The α4 Nicotinic Acetylcholine Receptor Is Necessary for the Initiation of Organophosphate-Induced Neuronal Hyperexcitability
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animals
2.3. Primary Neuron–Glia Co-Cultures
2.4. Measurement of Ca2+ in Primary Neuron–Glia Co-Cultures
2.5. Preparation of Acute Hippocampal Slices
2.6. Measurement of AChE Activity in Mouse Neuronal/Glial Cell Cultures and Hippocampal Slices
2.7. In Vitro pMEA Setup for Measuring Electrical Spike Activity (ESA)
2.8. In Vivo DFP Dosing Paradigm
2.9. Quantification of Seizure Behavior
2.10. EEG Surgery and Recordings
2.11. EEG Analyses
3. Results
3.1. Primary Neuronal/Glial Cell Cultures from Neonatal Rodents Express AChE but Fail to Target Functional nAChRs
3.2. DFP Increased Spontaneous Electrical Spike Activity (ESA) Proportionate to AChE Inhibition in Acute Hippocampal Slices Prepared from Adult Mouse Hippocampi
3.2.1. Mecamylamine Suppressed DFP-Triggered ESA Hyperexcitation
3.2.2. Dihydro-β-Erythroidine (DHβE) Reversibly Attenuated the DFP-Triggered Increases in ESA
3.2.3. ESA Responses to DFP Are Significantly Attenuated in Slices from α4 nAChR Knockout (KO) Mice
3.3. Pharmacologic Antagonism or Genetic KO of α4, but Not α7, nAChRs Prevented DFP-Induced EEG Abnormalities
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Costa, L.G. Organophosphorus Compounds at 80: Some Old and New Issues. Toxicol. Sci. 2018, 162, 24–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jett, D.A.; Spriggs, S.M. Translational research on chemical nerve agents. Neurobiol. Dis. 2020, 133, 104335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vale, J.A.; Marrs, T.O.; Maynard, R.C. Novichok: A murderous nerve agent attack in the UK. Clin. Toxicol. 2018, 56, 1093–1097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steindl, D.; Boehmerle, W.; Korner, R.; Praeger, D.; Haug, M.; Nee, J.; Schreiber, A.; Scheibe, F.; Demin, K.; Jacoby, P.; et al. Novichok nerve agent poisoning. Lancet 2021, 397, 249–252. [Google Scholar] [CrossRef] [Scilit]
- Mew, E.J.; Padmanathan, P.; Konradsen, F.; Eddleston, M.; Chang, S.S.; Phillips, M.R.; Gunnell, D. The global burden of fatal self-poisoning with pesticides 2006-15: Systematic review. J. Affect. Disord. 2017, 219, 93–104. [Google Scholar] [CrossRef] [Scilit]
- Jett, D.A.; Sibrizzi, C.A.; Blain, R.B.; Hartman, P.A.; Lein, P.J.; Taylor, K.W.; Rooney, A.A. A national toxicology program systematic review of the evidence for long-term effects after acute exposure to sarin nerve agent. Crit. Rev. Toxicol. 2020, 50, 474–490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, Y.H.; Lein, P.J. Mechanisms of organophosphate neurotoxicity. Curr. Opin. Toxicol. 2021, 26, 49–60. [Google Scholar] [CrossRef] [Scilit]
- Pereira, E.F.; Aracava, Y.; De Tolla, L.J., Jr.; Beecham, E.J.; Basinger, G.W., Jr.; Wakayama, E.J.; Albuquerque, E.X. Animal models that best reproduce the clinical manifestations of human intoxication with organophosphorus compounds. J. Pharmacol. Exp. Ther. 2014, 350, 313–321. [Google Scholar] [CrossRef] [Scilit]
- Richardson, J.R.; Fitsanakis, V.; Westerink, R.H.S.; Kanthasamy, A.G. Neurotoxicity of pesticides. Acta Neuropathol. 2019, 138, 343–362. [Google Scholar] [CrossRef] [Scilit]
