dental pulp stem cells derived from elderly patients and osteo-induced by a helioxanthin derivative. Int. J. Mol. Sci. 2020, 21, 7731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishigami, M.; Masumoto, H.; Ikuno, T.; Aoki, T.; Kawatou, M.; Minakata, K.; Ikeda, T.; Sakata, R.; Yamashita, J.K.; Minatoya, K. Human iPS cell-derived cardiac tissue sheets for functional restoration of infarcted porcine hearts. PLoS ONE 2018, 13, e0201650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- See, E.Y.; Toh, S.L.; Goh, J.C. Multilineage potential of bone-marrow-derived mesenchymal stem cell cell sheets: Implications for tissue engineering. Tissue Eng. Part A 2010, 16, 1421–1431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishida, K.; Yamato, M.; Hayashida, Y.; Watanabe, K.; Yamamoto, K.; Adachi, E.; Nagai, S.; Kikuchi, A.; Maeda, N.; Watanabe, H.; et al. Corneal reconstruction with tissue-engineered cell sheets composed of autologous oral mucosal epithelium. N. Engl. J. Med. 2004, 351, 1187–1196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morino, T.; Takagi, R.; Yamamoto, K.; Kojima, H.; Yamato, M. Explant culture of oral mucosal epithelial cells for fabricating transplantable epithelial cell sheet. Regen. Ther. 2019, 10, 36–45. [Google Scholar] [CrossRef] [Scilit]
- Du, C.; Yao, C.; Li, N.; Wang, S.; Feng, Y.; Yang, X. Cell sheet-engineered bones used for the reconstruction of mandibular defects in an animal model. Exp. Ther. Med. 2015, 10, 2216–2220. [Google Scholar] [CrossRef] [Scilit]
- Alghuwainem, A.; Alshareeda, A.T.; Alsowayan, B. Scaffold-free 3-D cell sheet technique bridges the gap between 2-D cell culture and animal models. Int. J. Mol. Sci. 2019, 20, 4926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langhans, S.A. Three-dimensional in vitro cell culture models in drug discovery and drug repositioning. Front. Pharm. 2018, 9, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graf, B.W.; Boppart, S.A. Imaging and analysis of three-dimensional cell culture models. Methods Mol. Biol. 2010, 591, 211–227. [Google Scholar]
- Pampaloni, F.; Stelzer, E. Three-dimensional cell cultures in toxicology. Biotechnol. Genet. Eng. Rev. 2010, 26, 117–138. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.; Wang, M.Y.; Tai, H.C.; Cheng, N.C. Cell sheet composed of adipose-derived stem cells demonstrates enhanced skin wound healing with reduced scar formation. Acta Biomater. 2018, 77, 191–200. [Google Scholar] [CrossRef] [Scilit]
- Ren, L.; Ma, D.; Liu, B.; Li, J.; Chen, J.; Yang, D.; Gao, P. Preparation of three-dimensional vascularized MSC cell sheet constructs for tissue regeneration. Biomed. Res. Int. 2014, 2014, 301279. [Google Scholar] [CrossRef] [Scilit]
- Williams, A.; Nowak, J.F.; Dass, R.; Samuel, J.; Mills, K.L. Toward morphologically relevant extracellular matrix in vitro models: 3D fiber reinforced hydrogels. Front. Physiol. 2018, 9, 966. [Google Scholar] [CrossRef] [Scilit]
- Torricelli, A.A.; Wilson, S.E. Cellular and extracellular matrix modulation of corneal stromal opacity. Exp. Eye Res. 2014, 129, 151–160. [Google Scholar] [CrossRef] [Scilit]
- Hassell, J.R.; Birk, D.E. The molecular basis of corneal transparency. Exp. Eye Res. 2010, 91, 326–335. [Google Scholar] [CrossRef] [Scilit]
- Salameh, C.; Salviat, F.; Bessot, E.; Lama, M.; Chassot, J.M.; Moulongui, E.; Wang, Y.; Robin, M.; Bardouil, A.; Selmane, M.; et al. Origin of transparency in scattering biomimetic collagen materials. Proc. Natl. Acad. Sci. USA 2020, 117, 11947–11953. [Google Scholar] [CrossRef] [Scilit]
