Cigarette Smoke Extract Combined with LPS Upregulates PITPβ Expression in Chronic Pulmonary Inflammation and May Be Related to the EGFR/ERK Signaling Pathway
Highlights
- Cigarette smoke extract (CSE) combined with lipopolysaccharide (LPS) significantly upregulates the expression of the transporter PITPβ in both in vivo and in vitro chronic pulmonary inflammation models.
- In the chronic lung inflammation model induced by CSE combined with LPS, the EGFR/ERK signaling pathway regulates the expression changes in PITPβ.
- Inhibition of the EGFR/ERK signaling pathway through regulation of PITPβ reduces inflammatory responses, suggesting that PITPβ may serve as a potential therapeutic target for COPD.
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Preparation of Rat Models
2.3. Histopathology
2.4. Preparation of CSE
2.5. Cell Culture
2.6. CCK8 Cell Viability Assay
2.7. Cell Model
2.8. Western Blot Analysis
2.9. Real-Time Quantitative PCR (RT-qPCR)
2.10. Immunofluorescence
2.11. Statistical Analysis
3. Results
3.1. Pathological Changes in Lung Tissue of COPD Rats Induced by Combined CS and LPS
3.2. Upregulation of Phospholipid Transporter PITPβ Expression in a Rat COPD Model Induced by CS Combined with LPS
3.3. Effects of CSE Combined with LPS on A549 Cell Viability
3.4. Upregulation of PITPβ Expression in A549 Cells Induced by Different Concentrations of CSE Combined with LPS
3.5. Inhibition of the ERK Signaling Pathway Reduces PITPβ Expression In Vitro
3.6. Silencing ERK Downregulates PITPβ Expression In Vitro
3.7. Overexpression of ERK Upregulates PITPβ Expression In Vitro
3.8. Silencing EGFR Downregulates PITPβ Expression and ERK Phosphorylation In Vitro
3.9. Silencing EGFR Downregulates PITPβ Expression via the ERK Signaling Pathway In Vitro
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| COPD | Chronic obstructive pulmonary disease |
| CSE | Cigarette smoke extract |
| CS | Cigarette smoke |
| LPS | Lipopolysaccharide |
| PITPβ | Phosphatidylinositol transfer protein β |
| ERK | Extracellular signal-regulated kinase |
| EGFR | Epidermal growth factor receptor |
| PI | Phosphatidylinositol |
| PC | Phosphatidylcholine |
| PG | Phosphatidylglycerol |
References
- Xu, J.; Zeng, Q.; Li, S.; Su, Q.; Fan, H. Inflammation mechanism and research progress of COPD. Front. Immunol. 2024, 15, 1404615. [Google Scholar] [CrossRef]
- Christenson, S.A.; Smith, B.M.; Bafadhel, M.; Putcha, N. Chronic obstructive pulmonary disease. Lancet 2022, 399, 2227–2242. [Google Scholar] [CrossRef]
- Boers, E.; Barrett, M.; Su, J.G.; Benjafield, A.V.; Sinha, S.; Kaye, L.; Zar, H.J.; Vuong, V.; Tellez, D.; Gondalia, R.; et al. Global Burden of Chronic Obstructive Pulmonary Disease Through 2050. JAMA Netw. Open 2023, 6, e2346598. [Google Scholar] [CrossRef]
- Upadhyay, P.; Wu, C.; Pham, A.; Zeki, A.A.; Royer, C.M.; Kodavanti, U.P.; Takeuchi, M.; Bayram, H.; Pinkerton, K.E. Animal models and mechanisms of tobacco smoke-induced chronic obstructive pulmonary disease (COPD). J. Toxicol. Env. Health B Crit. Rev. 2023, 26, 275–305. [Google Scholar] [CrossRef]
- Chen, S.; Kuhn, M.; Prettner, K.; Yu, F.; Yang, T.; Bärnighausen, T.; Bloom, D.E.; Wang, C. The global economic burden of chronic obstructive pulmonary disease for 204 countries and territories in 2020–50: A health-augmented macroeconomic modelling study. Lancet Glob. Health 2023, 11, e1183–e1193. [Google Scholar] [CrossRef]
