Effects of Polystyrene Microplastic Exposure on Liver Cell Damage, Oxidative Stress, and Gene Expression in Juvenile Crucian Carp (Carassius auratus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Instruments and Reagents
2.2. Test Organism
2.3. Experimental Methods
2.3.1. Poisoning Method
2.3.2. Collection of Tissue Samples
2.3.3. Methods of Histopathological Analysis
2.3.4. Determination of Indices Related to Antioxidant Enzyme Activity
2.3.5. Analysis of mRNA Expression of Antioxidant-Related Genes
- (1)
- Total RNA extraction and cDNA synthesis
- (2)
- Fluorescence quantitative PCR
2.4. Data Processing Methods
3. Results
3.1. Histological Analysis of PS-MP Stress on Liver Cell Destruction in Juvenile Crucian Carp
3.2. Changes in Antioxidant Enzyme Activities in Liver Tissues of Juvenile Crucian Carp After 32 d of Exposure to PS-MPs
3.3. Changes in mRNA Expression of Antioxidant-Related Genes in Juvenile Crucian Carp Liver Tissues After 32 d Exposure to PS-MPs
3.4. Principal Component Analysis and Correlation Analysis
3.5. Relationship Between Antioxidant Enzyme Activities and Related Genes in Juvenile Crucian Carp After 32 d of MP Exposure
3.5.1. Interrelationship Between GST Enzymes and Genes and PS-MP Exposure 32 d in Juvenile Crucian Carp Liver Tissue
3.5.2. Response of Antioxidant-Related Genes in Juvenile Crucian Carp Liver Tissue to 32 d Exposure to PS-MPs
4. Discussion
4.1. Effects of 32 d Exposure of PS-MPs on Liver Tissue Cells of Juvenile Crucian Carp
4.2. Effects of 32 d Exposure to PS-MPs on the Hepatic Antioxidant System of Juvenile Crucian Carp
4.3. Interrelationship of Antioxidant Enzymes and Genes in the Liver of Juvenile Crucian Carp to PS-MPs for 32 d
Phenomena Observed in This Paper | Phenomena Observed in References |
---|---|
GST enzyme activity and GSTα genes were elevated in the low-concentration group, while GSTpi genes were reduced in the low-concentration group. | Larimichthys crocea showed a significant increase in GST activity and GSTα gene and a decrease in the expression of some antioxidant-related genes under low external stress [34,35]. |
Antioxidant enzyme activity gradually decreased with increasing microplastic concentration, while CYP1A and GSTα genes first increased and then decreased. | The GST enzyme activity of yellow catfish exposed to external contamination gradually decreased with the increase in contamination concentration, while the expression of CYP1A gene first increased and then decreased [36,37]. |
GST enzyme activity was highest in the low-concentration group, while GSTpi gene and GSTα gene expression was highest in the medium-concentration group. | The activity of antioxidant enzymes decreases after reaching the pollution threshold, and the expression of some antioxidant-related genes increases and then decreases [33]. |
4.4. Effects of 32 d Exposure to PS-MPs on the Expression of Antioxidant Genes in the Liver of Juvenile Crucian Carp
5. Conclusions and Prospects
- (1)
- Microplastics induced significant changes in the expression of Vtg and Chg-related genes and the content of Vtg and Chg may be an important factor affecting cell morphology, which should be investigated in the future;
- (2)
- Owing to the characteristics of microplastics, the surface can easily adsorb the remaining contaminants, and future studies should systematically analyze the effects of microplastics and other contaminants in fish liver tissues in conjunction with microplastics;