- Newmark, J. Therapy for acute nerve agent poisoning: An update. Neurol. Clin. Pract. 2019, 9, 337–342. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y. Organophosphate-induced brain damage: Mechanisms, neuropsychiatric and neurological consequences, and potential therapeutic strategies. Neurotoxicology 2012, 33, 391–400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chuang, C.S.; Yang, K.W.; Yen, C.M.; Lin, C.L.; Kao, C.H. Risk of Seizures in Patients with Organophosphate Poisoning: A Nationwide Population-Based Study. Int. J. Environ. Res. Public Health 2019, 16, 3147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dassanayake, T.; Weerasinghe, V.; Dangahadeniya, U.; Kularatne, K.; Dawson, A.; Karalliedde, L.; Senanayake, N. Cognitive processing of visual stimuli in patients with organophosphate insecticide poisoning. Neurology 2007, 68, 2027–2030. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dassanayake, T.; Weerasinghe, V.; Dangahadeniya, U.; Kularatne, K.; Dawson, A.; Karalliedde, L.; Senanayake, N. Long-term event-related potential changes following organophosphorus insecticide poisoning. Clin. Neurophysiol. 2008, 119, 144–150. [Google Scholar] [CrossRef] [Scilit]
- Figueiredo, T.H.; Apland, J.P.; Braga, M.F.M.; Marini, A.M. Acute and long-term consequences of exposure to organophosphate nerve agents in humans. Epilepsia 2018, 59 (Suppl. S2), 92–99. [Google Scholar] [CrossRef] [Scilit]
- Loh, Y.; Swanberg, M.M.; Ingram, M.V.; Newmark, J. Case report: Long-term cognitive sequelae of sarin exposure. Neurotoxicology 2010, 31, 244–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamasue, H.; Abe, O.; Kasai, K.; Suga, M.; Iwanami, A.; Yamada, H.; Tochigi, M.; Ohtani, T.; Rogers, M.A.; Sasaki, T.; et al. Human brain structural change related to acute single exposure to sarin. Ann. Neurol. 2007, 61, 37–46. [Google Scholar] [CrossRef] [Scilit]
- de Araujo Furtado, M.; Rossetti, F.; Chanda, S.; Yourick, D. Exposure to nerve agents: From status epilepticus to neuroinflammation, brain damage, neurogenesis and epilepsy. Neurotoxicology 2012, 33, 1476–1490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shih, T.M.; Duniho, S.M.; McDonough, J.H. Control of nerve agent-induced seizures is critical for neuroprotection and survival. Toxicol. Appl. Pharmacol. 2003, 188, 69–80. [Google Scholar] [CrossRef] [Scilit]
- Hobson, B.A.; Siso, S.; Rowland, D.J.; Harvey, D.J.; Bruun, D.A.; Garbow, J.R.; Lein, P.J. From the Cover: MagneticResonance Imaging Reveals Progressive Brain Injury in Rats Acutely Intoxicated With Diisopropylfluorophosphate. Toxicol. Sci. 2017, 157, 342–353. [Google Scholar] [CrossRef] [Scilit]
- McDonough, J.H., Jr.; Shih, T.M. Neuropharmacological mechanisms of nerve agent-induced seizure and neuropathology. Neurosci. Biobehav. Rev. 1997, 21, 559–579. [Google Scholar] [CrossRef] [Scilit]
- Shih, T.M.; Koviak, T.A.; Capacio, B.R. Anticonvulsants for poisoning by the organophosphorus compound soman: Pharmacological mechanisms. Neurosci. Biobehav. Rev. 1991, 15, 349–362. [Google Scholar] [CrossRef] [Scilit]
- Goodkin, H.P.; Joshi, S.; Mtchedlishvili, Z.; Brar, J.; Kapur, J. Subunit-specific trafficking of GABA(A) receptors during status epilepticus. J. Neurosci. 2008, 28, 2527–2538. [Google Scholar] [CrossRef] [Scilit]
- Wasterlain, C.G.; Liu, H.; Naylor, D.E.; Thompson, K.W.; Suchomelova, L.; Niquet, J.; Mazarati, A.M.; Baldwin, R.A. Molecular basis of self-sustaining seizures and pharmacoresistance during status epilepticus: The receptor trafficking hypothesis revisited. Epilepsia 2009, 50 (Suppl. S12), 16–18. [Google Scholar] [CrossRef] [Scilit]