- Barnes, P.J. Inflammatory mechanisms in patients with chronic obstructive pulmonary disease. J. Allergy. Clin. Immunol. 2016, 138, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Griese, M. Pulmonary surfactant in health and human lung diseases: State of the art. Eur. Respir. J. 1999, 13, 1455–1476. [Google Scholar] [CrossRef] [PubMed]
- Agudelo, C.W.; Kumley, B.K.; Area-Gomez, E.; Xu, Y.; Dabo, A.J.; Geraghty, P.; Campos, M.; Foronjy, R.; Garcia-Arcos, I. Decreased surfactant lipids correlate with lung function in chronic obstructive pulmonary disease (COPD). PLoS ONE 2020, 15, e0228279. [Google Scholar] [CrossRef]
- Numata, M.; Voelker, D.R. Anti-inflammatory and anti-viral actions of anionic pulmonary surfactant phospholipids. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2022, 1867, 159139. [Google Scholar] [CrossRef]
- Burgy, O.; Loriod, S.; Beltramo, G.; Bonniaud, P. Extracellular Lipids in the Lung and Their Role in Pulmonary Fibrosis. Cells 2022, 11, 1209. [Google Scholar] [CrossRef] [PubMed]
- Agudelo, C.W.; Samaha, G.; Garcia-Arcos, I. Alveolar lipids in pulmonary disease. A review. Lipids Health Dis. 2020, 19, 122. [Google Scholar] [CrossRef]
- Hsuan, J.; Cockcroft, S. The PITP family of phosphatidylinositol transfer proteins. Genome Biol. 2001, 2, reviews3011.1. [Google Scholar] [CrossRef] [PubMed]
- Cockcroft, S.; Carvou, N. Biochemical and biological functions of class I phosphatidylinositol transfer proteins. Biochim Biophys Acta 2007, 1771, 677–691. [Google Scholar] [CrossRef] [PubMed]
- Ile, K.E.; Schaaf, G.; Bankaitis, V.A. Phosphatidylinositol transfer proteins and cellular nanoreactors for lipid signaling. Nat. Chem. Biol. 2006, 2, 576–583. [Google Scholar] [CrossRef]
- Lipp, N.; Ikhlef, S.; Milanini, J.; Drin, G. Lipid Exchangers: Cellular Functions and Mechanistic Links with Phosphoinositide Metabolism. Front. Cell Dev. Biol. 2020, 8, 663. [Google Scholar] [CrossRef]
- Ashlin, T.G.; Blunsom, N.J.; Cockcroft, S. Courier service for phosphatidylinositol: PITPs deliver on demand. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2021, 1866, 158985. [Google Scholar] [CrossRef]
- Lesko, J.; Triebl, A.; Stacher-Priehse, E.; Fink-Neuböck, N.; Lindenmann, J.; Smolle-Jüttner, F.; Köfeler, H.C.; Hrzenjak, A.; Olschewski, H.; Leithner, K. Phospholipid dynamics in ex vivo lung cancer and normal lung explants. Exp. Mol. Med. 2021, 53, 81–90. [Google Scholar] [CrossRef] [PubMed]
- Yalcin, A.; Clem, B.; Makoni, S.; Clem, A.; Nelson, K.; Thornburg, J.; Siow, D.; Lane, A.N.; Brock, S.E.; Goswami, U.; et al. Selective inhibition of choline kinase simultaneously attenuates MAPK and PI3K/AKT signaling. Oncogene 2010, 29, 139–149. [Google Scholar] [CrossRef] [PubMed]
- Sabbah, D.A.; Hajjo, R.; Sweidan, K. Review on Epidermal Growth Factor Receptor (EGFR) Structure, Signaling Pathways, Interactions, and Recent Updates of EGFR Inhibitors. Curr. Top. Med. Chem. 2020, 20, 815–834. [Google Scholar] [CrossRef]
- Goldkorn, T.; Filosto, S. Lung injury and cancer: Mechanistic insights into ceramide and EGFR signaling under cigarette smoke. Am. J. Respir. Cell Mol. Biol. 2010, 43, 259–268. [Google Scholar] [CrossRef]
- Mercer, B.A.; D’Armiento, J.M. Emerging role of MAP kinase pathways as therapeutic targets in COPD. Int. J. Chronic Obstr. Pulm. Dis. 2006, 1, 137–150. [Google Scholar] [CrossRef]