- (3)
- Considering the diversity of microplastic species, shapes, and particle sizes in nature, future studies can be combined with the field environment to design experiments to investigate the state of fish liver tissues when they are subjected to microplastic stress in the field environment.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Thompson, R.C.; Olsen, Y.; Mitchell, R.P.; Davis, A.; Rowland, S.J.; John, A.W.G.; McGonigle, D.; Russell, A.E. Lost at Sea: Where Is All the Plastic? Science 2004, 304, 838. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.P.; Jiang, L.; Xu, C.Y.; Li, H.; Liu, J. Distribution characteristics and sources of microplastics in surface seawater of the East China Sea. Mar. Environ. Sci. 2023, 42, 315–325. (In Chinese) [Google Scholar] [CrossRef]
- Fu, D.; Chen, C.M.; Qi, H.; Fan, Z.; Wang, Z.; Peng, L.; Li, B. Occurrences and Distribution of Microplastic Pollution and the Control Measures in China. Mar. Pollut. Bull. 2020, 153, 110963. [Google Scholar] [CrossRef] [PubMed]
- Xue, R.Z.; Liu, Z.M.; Wang, M.; Dai, Y.H.; Zhao, J. Regulation of Marine Organisms on the Transport and Transformation of Microplastics. Earth Environ. 2022, 50, 291–303. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, F.; Wang, Z. Toxicity, Mechanism and Their Impact Factors of Micro/Nano Plastics to Freshwater Organisms: A Review. Asian J. Ecotoxicol. 2021, 16, 95–106. (In Chinese) [Google Scholar]
- Jabeen, K.; Li, B.; Chen, Q.; Su, L.; Wu, C.; Hollert, H.; Shi, H. Effects of Virgin Microplastics on Goldfish (Carassius auratus). Chemosphere 2018, 213, 323–332. [Google Scholar] [CrossRef]
- Zhao, J.; Rao, B.Q.; Guo, X.M.; Gao, J.Y. Effects of Microplastics on Embryo Hatching and Intestinal Accumulation in Larval Zebrafish Danio rerio. Environ. Sci. 2021, 42, 485–491. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, Y.K.; Yang, B.K.; Xie, P.F.; Hu, L.Y.; Zhao, X.Q.; Xu, S.X.; Sun, P. Effects of Polystyrene Microplastics on Metabolism in Liver of Swordtail Fish. Asian J. Ecotoxicol. 2022, 17, 35–43. (In Chinese) [Google Scholar]
- Collard, F.; Gilbert, B.; Compère, P.; Eppe, G.; Das, K.; Jauniaux, T.; Parmentier, E. Microplastics in Livers of European Anchovies (Engraulis encrasicolus, L.). Environ. Pollut. 2017, 229, 1000–1005. [Google Scholar] [CrossRef]
- Chenet, T.; Mancia, A.; Bono, G.; Falsone, F.; Scannella, D.; Vaccaro, C.; Baldi, A.; Catani, M.; Cavazzini, A.; Pasti, L. Plastic Ingestion by Atlantic Horse Mackerel (Trachurus trachurus) from Central Mediterranean Sea: A Potential Cause for Endocrine Disruption. Environ. Pollut. 2021, 284, 117449. [Google Scholar] [CrossRef]
- Hao, Y.; Sun, Y.; Li, M.; Fang, X.; Wang, Z.; Zuo, J.; Zhang, C. Adverse Effects of Polystyrene Microplastics in the Freshwater Commercial Fish, Grass Carp (Ctenopharyngodon idella): Emphasis on Physiological Response and Intestinal Microbiome. Sci. Total Environ. 2023, 856, 159270. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Zuo, J.; Li, J.; Zhang, Y.; Ai, X.; Zhang, J.; Gong, D.; Sun, D. Effects of Secondary Polyethylene Microplastic Exposure on Crucian (Carassius carassius) Growth, Liver Damage, and Gut Microbiome Composition. Sci. Total Environ. 2022, 802, 149736. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Gu, H.; Chang, X.; Huang, W.; Sokolova, I.M.; Wei, S.; Sun, L.; Li, S.; Wang, X.; Hu, M.; et al. Oxidative Stress Induced by Nanoplastics in the Liver of Juvenile Large Yellow Croaker Larimichthys Crocea. Mar. Pollut. Bull. 2021, 170, 112661. [Google Scholar] [CrossRef] [PubMed]