- Zambrano, C.A.; Short, C.A.; Salamander, R.M.; Grady, S.R.; Marks, M.J. Density of alpha4beta2* nAChR on the surface of neurons is modulated by chronic antagonist exposure. Pharmacol. Res. Perspect. 2015, 3, e00111. [Google Scholar] [CrossRef] [Scilit]
- Srinivasan, R.; Pantoja, R.; Moss, F.J.; Mackey, E.D.; Son, C.D.; Miwa, J.; Lester, H.A. Nicotine up-regulates alpha4beta2 nicotinic receptors and ER exit sites via stoichiometry-dependent chaperoning. J. Gen. Physiol. 2011, 137, 59–79. [Google Scholar] [CrossRef] [Scilit]
- Calsbeek, J.J.; Gonzalez, E.A.; Bruun, D.A.; Guignet, M.A.; Copping, N.; Dawson, M.E.; Yu, A.J.; MacMahon, J.A.; Saito, N.H.; Harvey, D.J.; et al. Persistent neuropathology and behavioral deficits in a mouse model of status epilepticus induced by acute intoxication with diisopropylfluorophosphate. Neurotoxicology 2021, 87, 106–119. [Google Scholar] [CrossRef] [Scilit]
- Gao, J.; Naughton, S.X.; Wulff, H.; Singh, V.; Beck, W.D.; Magrane, J.; Thomas, B.; Kaidery, N.A.; Hernandez, C.M.; Terry, A.V., Jr. Diisopropylfluorophosphate Impairs the Transport of Membrane-Bound Organelles in Rat Cortical Axons. J. Pharmacol. Exp. Ther. 2016, 356, 645–655. [Google Scholar] [CrossRef] [Scilit]
- Ross, S.A.; Wong, J.Y.; Clifford, J.J.; Kinsella, A.; Massalas, J.S.; Horne, M.K.; Scheffer, I.E.; Kola, I.; Waddington, J.L.; Berkovic, S.F.; et al. Phenotypic characterization of an alpha 4 neuronal nicotinic acetylcholine receptor subunit knock-out mouse. J. Neurosci. 2000, 20, 6431–6441. [Google Scholar] [CrossRef] [Scilit]
- Orr-Urtreger, A.; Goldner, F.M.; Saeki, M.; Lorenzo, I.; Goldberg, L.; De Biasi, M.; Dani, J.A.; Patrick, J.W.; Beaudet, A.L. Mice deficient in the alpha7 neuronal nicotinic acetylcholine receptor lack alpha-bungarotoxin binding sites and hippocampal fast nicotinic currents. J. Neurosci. 1997, 17, 9165–9171. [Google Scholar] [CrossRef] [Scilit]
- Kretz, A.; Marticke, J.K.; Happold, C.J.; Schmeer, C.; Isenmann, S. A primary culture technique of adult retina for regeneration studies on adult CNS neurons. Nat. Protoc. 2007, 2, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.S.; Pessah, I.N.; Santana, C.M.; Purnell, B.; Li, R.; Buchanan, G.F.; Rumbeiha, W.K. Investigations into hydrogen sulfide-induced suppression of neuronal activity in vivo and calcium dysregulation in vitro. Toxicol. Sci. 2023, 192, 247–264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antrobus, S.; Pressly, B.; Nik, A.M.; Wulff, H.; Pessah, I.N. Structure-Activity Relationship of Neuroactive Steroids, Midazolam, and Perampanel Toward Mitigating Tetramine-Triggered Activity in Murine Hippocampal Neuronal Networks. Toxicol. Sci. 2021, 180, 325–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, J.; Yu, Y.; Feng, W.; Li, J.; Liu, J.; Zhang, C.; Dong, Y.; Pessah, I.N.; Cao, Z. Influence of Nanomolar Deltamethrin on the Hallmarks of Primary Cultured Cortical Neuronal Network and the Role of Ryanodine Receptors. Environ. Health Perspect. 2019, 127, 67003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, W.; Zheng, J.; Robin, G.; Dong, Y.; Ichikawa, M.; Inoue, Y.; Mori, T.; Nakano, T.; Pessah, I.N. Enantioselectivity of 2,2′,3,5′,6-Pentachlorobiphenyl (PCB 95) Atropisomers toward Ryanodine Receptors (RyRs) and Their Influences on Hippocampal Neuronal Networks. Environ. Sci. Technol. 