- Pan, Z.; Wang, K.; Wang, X.; Jia, Z.; Yang, Y.; Duan, Y.; Huang, L.; Wu, Z.; Zhang, J.; Ding, X. Cholesterol promotes EGFR-TKIs resistance in NSCLC by inducing EGFR/Src/Erk/SP1 signaling-mediated ERRα re-expression. Mol. Cancer 2022, 21, 77. [Google Scholar] [CrossRef]
- El-Hashim, A.Z.; Khajah, M.A.; Renno, W.M.; Babyson, R.S.; Uddin, M.; Benter, I.F.; Ezeamuzie, C.; Akhtar, S. Src-dependent EGFR transactivation regulates lung inflammation via downstream signaling involving ERK1/2, PI3Kδ/Akt and NFκB induction in a murine asthma model. Sci. Rep. 2017, 7, 9919. [Google Scholar] [CrossRef] [PubMed]
- Agassandian, M.; Miakotina, O.L.; Andrews, M.; Mathur, S.N.; Mallampalli, R.K. Pseudomonas aeruginosa and sPLA2 IB stimulate ABCA1-mediated phospholipid efflux via ERK-activation of PPARalpha-RXR. Biochem. J. 2007, 403, 409–420. [Google Scholar] [CrossRef]
- Gu, W.; Song, L.; Li, X.; Wang, D.; Guo, X.; Xu, W. Mesenchymal stem cells alleviate airway inflammation and emphysema in COPD through down-regulation of cyclooxygenase-2 via p38 and ERK MAPK pathways. Sci. Rep. 2015, 5, 8733. [Google Scholar] [CrossRef]
- Kunzelmann-Marche, C.; Freyssinet, J.; Martínez, M.C. Loss of plasma membrane phospholipid asymmetry requires raft integrity. Role of transient receptor potential channels and ERK pathway. J. Biol. Chem. 2002, 277, 19876–19881. [Google Scholar] [CrossRef]
- Kauffmann-Zeh, A.; Thomas, G.M.; Ball, A.; Prosser, S.; Cunningham, E.; Cockcroft, S.; Hsuan, J.J. Requirement for phosphatidylinositol transfer protein in epidermal growth factor signaling. Science 1995, 268, 1188–1190. [Google Scholar] [CrossRef]
- Larijani, B.; Allen-Baume, V.; Morgan, C.P.; Li, M.; Cockcroft, S. EGF regulation of PITP dynamics is blocked by inhibitors of phospholipase C and of the Ras-MAP kinase pathway. Curr. Biol. 2003, 13, 78–84. [Google Scholar] [CrossRef][Green Version]
- Fang, X.; Wang, Z.; Qi, C.; Zhou, J.; Zhang, S.; Song, J. The changes of MRP2 expression in three kinds of pulmonary inflammation models: The downregulation occurred in cigarette smoke extract (CSE) stimulation group and CSE plus LPS stimulation group, unchanged in LPS stimulation group. Toxicol. Mech. Methods 2021, 31, 413–424. [Google Scholar] [CrossRef] [PubMed]
- Qi, C.; Zhou, J.; Wang, Z.; Fang, X.; Li, D.; Jin, Y.; Song, J. Cigarette smoke extract combined with lipopolysaccharide reduces OCTN1/2 expression in human alveolar epithelial cells in vitro and rat lung in vivo under inflammatory conditions. Int. Immunopharmacol. 2020, 87, 106812. [Google Scholar] [CrossRef] [PubMed]
- Zhai, H.; Pan, T.; Yang, H.; Wang, H.; Wang, Y. Cadmium induces A549 cell migration and invasion by activating ERK. Exp. Ther. Med. 2019, 18, 1793–1799. [Google Scholar] [CrossRef]
- de Oca, M.M.; Perez-Padilla, R.; Celli, B.; Aaron, S.D.; Wehrmeister, F.C.; Amaral, A.F.S.; Mannino, D.; Zheng, J.; Salvi, S.; Obaseki, D.; et al. The global burden of COPD: Epidemiology and effect of prevention strategies. Lancet Resp. Med. 2025, 13, 709–724. [Google Scholar] [CrossRef]
- Lareau, S.C.; Fahy, B.; Meek, P.; Wang, A. Chronic Obstructive Pulmonary Disease (COPD). Am. J. Respir. Crit. Care Med. 2019, 199, P1–P2. [Google Scholar] [CrossRef]
- Hardaker, E.L.; Freeman, M.S.; Dale, N.; Bahra, P.; Raza, F.; Banner, K.H.; Poll, C. Exposing rodents to a combination of tobacco smoke and lipopolysaccharide results in an exaggerated inflammatory response in the lung. Br. J. Pharmacol. 2010, 160, 1985–1996. [Google Scholar] [CrossRef]