- Rogers, J.D.; Radosevich, A.J.; Yi, J.; Backman, V. Modeling light scattering in tissue as continuous random media using a versatile refractive index correlation function. IEEE J. Sel. Top. Quantum Electron. 2013, 20, 7000514. [Google Scholar] [CrossRef] [Scilit]
- Bou-Ghannam, S.; Kim, K.; Grainger, D.W.; Okano, T. 3D cell sheet structure augments mesenchymal stem cell cytokine production. Sci. Rep. 2021, 11, 8170. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.; Thorp, H.; Bou-Ghannam, S.; Grainger, D.W.; Okano, T. Stable cell adhesion affects mesenchymal stem cell sheet fabrication: Effects of fetal bovine serum and human platelet lysate. J. Tissue Eng. Regen. Med. 2020, 14, 741–753. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.S.; Lee, M.W.; Yoo, K.H.; Lee, T.H.; Kim, H.J.; Jang, I.K.; Chun, Y.H.; Kim, H.J.; Park, S.J.; Lee, S.H.; et al. Gene expression profiles of human adipose tissue-derived mesenchymal stem cells are modified by cell culture density. PLoS ONE 2014, 9, e83363. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.; Dean, D.; Mikos, A.G.; Fisher, J.P. Effect of initial cell seeding density on early osteogenic signal expression of rat bone marrow stromal cells cultured on cross-linked poly(propylene fumarate) disks. Biomacromolecules 2009, 10, 1810–1817. [Google Scholar] [CrossRef] [Scilit]
- Yamane, S.; Higa, K.; Umezawa, T.; Serikawa, M.; Shimazaki, J.; Abe, S. Engineered three-dimensional rabbit oral epithelial-mesenchymal-muscular hybrid sheets. Int. J. Oral Sci. 2016, 8, 145–154. [Google Scholar] [CrossRef] [Scilit]
- Sugiyama, H.; Yamato, M.; Nishida, K.; Okano, T. Evidence of the survival of ectopically transplanted oral mucosal epithelial stem cells after repeated wounding of cornea. Mol. Ther. 2014, 22, 1544–1555. [Google Scholar] [CrossRef] [Scilit]
- Jia, Z.; Guo, H.; Xie, H.; Bao, X.; Huang, Y.; Yang, G.; Chen, F. Harvesting prevascularized smooth muscle cell sheets from common polystyrene culture dishes. PLoS ONE 2018, 13, e0204677. [Google Scholar] [CrossRef] [Scilit]
- Sekiya, N.; Tobita, K.; Beckman, S.; Okada, M.; Gharaibeh, B.; Sawa, Y.; Kormos, R.L.; Huard, J. Muscle-derived stem cell sheets support pump function and prevent cardiac arrhythmias in a model of chronic myocardial infarction. Mol. Ther. 2013, 21, 662–669. [Google Scholar] [CrossRef] [Scilit]
- Yin, L.; Zhu, Y.; Yang, J.; Ni, Y.; Zhou, Z.; Chen, Y.; Wen, L. Adipose tissue-derived mesenchymal stem cells differentiated into hepatocyte-like cells in vivo and in vitro. Mol. Med. Rep. 2015, 11, 1722–1732. [Google Scholar] [CrossRef] [Scilit]
- Neofytou, E.A.; Chang, E.; Patlola, B.; Joubert, L.M.; Rajadas, J.; Gambhir, S.S.; Cheng, Z.; Robbins, R.C.; Beygui, R.E. Adipose tissue-derived stem cells display a proangiogenic phenotype on 3D scaffolds. J. Biomed Mater. Res. A 2011, 98, 383–393. [Google Scholar] [CrossRef] [Scilit]
- Campanale, J.P.; Sun, T.Y.; Montell, D.J. Development and dynamics of cell polarity at a glance. J. Cell Sci. 2017, 130, 1201–1207. [Google Scholar] [CrossRef] [Scilit]
- Ladoux, B.; Mege, R.M.; Trepat, X. Front-rear polarization by mechanical cues: From single cells to tissues. Trends Cell Biol. 2016, 26, 420–433. [Google Scholar] [CrossRef] [Scilit]