2017, 51, 14406–14416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Z.; Xu, J.; Hulsizer, S.; Cui, Y.; Dong, Y.; Pessah, I.N. Influence of tetramethylenedisulfotetramine on synchronous calcium oscillations at distinct developmental stages of hippocampal neuronal cultures. Neurotoxicology 2017, 58, 11–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Z.; Zou, X.; Cui, Y.; Hulsizer, S.; Lein, P.J.; Wulff, H.; Pessah, I.N. Rapid throughput analysis demonstrates that chemicals with distinct seizurogenic mechanisms differentially alter Ca2+ dynamics in networks formed by hippocampal neurons in culture. Mol. Pharmacol. 2015, 87, 595–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellman, G.L.; Courtney, K.D.; Andres, V., Jr.; Feather-Stone, R.M. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 1961, 7, 88–95. [Google Scholar] [CrossRef] [Scilit]
- Bruun, D.A.; Guignet, M.; Harvey, D.J.; Lein, P.J. Pretreatment with pyridostigmine bromide has no effect on seizure behavior or 24 hour survival in the rat model of acute diisopropylfluorophosphate intoxication. Neurotoxicology 2019, 73, 81–84. [Google Scholar] [CrossRef] [Scilit]
- Dhir, A.; Bruun, D.A.; Guignet, M.; Tsai, Y.H.; Gonzalez, E.; Calsbeek, J.; Vu, J.; Saito, N.; Tancredi, D.J.; Harvey, D.J.; et al. Allopregnanolone and perampanel as adjuncts to midazolam for treating diisopropylfluorophosphate-induced status epilepticus in rats. Ann. N. Y. Acad. Sci. 2020, 1480, 183–206. [Google Scholar] [CrossRef] [Scilit]
- Slimen, I.B.; Boubchir, L.; Seddik, H. Epileptic seizure prediction based on EEG spikes detection of ictal-preictal states. J. Biomed. Res. 2020, 34, 162–169. [Google Scholar] [CrossRef] [Scilit]
- Rojas, A.; McCarren, H.S.; Wang, J.; Wang, W.; Abreu-Melon, J.; Wang, S.; McDonough, J.H.; Dingledine, R. Comparison of neuropathology in rats following status epilepticus induced by diisopropylfluorophosphate and soman. Neurotoxicology 2021, 83, 14–27. [Google Scholar] [CrossRef] [Scilit]
- Harris, L.; Stitcher, D. Protection against diisopropylfluorophosphate intoxication by pyridostigmine and physostigmine in combination with atropine and mecamylamine. Naunyn Schmiedebergs Arch. Pharmacol. 1984, 327, 64–69. [Google Scholar] [CrossRef] [Scilit]
- Hassel, B. Nicotinic mechanisms contribute to soman-induced symptoms and lethality. Neurotoxicology 2006, 27, 501–507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steinlein, O.K.; Mulley, J.C.; Propping, P.; Wallace, R.H.; Phillips, H.A.; Sutherland, G.R.; Scheffer, I.E.; Berkovic, S.F. A missense mutation in the neuronal nicotinic acetylcholine receptor alpha 4 subunit is associated with autosomal dominant nocturnal frontal lobe epilepsy. Nat. Genet. 1995, 11, 201–203. [Google Scholar] [CrossRef] [Scilit]
- Fonck, C.; Nashmi, R.; Deshpande, P.; Damaj, M.I.; Marks, M.J.; Riedel, A.; Schwarz, J.; Collins, A.C.; Labarca, C.; Lester, H.A. Increased sensitivity to agonist-induced seizures, straub tail, and hippocampal theta rhythm in knock-in mice carrying hypersensitive alpha 4 nicotinic receptors. J. Neurosci. 2003, 23, 2582–2590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stitzel, J.A.; Blanchette, J.M.; Collins, A.C. Sensitivity to the seizure-inducing effects of nicotine is associated with strain-specific variants of the alpha 5 and alpha 7 nicotinic receptor subunit genes. J. Pharmacol. Exp. Ther. 1998, 284, 1104–1111. [Google Scholar] [PubMed]