- Zhou, Y.; Tan, X.; Kuang, W.; Liu, L.; Wan, L. Erythromycin ameliorates cigarette-smoke-induced emphysema and inflammation in rats. Transl. Res. 2012, 159, 464–472. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Sun, D.; Yuan, L.; Liu, C.; Chen, L.; Xu, G.; Shu, J.; Guan, R.; Xu, J.; Li, Y.; et al. Sodium tanshinone IIA sulfonate protects against acute exacerbation of cigarette smoke-induced chronic obstructive pulmonary disease in mice. Int. Immunopharmacol. 2020, 81, 106261. [Google Scholar] [CrossRef]
- Yang, Y.; Di, T.; Zhang, Z.; Liu, J.; Fu, C.; Wu, Y.; Bian, T. Dynamic evolution of emphysema and airway remodeling in two mouse models of COPD. BMC Pulm. Med. 2021, 21, 134. [Google Scholar] [CrossRef]
- Siriphorn, S.V.; Thorsuwan, S.; Thongam, J.; Ruangklai, S.; Hussarin, P.; Rungruang, T.; Srisuma, S. Alterations in Adiponectin Expression in Models of Cigarette Smoke Extract-Induced Mouse Pulmonary Emphysema and Alveolar Epithelial Cell Injury. COPD J. Chronic Obstr. Pulm. Dis. 2025, 22, 2477235. [Google Scholar] [CrossRef] [PubMed]
- Possebon, L.; de Souza Lima Lebron, I.; Furlan Da Silva, L.; Tagliaferri Paletta, J.; Glad, B.G.; Sant’Ana, M.; Iyomasa-Pilon, M.M.; Ribeiro Souza, H.; de Souza Costa, S.; Pereira Da Silva Rodriguesa, G.; et al. Anti-inflammatory actions of herbal medicines in a model of chronic obstructive pulmonary disease induced by cigarette smoke. Biomed. Pharmacother. 2018, 99, 591–597. [Google Scholar] [CrossRef] [PubMed]
- Hirsch, E.; Gulluni, F.; Martini, M. Phosphoinositides in cell proliferation and metabolism. Adv. Biol. Regul. 2020, 75, 100693. [Google Scholar] [CrossRef]
- Cockcroft, S.; Garner, K. Potential role for phosphatidylinositol transfer protein (PITP) family in lipid transfer during phospholipase C signalling. Adv. Biol. Regul. 2013, 53, 280–291. [Google Scholar] [CrossRef] [PubMed]
- Vieira, N.M.; Spinazzola, J.M.; Alexander, M.S.; Moreira, Y.B.; Kawahara, G.; Gibbs, D.E.; Mead, L.C.; Verjovski-Almeida, S.; Zatz, M.; Kunkel, L.M. Repression of phosphatidylinositol transfer protein α ameliorates the pathology of Duchenne muscular dystrophy. Proc. Natl. Acad. Sci. USA 2017, 114, 6080–6085. [Google Scholar] [CrossRef]
- Alb, J.G.J.; Cortese, J.D.; Phillips, S.E.; Albin, R.L.; Nagy, T.R.; Hamilton, B.A.; Bankaitis, V.A. Mice lacking phosphatidylinositol transfer protein-alpha exhibit spinocerebellar degeneration, intestinal and hepatic steatosis, and hypoglycemia. J. Biol. Chem. 2003, 278, 33501–33518. [Google Scholar] [CrossRef]
- Yang, H.; Zhang, X.; Wang, C.; Zhang, H.; Yi, J.; Wang, K.; Hou, Y.; Ji, P.; Jin, X.; Li, C.; et al. Microcolin H, a novel autophagy inducer, exerts potent antitumour activity by targeting PITPα/β. Signal Transduct. Target. Ther. 2023, 8, 428. [Google Scholar] [CrossRef]
- Luchese, C.; Stangherlin, E.C.; Gay, B.M.; Nogueira, C.W. Antioxidant effect of diphenyl diselenide on oxidative damage induced by smoke in rats: Involvement of glutathione. Ecotoxicol. Environ. Saf. 2009, 72, 248–254. [Google Scholar] [CrossRef]
- Telenga, E.D.; Hoffmann, R.F.; Ruben, T.; Hoonhorst, S.J.M.; Willemse, B.W.M.; van Oosterhout, A.J.M.; Heijink, I.H.; van den Berge, M.; Jorge, L.; Sandra, P.; et al. Untargeted lipidomic analysis in chronic obstructive pulmonary disease. Uncovering sphingolipids. Am. J. Respir. Crit. Care Med. 2014, 190, 155–164. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Qin, P.; Wang, R.; Mi, Y.; Li, Y.; Feng, J.; Shen, W.; Dong, H.; Duo, J.; Ma, L.; et al. Effects of Tibetan medicine Longdan zhike tablet on chronic obstructive pulmonary disease through MAPK pathway. J. Ethnopharmacol. 2024, 328, 118082. [Google Scholar] [CrossRef]