- Yonemura, S. Differential sensitivity of epithelial cells to extracellular matrix in polarity establishment. PLoS ONE 2014, 9, e112922. [Google Scholar] [CrossRef] [Scilit]
- St Johnston, D.; Ahringer, J. Cell polarity in eggs and epithelia: Parallels and diversity. Cell 2010, 141, 757–774. [Google Scholar] [CrossRef] [Scilit]
- Hashimoto, M.; Hamada, H. Translation of anterior-posterior polarity into left-right polarity in the mouse embryo. Curr. Opin. Genet. Dev. 2010, 20, 433–437. [Google Scholar] [CrossRef] [Scilit]
- Fujii, M.; Yamanouchi, K.; Sakai, Y.; Baimakhanov, Z.; Yamaguchi, I.; Soyama, A.; Hidaka, M.; Takatsuki, M.; Kuroki, T.; Eguchi, S. In vivo construction of liver tissue by implantation of a hepatic non-parenchymal/adipose-derived stem cell sheet. J. Tissue Eng. Regen. Med. 2018, 12, e287–e295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayala Garcia, M.A.; Gonzalez Yebra, B.; Lopez Flores, A.L.; Guani Guerra, E. The major histocompatibility complex in transplantation. J. Transpl. 2012, 2012, 842141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasai, Y.; Takeda, N.; Kobayashi, S.; Takagi, R.; Yamato, M. Cellular events and behaviors after grafting of stratified squamous epithelial cell sheet onto a hydrated collagen gel. FEBS Open Bio 2017, 7, 691–704. [Google Scholar] [CrossRef] [Scilit]
- Hayashi, R.; Ishikawa, Y.; Sasamoto, Y.; Katori, R.; Nomura, N.; Ichikawa, T.; Araki, S.; Soma, T.; Kawasaki, S.; Sekiguchi, K.; et al. Co-ordinated ocular development from human iPS cells and recovery of corneal function. Nature 2016, 531, 376–380. [Google Scholar] [CrossRef] [Scilit]
- Sawa, Y.; Miyagawa, S. Present and future perspectives on cell sheet-based myocardial regeneration therapy. Biomed. Res. Int. 2013, 2013, 583912. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene of Interest | Gene ID | Forward Primer | Reverse Primer |
|---|---|---|---|
| 18S | NR_003286.4 | CGGCTACCACATCCAAGGAA | GCTGGAATTACCGCGGCT |
| HLA-A | NM_002116 | AGATACACCTGCCATGTGCAGC | GATCACAGCTCCAAGGAGAACC |
| HLA-DR | NM_002124 | GAGCAAGATGCTGAGTGGAGTC | CTGTTGGCTGAAGTCCAGAGTG |
| CD14 | NM_000610.4 | CAACCTAGAGCCGTTTCTAAAGC | GCGCCTACCAGTAGCTGAG |
| CD29 | NM_033667 | GGATTCTCCAGAAGGTGGTTTCG | TGCCACCAAGTTTCCCATCTCC |
| CD31 | NM_000442 | AAGTGGAGTCCAGCCGCATATC | ATGGAGCAGGACAGGTTCAGTC |
| CD44 | NM_000610.4 | CCAGAAGGAACAGTGGTTTGGC | ACTGTCCTCTGGGCTTGGTGTT |
| CD73 | NM_002526.4 | CTCCTCTCAATCATGCCGCT | CCCAGGTAATTGTGCCATTGT |
| CD90 | NM_001311160.2 | GAAGGTCCTCTACTTATCCGCC | TGATGCCCTCACACTTGACCAG |
| CD105 | NM_001278138.2 | CGGTGGTCAATATCCTGTCGAG | AGGAAGTGTGGGCTGAGGTAGA |
| CD166 | NM_001243280.2 | TGGCAATATCACATGGTACAGGAA | CCAGGGTGGAAGTCATGGTATAGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ochiai, J.; Niihara, Y.; Oliva, J. Measurement of the Adipose Stem Cells Cell Sheets Transmittance. Bioengineering 2021, 8, 93. https://doi.org/10.3390/bioengineering8070093
Ochiai J, Niihara Y, Oliva J. Measurement of the Adipose Stem Cells Cell Sheets Transmittance. Bioengineering. 2021; 8(7):93. https://doi.org/10.3390/bioengineering8070093
Chicago/Turabian StyleOchiai, Jun, Yutaka Niihara, and Joan Oliva. 2021. "Measurement of the Adipose Stem Cells Cell Sheets Transmittance" Bioengineering 8, no. 7: 93. https://doi.org/10.3390/bioengineering8070093
APA StyleOchiai, J., Niihara, Y., & Oliva, J. (2021). Measurement of the Adipose Stem Cells Cell Sheets Transmittance. Bioengineering, 8(7), 93. https://doi.org/10.3390/bioengineering8070093