- Li, Y.; Lein, P.J.; Liu, C.; Bruun, D.A.; Tewolde, T.; Ford, G.; Ford, B.D. Spatiotemporal pattern of neuronal injury induced by DFP in rats: A model for delayed neuronal cell death following acute OP intoxication. Toxicol. Appl. Pharmacol. 2011, 253, 261–269. [Google Scholar] [CrossRef] [Scilit]
- Forsberg, A.; Puu, G. Kinetics for the inhibition of acetylcholinesterase from the electric eel by some organophosphates and carbamates. Eur. J. Biochem. 1984, 140, 153–156. [Google Scholar] [CrossRef] [Scilit]
- Hermann, D.; van Amsterdam, C. Analysis of spontaneous hippocampal activity allows sensitive detection of acetylcholine-mediated effects. J. Pharmacol. Toxicol. Methods 2015, 71, 54–60. [Google Scholar] [CrossRef] [Scilit]
- Ferchmin, P.A.; Andino, M.; Reyes Salaman, R.; Alves, J.; Velez-Roman, J.; Cuadrado, B.; Carrasco, M.; Torres-Rivera, W.; Segarra, A.; Martins, A.H.; et al. 4R-cembranoid protects against diisopropylfluorophosphate-mediated neurodegeneration. Neurotoxicology 2014, 44, 80–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrison, P.K.; Sheridan, R.D.; Green, A.C.; Scott, I.R.; Tattersall, J.E. A guinea pig hippocampal slice model of organophosphate-induced seizure activity. J. Pharmacol. Exp. Ther. 2004, 310, 678–686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Damaj, M.I.; Glassco, W.; Dukat, M.; Martin, B.R. Pharmacological characterization of nicotine-induced seizures in mice. J. Pharmacol. Exp. Ther. 1999, 291, 1284–1291. [Google Scholar] [PubMed]
- Kedmi, M.; Beaudet, A.L.; Orr-Urtreger, A. Mice lacking neuronal nicotinic acetylcholine receptor beta4-subunit and mice lacking both alpha5- and beta4-subunits are highly resistant to nicotine-induced seizures. Physiol. Genom. 2004, 17, 221–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salas, R.; Orr-Urtreger, A.; Broide, R.S.; Beaudet, A.; Paylor, R.; De Biasi, M. The nicotinic acetylcholine receptor subunit alpha 5 mediates short-term effects of nicotine in vivo. Mol. Pharmacol. 2003, 63, 1059–1066. [Google Scholar] [CrossRef] [Scilit]
- Wong, J.Y.; Ross, S.A.; McColl, C.; Massalas, J.S.; Powney, E.; Finkelstein, D.I.; Clark, M.; Horne, M.K.; Berkovic, S.F.; Drago, J. Proconvulsant-induced seizures in alpha(4) nicotinic acetylcholine receptor subunit knockout mice. Neuropharmacology 2002, 43, 55–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lallement, G.; Carpentier, P.; Collet, A.; Baubichon, D.; Pernot-Marino, I.; Blanchet, G. Extracellular acetylcholine changes in rat limbic structures during soman-induced seizures. Neurotoxicology 1992, 13, 557–567. [Google Scholar] [PubMed]
- Zimmerman, G.; Njunting, M.; Ivens, S.; Tolner, E.A.; Behrens, C.J.; Gross, M.; Soreq, H.; Heinemann, U.; Friedman, A. Acetylcholine-induced seizure-like activity and modified cholinergic gene expression in chronically epileptic rats. Eur. J. Neurosci. 2008, 27, 965–975. [Google Scholar] [CrossRef] [Scilit]
- Maslarova, A.; Salar, S.; Lapilover, E.; Friedman, A.; Veh, R.W.; Heinemann, U. Increased susceptibility to acetylcholine in the entorhinal cortex of pilocarpine-treated rats involves alterations in KCNQ channels. Neurobiol. Dis. 2013, 56, 14–24. [Google Scholar] [CrossRef] [Scilit]
