Effect of Sublethal Concentrations of Metal Nanomaterials on Cell Energy Metabolism
Abstract
1. Introduction
2. Materials and Methods
2.1. Morphological and Surface Characterization of the Four Metallic Nanomaterials
2.2. Cell Culture
2.3. Cell Viability
2.4. Apoptosis Detection by Flow Cytometry
2.5. Real-Time RT-PCR Analysis
2.6. Western Blot Analysis
2.7. Morphological Changes in Mitochondria Were Observed by TEM
2.8. Measurement of Mitochondrial Membrane Potential
2.9. Mitochondrial Energy Metabolism Analysis System
2.10. Measurement of Mitochondrial Complex Activity
2.11. Statistical Analysis
3. Results and Discussion
3.1. Characterization of Metallic Nanomaterials
3.2. The Effect of Sublethal Concentrations of Metal Nanomaterials on Cell Activity
3.3. The Effects of Metallic Nanomaterials on the Mitochondria in HK-2 Cells
3.4. The Effects of Metallic Nanomaterials on the Mitochondrial Energy Metabolism
3.5. The Effects of Metallic Nanomaterials on the Mitochondrial Complex Activity
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Buzea, C.; Pacheco, I.I.; Robbie, K. Nanomaterials and nanoparticles: Sources and toxicity. Biointerphases 2007, 2, 54. [Google Scholar] [CrossRef]
- Ahmad, F.; Ashraf, N.; Ashraf, T.; Zhou, R.B.; Yin, D.C. Biological synthesis of metallic nanoparticles (MNPs) by plants and microbes: Their cellular uptake, biocompatibility, and biomedical applications. Appl. Microbiol. Biotechnol. 2019, 103, 2913–2935. [Google Scholar] [CrossRef] [PubMed]
- Herbert, G. Nanostructured materials: Basic concepts and microstructure. Acta Mater. 2000, 48, 29. [Google Scholar]
- You, H.; Yang, S.; Ding, B.; Yang, H. Synthesis of colloidal metal and metal alloy nanoparticles for electrochemical energy applications. Chem. Soc. Rev. 2013, 42, 2880–2904. [Google Scholar] [CrossRef]
- Singh, P.; Kim, Y.J.; Zhang, D.; Yang, D.C. Biological Synthesis of Nanoparticles from Plants and Microorganisms. Trends Biotechnol. 2016, 34, 588–599. [Google Scholar] [CrossRef]
- Abbasi, E.; Milani, M.; Fekri Aval, S.; Kouhi, M.; Akbarzadeh, A.; Tayefi Nasrabadi, H.; Nikasa, P.; Joo, S.W.; Hanifehpour, Y.; Nejati-Koshki, K.; et al. Silver nanoparticles: Synthesis methods, bio-applications and properties. Crit. Rev. Microbiol. 2016, 42, 173–180. [Google Scholar] [CrossRef] [PubMed]
- Mathur, P.; Jha, S.; Ramteke, S.; Jain, N.K. Pharmaceutical aspects of silver nanoparticles. Artif. Cells Nanomed. Biotechnol. 2018, 46 (Suppl. S1), 115–126. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Xu, L.; Dekkers, S.; Zhang, L.G.; Cassee, F.R.; Zuo, Y.Y. Aggregation State of Metal-Based Nanomaterials at the Pulmonary Surfactant Film Determines Biophysical Inhibition. Environ. Sci. Technol. 2018, 52, 8920–8929. [Google Scholar] [CrossRef]
- Cao, Y.; Gong, Y.; Liao, W.; Luo, Y.; Wu, C.; Wang, M.; Yang, Q. A review of cardiovascular toxicity of TiO2, ZnO and Ag nanoparticles (NPs). Biometals 2018, 31, 457–476. [Google Scholar] [CrossRef]