- Das, A. The Emerging Role of Microplastics in Systemic Toxicity: Involvement of Reactive Oxygen Species (ROS). Sci. Total Environ. 2023, 895, 165076. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.Z.; Huang, H. Effect of Microplastics on Antioxidant Enzyme System in Juvenile Red Crucian Carp. Environ. Sci. Technol. 2019, 42, 23–27. (In Chinese) [Google Scholar] [CrossRef]
- Tang, J.; Ni, X.; Zhou, Z.; Wang, L.; Lin, S. Acute Microplastic Exposure Raises Stress Response and Suppresses Detoxification and Immune Capacities in the Scleractinian Coral Pocillopora damicornis. Environ. Pollut. 2018, 243, 66–74. [Google Scholar] [CrossRef]
- Eom, H.-J.; Nam, S.-E.; Rhee, J.-S. Polystyrene Microplastics Induce Mortality through Acute Cell Stress and Inhibition of Cholinergic Activity in a Brine Shrimp. Mol. Cell. Toxicol. 2020, 16, 233–243. [Google Scholar] [CrossRef]
- Solomando, A.; Capó, X.; Alomar, C.; Compa, M.; Valencia, J.M.; Sureda, A.; Deudero, S. Assessment of the Effect of Long-Term Exposure to Microplastics and Depuration Period in Sparus Aurata Linnaeus, 1758: Liver and Blood Biomarkers. Sci. Total Environ. 2021, 786, 147479. [Google Scholar] [CrossRef]
- Shen, J.; Wang, L.; Zhang, W.; Gong, X.; Li, S.; Zou, X.; Chen, C.; Xia, R.; Zhang, D.; Xu, S.; et al. Effects of Naphtho[2,1-a]Pyrene Exposure on CYP1A1 Expression: An in Vivo and in Vitro Mechanistic Study Exploring the Role of m6A Posttranscriptional Modification. Environ. Health Perspect. 2024, 132, 087003. [Google Scholar] [CrossRef]
- Yang, N.; Tan, T.; Yang, C.C.; Wu, H.L.; Wang, J.; Lei, X. Effects of Phenanthrene on Hepatic Gonadal Index and Vitellogenin Gene Expression in Misgurnus anguillicaudatus. Asian J. Ecotoxicol. 2022, 17, 497–506. (In Chinese) [Google Scholar]
- Horie, Y.; Nomura, M.; Ramaswamy, B.R.; Harino, H.; Yap, C.K.; Okamura, H. Effects of Non-Phthalate Plasticizer Bis(2-Ethylhexyl) Sebacate (DEHS) on the Endocrine System in Japanese Medaka (Oryzias latipes). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2023, 264, 109531. [Google Scholar] [CrossRef] [PubMed]
- Li, W.J.; Huang, Y.Q.; Pang, R.C.; Huang, L.L.; Zhu, L.; Wang, C.G. Separation, Identification and Characterization of Microplastics of Marine Fish in Beibu Gulf. Environ. Sci. Technol. 2022, 45, 118–127. (In Chinese) [Google Scholar] [CrossRef]
- Yan, Z.; Zhao, H.; Zhu, P.; Wang, Y.; Hou, J.; Lu, G.; He, C. Polystyrene Microplastics Alter the Trophic Transfer and Biotoxicity of Fluoxetine in an Aquatic Food Chain. J. Hazard. Mater. 2024, 470, 134179. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.; Li, X.; Zhou, Y.; Yu, H.; Xie, Y.; Guo, H.; Wang, H.; Li, Y.; Feng, Y.; Wang, Y. Polystyrene Microplastics Induce Hepatotoxicity and Disrupt Lipid Metabolism in the Liver Organoids. Sci. Total Environ. 2022, 806, 150328. [Google Scholar] [CrossRef]
- Zheng, X.; Zhang, W.; Yuan, Y.; Li, Y.; Liu, X.; Wang, X.; Fan, Z. Growth Inhibition, Toxin Production and Oxidative Stress Caused by Three Microplastics in Microcystis aeruginosa. Ecotoxicol. Environ. Saf. 2021, 208, 111575. [Google Scholar] [CrossRef]