- Dodd, J.; Dingledine, R.; Kelly, J.S. The excitatory action of acetylcholine on hippocampal neurones of the guinea pig and rat maintained in vitro. Brain Res. 1981, 207, 109–127. [Google Scholar] [CrossRef] [Scilit]
- Wheal, H.V.; Miller, J.J. Pharmacological identification of acetylcholine and glutamate excitatory systems in the dentate gyrus of the rat. Brain Res. 1980, 182, 145–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vidal, C.; Changeux, J.P. Pharmacological profile of nicotinic acetylcholine receptors in the rat prefrontal cortex: An electrophysiological study in a slice preparation. Neuroscience 1989, 29, 261–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Dell, T.J.; Christensen, B.N. Mecamylamine is a selective non-competitive antagonist of N-methyl-D-aspartate- and aspartate-induced currents in horizontal cells dissociated from the catfish retina. Neurosci. Lett. 1988, 94, 93–98. [Google Scholar] [CrossRef] [Scilit]
- Debruyne, D.; Sobrio, F.; Hinschberger, A.; Camsonne, R.; Coquerel, A.; Barre, L. Short-term pharmacokinetics and brain distribution of mecamylamine as a preliminary to carbon-11 labeling for nicotinic receptor investigation. J. Pharm. Sci. 2003, 92, 1051–1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fleisher, J.H.; Harris, L.W.; Miller, G.R.; Thomas, N.C.; Cliff, W.J. Antagonism of sarin poisoning in rats and guinea pigs by atropine, oximes, and mecamylamine. Toxicol. Appl. Pharmacol. 1970, 16, 40–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiou, G.C.; Chang, W.T.; Aimoto, T. Prophylactic action of hexamethonium, trimethaphan, and mecamylamine against diisopropyl fluorophosphate poisoning in mice. Fundam. Appl. Toxicol. 1986, 6, 35–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lein, P.J.; Barnhart, C.D.; Pessah, I.N. Acute hippocampal slice preparation and hippocampal slice cultures. Methods Mol. Biol. 2011, 758, 115–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klink, R.; de Kerchove d’Exaerde, A.; Zoli, M.; Changeux, J.P. Molecular and physiological diversity of nicotinic acetylcholine receptors in the midbrain dopaminergic nuclei. J. Neurosci. 2001, 21, 1452–1463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harvey, S.C.; Maddox, F.N.; Luetje, C.W. Multiple determinants of dihydro-beta-erythroidine sensitivity on rat neuronal nicotinic receptor alpha subunits. J. Neurochem. 1996, 67, 1953–1959. [Google Scholar] [CrossRef] [Scilit]
- Salas, R.; Cook, K.D.; Bassetto, L.; De Biasi, M. The alpha3 and beta4 nicotinic acetylcholine receptor subunits are necessary for nicotine-induced seizures and hypolocomotion in mice. Neuropharmacology 2004, 47, 401–407. [Google Scholar] [CrossRef] [Scilit]
- McCauley, L.A.; Rischitelli, G.; Lambert, W.E.; Lasarev, M.; Sticker, D.L.; Spencer, P.S. Symptoms of Gulf War veterans possibly exposed to organophosphate chemical warfare agents at Khamisiyah, Iraq. Int. J. Occup. Environ. Health 2001, 7, 79–89. [Google Scholar] [CrossRef] [PubMed]
- Chao, L.L.; Kriger, S.; Buckley, S.; Ng, P.; Mueller, S.G. Effects of low-level sarin and cyclosarin exposure on hippocampal subfields in Gulf War Veterans. Neurotoxicology 2014, 44, 263–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nies, A.S. Adverse reactions and interactions limiting the use of antihypertensive drugs. Am. J. Med. 1975, 58, 495–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Gene Name | Forward Primer Sequence | Reverse Primer Sequence | Expected Size (bp) |