- Liu, D.; Xu, W.; Tang, Y.; Cao, J.; Chen, R.; Wu, D.; Chen, H.; Su, B.; Xu, J. Nebulization of risedronate alleviates airway obstruction and inflammation of chronic obstructive pulmonary diseases via suppressing prenylation-dependent RAS/ERK/NF-κB and RhoA/ROCK1/MLCP signaling. Respir. Res. 2022, 23, 380. [Google Scholar] [CrossRef] [PubMed]
- Inoue, H.; Akimoto, K.; Homma, T.; Tanaka, A.; Sagara, H. Airway Epithelial Dysfunction in Asthma: Relevant to Epidermal Growth Factor Receptors and Airway Epithelial Cells. J. Clin. Med. 2020, 9, 3698. [Google Scholar] [CrossRef]
- Burgess, A.W. Regulation of Signaling from the Epidermal Growth Factor Family. J. Phys. Chem. B 2022, 126, 7475–7485. [Google Scholar] [CrossRef]
- Mhone, T.G.; Chen, M.; Kuo, C.; Shih, T.; Yeh, C.; Wang, T.; Chen, R.; Chang, Y.; Kuo, W.; Huang, C. Daidzein Synergizes with Gefitinib to Induce ROS/JNK/c-Jun Activation and Inhibit EGFR-STAT/AKT/ERK Pathways to enhance Lung Adenocarcinoma cells chemosensitivity. Int. J. Biol. Sci. 2022, 18, 3636–3652. [Google Scholar] [CrossRef] [PubMed]
- Gu, M.; Pang, Z. Luteolin inhibits inflammation and M1 macrophage polarization in the treatment of Pseudomonas aeruginosa-induced acute pneumonia through suppressing EGFR/PI3K/AKT/NF-κB and EGFR/ERK/AP-1 signaling pathways. Phytomedicine 2025, 141, 156663. [Google Scholar] [CrossRef] [PubMed]








| Gene | Species | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|---|
| ACTB | Human | GCTATCCAGGCTGTGCTATC | TGTCACGCACGATTTCC |
| PITPNB | Human | GGGTTCCGGGAAGATGGTG | GCTGCCCAACCTGATACTCC |
| TNF-α | Human | GCCCTGGTATGAGCCCATCT | AGTAGACCTGCCCAGACTCG |
| IL-6 | Human | AGCCCACCGGGAACGAAA | CCGAAGGCGCTTGTGGAG |
| EGFR | Human | CCCACTCATGCTCTACAACCC | TCGCACTTCTTACACTTGCGG |
| MAPK3 | Human | CTACACGCAGTTGCAGTACAT | CAGCAGGATCTGGATCTCCC |
| MAPK1 | Human | TACACCAACCTCTCGTACATCG | CATGTCTGAAGCGCAGTAAGATT |
| Actb | Rat | GAGCGCAAGTACTCTGTGTG | CCTGCTTGCTGATCCACATC |
| Pitbnb | Rat | TCAAGTTCAAGTGGTGGGGG | AACCCTTCTTACGCATTGTTTCT |
| Tnf-α | Rat | TGGGCTCCCTCTCATCAGTTCC | GCTCCTCCGCTTGGTGGTTTG |
| Il-6 | Rat | CCAGTTGCCTTCTTGGGACT | TGCCATTGCACAACTCTTTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Sun, Y.; Li, H.; Zhu, X.; Song, J. Cigarette Smoke Extract Combined with LPS Upregulates PITPβ Expression in Chronic Pulmonary Inflammation and May Be Related to the EGFR/ERK Signaling Pathway. Toxics 2026, 14, 182. https://doi.org/10.3390/toxics14020182
Sun Y, Li H, Zhu X, Song J. Cigarette Smoke Extract Combined with LPS Upregulates PITPβ Expression in Chronic Pulmonary Inflammation and May Be Related to the EGFR/ERK Signaling Pathway. Toxics. 2026; 14(2):182. https://doi.org/10.3390/toxics14020182
Chicago/Turabian StyleSun, Yan, Haojie Li, Xueqing Zhu, and Jue Song. 2026. "Cigarette Smoke Extract Combined with LPS Upregulates PITPβ Expression in Chronic Pulmonary Inflammation and May Be Related to the EGFR/ERK Signaling Pathway" Toxics 14, no. 2: 182. https://doi.org/10.3390/toxics14020182
APA StyleSun, Y., Li, H., Zhu, X., & Song, J. (2026). Cigarette Smoke Extract Combined with LPS Upregulates PITPβ Expression in Chronic Pulmonary Inflammation and May Be Related to the EGFR/ERK Signaling Pathway. Toxics, 14(2), 182. https://doi.org/10.3390/toxics14020182