- Goodman, K.E.; Hare, J.T.; Khamis, Z.I.; Hua, T.; Sang, Q.-X.A. Exposure of Human Lung Cells to Polystyrene Microplastics Significantly Retards Cell Proliferation and Triggers Morphological Changes. Chem. Res. Toxicol. 2021, 34, 1069–1081. [Google Scholar] [CrossRef]
- Tièche, C.C.; Gao, Y.; Bührer, E.D.; Hobi, N.; Berezowska, S.A.; Wyler, K.; Froment, L.; Weis, S.; Peng, R.-W.; Bruggmann, R.; et al. Tumor Initiation Capacity and Therapy Resistance Are Differential Features of EMT-Related Subpopulations in the NSCLC Cell Line A549. Neoplasia 2019, 21, 185–196. [Google Scholar] [CrossRef]
- Razmara, P.; Zink, L.; Doering, J.A.; Miller, J.G.P.; Wiseman, S.B.; Pyle, G.G. The Combined Effect of Copper Nanoparticles and Microplastics on Transcripts Involved in Oxidative Stress Pathway in Rainbow Trout (Oncorhynchus mykiss) Hepatocytes. Bull. Environ. Contam. Toxicol. 2023, 111, 47. [Google Scholar] [CrossRef]
- Suman, T.Y.; Jia, P.-P.; Li, W.-G.; Junaid, M.; Xin, G.-Y.; Wang, Y.; Pei, D.-S. Acute and Chronic Effects of Polystyrene Microplastics on Brine Shrimp: First Evidence Highlighting the Molecular Mechanism through Transcriptome Analysis. J. Hazard. Mater. 2020, 400, 123220. [Google Scholar] [CrossRef]
- Kazmi, S.S.U.H.; Tayyab, M.; Pastorino, P.; Barcelò, D.; Yaseen, Z.M.; Grossart, H.-P.; Khan, Z.H.; Li, G. Decoding the Molecular Concerto: Toxicotranscriptomic Evaluation of Microplastic and Nanoplastic Impacts on Aquatic Organisms. J. Hazard. Mater. 2024, 472, 134574. [Google Scholar] [CrossRef]
- Banaee, M.; Zeidi, A.; Sinha, R.; Faggio, C. Individual and Combined Toxic Effects of Nano-ZnO and Polyethylene Microplastics on Mosquito Fish (Gambusia holbrooki). Water 2023, 15, 1660. [Google Scholar] [CrossRef]
- Cheng, Y.; Zhu, L.; Song, W.; Jiang, C.; Li, B.; Du, Z.; Wang, J.; Wang, J.; Li, D.; Zhang, K. Combined Effects of Mulch Film-Derived Microplastics and Atrazine on Oxidative Stress and Gene Expression in Earthworm (Eisenia fetida). Sci. Total Environ. 2020, 746, 141280. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Wang, F.; Li, K.; Nie, X.; Fang, H. Effects of Norfloxacin Nicotinate on the Early Life Stage of Zebrafish (Danio rerio): Developmental Toxicity, Oxidative Stress and Immunotoxicity. Fish Shellfish Immunol. 2020, 96, 262–269. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Zhang, X.; Hu, W.; Zhang, J.; Zheng, J. Larimichthys Crocea Is a Suitable Bioindicator for Monitoring Short-Term Cd Discharge along the Coast: An Experimental Study. Environ. Pollut. 2020, 259, 113849. [Google Scholar] [CrossRef]
- Tian, R.; Guan, M.; Chen, L.; Wan, Y.; He, L.; Zhao, Z.; Gao, T.; Zong, L.; Chang, J.; Zhang, J. Mechanism Insights into the Histopathological Changes of Polypropylene Microplastics Induced Gut and Liver in Zebrafish. Ecotox. Environ. Saf. 2024, 280, 116537. [Google Scholar] [CrossRef]
- Yang, Y.; Li, R.; Liu, A.; Xu, J.; Li, L.; Zhao, R.; Qu, M.; Di, Y. How Does the Internal Distribution of Microplastics in Scylla Serrata Link with the Antioxidant Response in Functional Tissues? Environ. Pollut. 2023, 324, 121423. [Google Scholar] [CrossRef]