- Ray, P.C.; Yu, H.; Fu, P.P. Toxicity and environmental risks of nanomaterials: Challenges and future needs. J. Environ. Sci. Health C Environ. Carcinog. Ecotoxicol. Rev. 2009, 27, 1–35. [Google Scholar] [CrossRef]
- Czyzowska, A.; Barbasz, A. Cytotoxicity of zinc oxide nanoparticles to innate and adaptive human immune cells. J. Appl. Toxicol. 2021, 41, 1425–1437. [Google Scholar] [CrossRef]
- Assadian, E.; Zarei, M.H.; Gilani, A.G.; Farshin, M.; Degampanah, H.; Pourahmad, J. Toxicity of Copper Oxide (CuO) Nanoparticles on Human Blood Lymphocytes. Biol. Trace Elem. Res. 2018, 184, 350–357. [Google Scholar] [CrossRef] [PubMed]
- Soto, K.F.; Carrasco, A.; Powell, T.G.; Garza, K.M.; Murr, L.E. Comparative in vitro cytotoxicity assessment of some manufacturednanoparticulate materials characterized by transmissionelectron microscopy. J. Nanoparticle Res. 2005, 7, 145–169. [Google Scholar] [CrossRef]
- Akçan, R.; Aydogan, H.C.; Yildirim, M.Ş.; Taştekin, B.; Sağlam, N. Nanotoxicity: A challenge for future medicine. Turk. J. Med. Sci. 2020, 50, 1180–1196. [Google Scholar] [CrossRef]
- Yan, G.; Huang, Y.; Bu, Q.; Lv, L.; Deng, P.; Zhou, J.; Wang, Y.; Yang, Y.; Liu, Q.; Cen, X.; et al. Zinc oxide nanoparticles cause nephrotoxicity and kidney metabolism alterations in rats. J. Environ. Sci. Health A Tox. Hazard. Subst. Environ. Eng. 2012, 47, 577–588. [Google Scholar] [CrossRef] [PubMed]
- Zhao, K.F.; Song, Y.Q.; Zhang, R.H.; Yang, X.Y.; Bo, S.U.N.; Hou, Z.Q.; Pu, X.P.; Dai, H.X.; Bai, X.T. Comparative Toxicity of Nanomaterials to Air-blood Barrier Permeability Using an In Vitro Model. Biomed. Environ. Sci. 2019, 32, 602–613. [Google Scholar]
- Chen, P.; Wang, H.; He, M.; Chen, B.; Yang, B.; Hu, B. Size-dependent cytotoxicity study of ZnO nanoparticles in HepG2 cells. Ecotoxicol. Environ. Saf. 2019, 171, 337–346. [Google Scholar] [CrossRef]
- Wongrakpanich, A.; Mudunkotuwa, I.A.; Geary, S.M.; Morris, A.S.; Mapuskar, K.A.; Spitz, D.R.; Grassian, V.H.; Salem, A.K. Size-dependent cytotoxicity of copper oxide nanoparticles in lung epithelial cells. Environ. Sci. Nano 2016, 3, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Kong, Y.; Kundu, S.; Cirillo, J.D.; Liang, H. Antibacterial activities of gold and silver nanoparticles against Escherichia coli and bacillus Calmette-Guerin. J. Nanobiotechnol. 2012, 10, 19. [Google Scholar] [CrossRef]
- Vimbela, G.V.; Ngo, S.M.; Fraze, C.; Yang, L.; Stout, D.A. Antibacterial properties and toxicity from metallic nanomaterials. Int. J. Nanomed. 2017, 12, 3941–3965. [Google Scholar] [CrossRef]
- Møller, P.; Jacobsen, N.R.; Folkmann, J.K.; Danielsen, P.H.; Mikkelsen, L.; Hemmingsen, J.G.; Vesterdal, L.K.; Forchhammer, L.; Wallin, H.; Loft, S. Role of oxidative damage in toxicity of particulates. Free Radic. Res. 2010, 44, 1–46. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.C.; Murphy, M.P.; Jastroch, M.; Divakaruni, A.S.; Mookerjee, S.; Treberg, J.R.; Brand, M.D. Mitochondrial proton and electron leaks. Essays Biochem. 2010, 47, 53–67. [Google Scholar] [CrossRef]