|---|---|---|---|
| α4-WT | 5′–CAATGTACACCACCGCTCAC–3′ | 5′-ACTGCTATTGGGTGGGTGAC–3′ | 385 |
| α4-deletion mutant | 5′–CTTGGGTGGAGAGGCTATTC–3′ | 5′–AGGTGAGATGACAGGAGATC–3′ | 280 |
| α7-WT | 5′–TTCCTGGTCCTGCTGTGTTA–3′ | 5′–ATCAGATGTTGCTGGCATGA–3′ | 390 |
| α7-deletion mutant | 5′–TTCCTGGTCCTGCTGTGTTA–3′ | 5′–CCCTTTATAGATTCGCCCTTG–3′ | 187 |
| Primary Neuron-glia c¥o-cultures (Age When Cells were Derived) | SCO Response to DFP with >95% AChE Inhibition | AChE Expressed | Response to Cholinergic Ligands | |
|---|---|---|---|---|
| Atropine | Nicotine | |||
| Murine | ||||
| Hippocampus (PND 0) | DFP (−); Paraoxon (−) | YES | YES | NO |
| Neocortex (PND 0) | DFP (−); Paraoxon (−) | YES | YES | NO |
| Neocortex (E 18) | DFP (−); Paraoxon (−) | LOW | (Not tested) | NO |
| Neocortex (adult) | Unhealthy | (Not tested) | (Not tested) | (Not tested) |
| Rat | ||||
| Hippocampus (PND 0) | DFP (−); Paraoxon (−) | YES | YES | NO |
| Neocortex (PND 0) | DFP (−); Paraoxon (−) | YES | (Not tested) | NO |
| Baseline | DFP | |||||
|---|---|---|---|---|---|---|
| Epoch (bin width, 10min) | I | II | III | IV | V | VI |
| Mean fold-change over baseline (spikes/min) | 1 | 9.1 | 44.7 | 50.6 | 60.7 | 80.4 |
| Std. deviation | 0.746 | 81.1 | 158 | 121 | 130 | 152 |
| Std. error of mean | 0.0282 | 3.12 | 5.99 | 4.59 | 4.92 | 6.75 |
| Lower 95% CI of mean | 0.945 | 2.96 | 32.9 | 41.6 | 51.1 | 67.1 |
| Upper 95% CI of mean | 1.06 | 15.2 | 56.4 | 59.6 | 70.4 | 93.6 |
| Dunnett’s Multiple Comparisons Test | Mean Diff. | 95% CI of diff. | Adjusted p Value | |||
| I vs. II | −59.33 | −76.65 to −42.01 | <0.0001 | |||
| I vs. III | −248.4 | −294.5 to −202.1 | <0.0001 | |||
| I vs. IV | −408.6 | −462.1 to −355.0 | <0.0001 | |||
| I vs. V | −542.3 | −604.0 to −480.6 | <0.0001 | |||
| I vs. VI | −678.9 | −760.0 to −597.7 | <0.0001 | |||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Andrew, P.M.; Feng, W.; Calsbeek, J.J.; Antrobus, S.P.; Cherednychenko, G.A.; MacMahon, J.A.; Bernardino, P.N.; Liu, X.; Harvey, D.J.; Lein, P.J.; et al. The α4 Nicotinic Acetylcholine Receptor Is Necessary for the Initiation of Organophosphate-Induced Neuronal Hyperexcitability. Toxics 2024, 12, 263. https://doi.org/10.3390/toxics12040263
Andrew PM, Feng W, Calsbeek JJ, Antrobus SP, Cherednychenko GA, MacMahon JA, Bernardino PN, Liu X, Harvey DJ, Lein PJ, et al. The α4 Nicotinic Acetylcholine Receptor Is Necessary for the Initiation of Organophosphate-Induced Neuronal Hyperexcitability. Toxics. 2024; 12(4):263. https://doi.org/10.3390/toxics12040263
Chicago/Turabian StyleAndrew, Peter M., Wei Feng, Jonas J. Calsbeek, Shane P. Antrobus, Gennady A. Cherednychenko, Jeremy A. MacMahon, Pedro N. Bernardino, Xiuzhen Liu, Danielle J. Harvey, Pamela J. Lein, and et al. 2024. "The α4 Nicotinic Acetylcholine Receptor Is Necessary for the Initiation of Organophosphate-Induced Neuronal Hyperexcitability" Toxics 12, no. 4: 263. https://doi.org/10.3390/toxics12040263
APA StyleAndrew, P. M., Feng, W., Calsbeek, J. J., Antrobus, S. P., Cherednychenko, G. A., MacMahon, J. A., Bernardino, P. N., Liu, X., Harvey, D. J., Lein, P. J., & Pessah, I. N. (2024). The α4 Nicotinic Acetylcholine Receptor Is Necessary for the Initiation of Organophosphate-Induced Neuronal Hyperexcitability. Toxics, 12(4), 263. https://doi.org/10.3390/toxics12040263