- Ku, P.; Wu, X.; Nie, X.; Ou, R.; Wang, L.; Su, T.; Li, Y. Effects of Triclosan on the Detoxification System in the Yellow Catfish (Pelteobagrus fulvidraco): Expressions of CYP and GST Genes and Corresponding Enzyme Activity in Phase I, II and Antioxidant System. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2014, 166, 105–114. [Google Scholar] [CrossRef]
- Zheng, S.Y.; Shao, X.; Qi, Z.; Yan, M.; Tao, M.H.; Wu, X.M.; Zhang, L.; Ma, J.; Li, A.; Chang, M.X. Zebrafish Nos2a Benefits Bacterial Proliferation via Suppressing ROS and Inducing NO Production to Impair the Expressions of Inflammatory Cytokines and Antibacterial Genes. Fish Shellfish Immunol. 2023, 142, 109178. [Google Scholar] [CrossRef]
- Ge, J.; Shelby, S.L.; Wang, Y.; Dias Morse, P.; Coffey, K.; Edwards, J.L.; Geng, T.; Li, J.; Huang, Y. Dietary Supplementation with Quercetin Alleviates Fescue Toxisis-Induced Cardiovascular Toxicity by Modulating Detoxification Enzymes through the AHR/NRF2/ABCC1 Signaling Pathways. Food Biosci. 2024, 61, 104877. [Google Scholar] [CrossRef]
- Liao, X.-L.; Chen, Z.-F.; Liu, Q.-Y.; Zhou, J.-M.; Cai, W.-X.; Wang, Y.; Cai, Z. Tissue Accumulation and Biotransformation of 6PPD-Quinone in Adult Zebrafish and Its Effects on the Intestinal Microbial Community. Environ. Sci. Technol. 2024, 58, 10275–10286. [Google Scholar] [CrossRef]
- Morini, M.; Lafont, A.G.; Maugars, G.; Baloche, S.; Dufour, S.; Asturiano, J.F.; Pérez, L. Identification and Stable Expression of Vitellogenin Receptor through Vitellogenesis in the European Eel. Animal 2020, 14, 1213–1222. [Google Scholar] [CrossRef]
- Fernández-Míguez, M.; Puvanendran, V.; Burgerhout, E.; Presa, P.; Tveiten, H.; Vorkamp, K.; Hansen, Ø.J.; Johansson, G.S.; Bogevik, A.S. Effects of Weathered Polyethylene Microplastic Ingestion on Sexual Maturation, Fecundity and Egg Quality in Maturing Broodstock Atlantic Cod Gadus morhua. Environ. Pollut. 2023, 320, 121053. [Google Scholar] [CrossRef]
Gene Name | Upstream Primer Sequence Number | Downstream Primer Sequence Number |
---|---|---|
GSTα | CCCGAGAATATAAAACTCCC | TCAAAAACACTTCCTCAAAC |
Vtg1 | TAGAGCTGGAATGGGAGAGG | TGACACTGTCATCTCTGGAA |
GSTpi | ATCTACCAGGAATATGAGAC | CGGGCAGCAATCTTATCCAC |
ChgH | TTGTGGCACCACAATGAAGA | TGGAGGAGGAACAGTGTTGA |
CYP1A | ATTTCATTCCCAAAGACACCTG | CAAAAACCAACACCTTCTCTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Huang, Y.; Li, W.; Deng, C.; Cao, W.; Yao, Y. Effects of Polystyrene Microplastic Exposure on Liver Cell Damage, Oxidative Stress, and Gene Expression in Juvenile Crucian Carp (Carassius auratus). Toxics 2025, 13, 53. https://doi.org/10.3390/toxics13010053
Li X, Huang Y, Li W, Deng C, Cao W, Yao Y. Effects of Polystyrene Microplastic Exposure on Liver Cell Damage, Oxidative Stress, and Gene Expression in Juvenile Crucian Carp (Carassius auratus). Toxics. 2025; 13(1):53. https://doi.org/10.3390/toxics13010053
Chicago/Turabian StyleLi, Xiangtong, Yuequn Huang, Wenrong Li, Chaoyang Deng, Weiyuan Cao, and Yi Yao. 2025. "Effects of Polystyrene Microplastic Exposure on Liver Cell Damage, Oxidative Stress, and Gene Expression in Juvenile Crucian Carp (Carassius auratus)" Toxics 13, no. 1: 53. https://doi.org/10.3390/toxics13010053
APA StyleLi, X., Huang, Y., Li, W., Deng, C., Cao, W., & Yao, Y. (2025). Effects of Polystyrene Microplastic Exposure on Liver Cell Damage, Oxidative Stress, and Gene Expression in Juvenile Crucian Carp (Carassius auratus). Toxics, 13(1), 53. https://doi.org/10.3390/toxics13010053