- Liao, C.; Li, Y.; Tjong, S.C. Bactericidal and Cytotoxic Properties of Silver Nanoparticles. Int. J. Mol. Sci. 2019, 20, 449. [Google Scholar] [CrossRef]
- Wang, F.; Wang, Y.; Yao, X.; Ma, C.; Yin, Y.; Song, M. Length and diameter-dependent phagocytosis and cytotoxicity of long silver nanowires in macrophages. Chemosphere 2019, 237, 124565. [Google Scholar] [CrossRef] [PubMed]
- Mohammadinejad, R.; Moosavi, M.A.; Tavakol, S.; Vardar, D.Ö.; Hosseini, A.; Rahmati, M.; Dini, L.; Hussain, S.; Mandegary, A.; Klionsky, D.J. Necrotic, apoptotic and autophagic cell fates triggered by nanoparticles. Autophagy 2019, 15, 4–33. [Google Scholar] [CrossRef]
- Zhang, J.; Qin, X.; Wang, B.; Xu, G.; Qin, Z.; Wang, J.; Wu, L.; Ju, X.; Bose, D.D.; Qiu, F.; et al. Zinc oxide nanoparticles harness autophagy to induce cell death in lung epithelial cells. Cell Death Dis. 2017, 8, e2954. [Google Scholar] [CrossRef]
- Grootjans, S.; Vanden Berghe, T.; Vandenabeele, P. Initiation and execution mechanisms of necroptosis: An overview. Cell Death Differ. 2017, 24, 1184–1195. [Google Scholar] [CrossRef]
- Gabelova, A.; Kozics, K.; Kapka-Skrzypczak, L.; Kruszewski, M.; Sramkova, M. Nephrotoxicity: Topical issue. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2019, 845, 402988. [Google Scholar] [CrossRef]
- Chernousova, S.; Epple, M. Silver as antibacterial agent: Ion, nanoparticle, and metal. Angew. Chem. Int. Ed. Engl. 2013, 52, 1636–1653. [Google Scholar] [CrossRef]
- Rosenberg, M.; Visnapuu, M.; Vija, H.; Kisand, V.; Kasemets, K.; Kahru, A.; Ivask, A. Selective antibiofilm properties and biocompatibility of nano-ZnO and nano-ZnO/Ag coated surfaces. Sci. Rep. 2020, 10, 13478. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Jun, B.H. Silver Nanoparticles: Synthesis and Application for Nanomedicine. Int. J. Mol. Sci. 2019, 20, 865. [Google Scholar] [CrossRef]
- Raha, S.; Ahmaruzzaman, M. ZnO nanostructured materials and their potential applications: Progress, challenges and perspectives. Nanoscale Adv. 2022, 4, 1868–1925. [Google Scholar] [CrossRef]
- Grigore, M.E.; Biscu, E.R.; Holban, A.M.; Gestal, M.C.; Grumezescu, A.M. Methods of Synthesis, Properties and Biomedical Applications of CuO Nanoparticles. Pharmaceuticals 2016, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Verma, N.K.; Conroy, J.; Lyons, P.E.; Coleman, J.; O’Sullivan, M.P.; Kornfeld, H.; Kelleher, D.; Volkov, Y. Autophagy induction by silver nanowires: A new aspect in the biocompatibility assessment of nanocomposite thin films. Toxicol. Appl. Pharm. 2012, 264, 451–461. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, K.C.; Rippstein, P.; Tayabali, A.F.; Willmore, W.G. Mitochondrial Toxicity of Cadmium Telluride Quantum Dot Nanoparticles in Mammalian Hepatocytes. Toxicol. Sci. 2015, 146, 31–42. [Google Scholar] [CrossRef]
- Almansour, M.; Sajti, L.; Melhim, W.; Jarrar, B. Ultrastructural Hepatic Alterations Induced by 35 nm Zinc Oxide Nanoparticles. Nanosci. Nanotechnol. Lett. 2015, 7, 763–769. [Google Scholar] [CrossRef]
- Natarajan, V.; Wilson, C.L.; Hayward, S.L.; Kidambi, S. Titanium Dioxide Nanoparticles Trigger Loss of Function and Perturbation of Mitochondrial Dynamics in Primary Hepatocytes. PLoS ONE 2015, 10, e0134541. [Google Scholar] [CrossRef]
- Faas, M.M.; De Vos, P. Mitochondrial function in immune cells in health and disease. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165845. [Google Scholar] [CrossRef] [PubMed]
- Wilson, D.F. Oxidative phosphorylation: Regulation and role in cellular and tissue metabolism. J. Physiol. 2017, 595, 7023–7038. [Google Scholar] [CrossRef]
- Roland Benz, S.M. The molecular mechanism of action of the proton ionophore FCCP (carbonylcyanide p-trifluoromethoxyphenylhydrazone). Biophys. J. 1983, 41, 8. [Google Scholar]
- Vh, P. Uncouplers of rat-liver mitochondrial oxidative phosphorylation. Biochem. J. 1965, 97, 5. [Google Scholar]
- Guo, R.; Gu, J.; Zong, S.; Wu, M.; Yang, M. Structure and mechanism of mitochondrial electron transport chain. Biomed. J. 2018, 41, 9–20. [Google Scholar] [CrossRef] [PubMed]
- Cogliati, S.; Lorenzi, I.; Rigoni, G.; Caicci, F.; Soriano, M.E. Regulation of Mitochondrial Electron Transport Chain Assembly. J. Mol. Biol. 2018, 430, 4849–4873. [Google Scholar] [CrossRef] [PubMed]





| Primers | Sequence |
|---|---|
| D-Loop F | GGCTCTCAACTCCAGCATGT |
| D-Loop R | AGGACGAGGGAGGCTACAAT |
| G6PC F | CTGTCTTTGATTCCTGCCTCAT |
| G6PC R | GTGGCTGTGCAGACATTCAA |
| Nanomaterials | Size 1 | Size 2 | Zeta Potential |
|---|---|---|---|
| ZnO | 40–150 nm (TEM) | 129.5 ± 38.7 nm | −2.2 ± 0.6 |
| CuO | 10–50 nm (SEM) | 50.1 ± 10.9 nm | −29.6 ± 0.8 |
| Ag | 30 nm (TEM) | 30.3 ± 0.4 nm | −31.9 ± 3.0 |
| AgNW | 30 nm (SEM) | 245.1 ± 1.5 nm | −7.3 ± 1.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, C.; Jiang, Q.; Liu, Z.; Yang, J.; Zhang, J.; Zhang, S.; Xin, W. Effect of Sublethal Concentrations of Metal Nanomaterials on Cell Energy Metabolism. Toxics 2023, 11, 453. https://doi.org/10.3390/toxics11050453
Liang C, Jiang Q, Liu Z, Yang J, Zhang J, Zhang S, Xin W. Effect of Sublethal Concentrations of Metal Nanomaterials on Cell Energy Metabolism. Toxics. 2023; 11(5):453. https://doi.org/10.3390/toxics11050453
Chicago/Turabian StyleLiang, Chaoshuai, Qiuyao Jiang, Zhenzhen Liu, Jian Yang, Jie Zhang, Shuping Zhang, and Wei Xin. 2023. "Effect of Sublethal Concentrations of Metal Nanomaterials on Cell Energy Metabolism" Toxics 11, no. 5: 453. https://doi.org/10.3390/toxics11050453
APA StyleLiang, C., Jiang, Q., Liu, Z., Yang, J., Zhang, J., Zhang, S., & Xin, W. (2023). Effect of Sublethal Concentrations of Metal Nanomaterials on Cell Energy Metabolism. Toxics, 11(5), 453. https://doi.org/10.3390/toxics11050453

