Effect of Instant Controlled Pressure Drop (DIC) Treatment on the Detection of Nut Allergens by Real Time PCR
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Instantaneous Controlled Depressurization Treatment (DIC)
2.3. Binary Mixtures
2.4. DNA Extraction and Conventional PCR
2.5. Targets, Primer Design and Real-Time PCR Conditions
3. Results and Discussion
3.1. Effect of DIC Treatment on Hazelnut Detectability
3.2. Effect of DIC Treatment on Pistachio Detectability
3.3. Effect of DIC Treatment on Cashew Detectability
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Sicherer, S.H. Evaluation of Food Allergy. In Mount Sinai Expert Guides: Allergy and Clinical Immunology; Sampson, H.A., Ed.; Wiley: Hoboken, NJ, USA, 2015; pp. 132–139. [Google Scholar]
- Ojeda, P.; Sastre, J.; Jm, O.; Chivato, T. Alergólogica 2015: A National Survey on Allergic Diseases in the Adult Spanish Population. J. Investig. Allergol. Clin. Immunol. 2018, 28, 151–164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crespo, J.F.; James, J.M.; Fernandez-Rodriguez, C.; Rodriguez, J. Food allergy: Nuts and tree nuts. Br. J. Nutr. 2006, 96, 95–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flinterman, A.E.; Akkerdaas, J.H.; Knulst, A.C.; van Ree, R.; Pasmans, S.G. Hazelnut allergy: From pollen-associated mild allergy to severe anaphylactic reactions. Curr. Opin. Allergy Clin. Immunol. 2008, 8, 261–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mendes, C.; Costa, J.; Vicente, A.A.; Oliveira, M.B.P.P.; Mafra, I. Cashew Nut Allergy: Clinical Relevance and Allergen Characterisation. Clin. Rev. Allergy Immunol. 2016, 57, 1–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costa, J.; Silva, I.; Vicente, A.A.; Oliveira, M.B.P.P. Pistachio nut allergy: An updated overview. Crit. Rev. Food Sci. Nutr. 2019, 59, 546–562. [Google Scholar] [CrossRef] [Scilit]
- Cuadrado, C.; Sanchiz, A.; Vicente, F.; Ballesteros, I.; Linacero, R. Changes Induced by Pressure Processing on Immunoreactive Proteins of Tree Nuts. Molecules 2020, 25, 954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabanillas, B.; Maleki, S.J.; Rodríguez, J.; Burbano, C.; Muzquiz, M.; Jiménez, M.A.; Pedrosa, M.M.; Cuadrado, C.; Crespo, J.F. Heat and pressure treatments effects on peanut allergenicity. Food Chem. 2012, 132, 360–366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanga, S.K.; Raghavan, V. Processing Effects On Tree Nut Allergens: A Review. Crit. Rev. Food Sci. Nutr. 2016, 57, 3794–3806. [Google Scholar] [CrossRef] [Scilit]
- De la Cruz, S.; Lopez-Calleja, I.; Martin, R.; Gonzalez, I.; Alcocer, M.; Garcia, T. Recent advances in the detection of allergens in foods. In Food Allergens: Methods and Protocols, Methods in Molecular Biology; Lin, J., Alcocer, M., Eds.; Springer Science: Berlin, Gemany, 2017; Volume 1592, pp. 263–295. ISBN 978-1-4939-6923-4. [Google Scholar]
- Linacero, R.; Sanchiz, A.; Ballesteros, I.; Cuadrado, C. Application of real-time PCR for tree nut allergen detection in processed foods. Crit. Rev. Food Sci. Nutr. 2020, 60, 1077–1093. [Google Scholar] [CrossRef] [Scilit]
- Hird, H.; Chisholm, J.; Sanchez, A.; Hernandez, M.; Goodier, R.; Schneede, K.; Boltz, C.; Popping, B. Effect of heat and pressure processing on DNA fragmentation and implications for the detection of meat using a real-time polymerase chain reaction. Food Addit. Contam. 2006, 23, 645–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Vanga, S.K.; McCusker, C.; Raghavan, V. A Comprehensive Review on Kiwifruit Allergy: Pathogenesis, Diagnosis, Management, and Potential Modification of Allergens Through Processing. Compr. Rev. Food Sci. Food Saf. 2019, 18, 500–513. [Google Scholar] [CrossRef] [Scilit]
- Cabanillas, B.; Novak, N. Effects of daily food processing on allergenicity. Crit. Rev. Food Sci. Nutr. 2019, 59, 31–42. [Google Scholar] [CrossRef] [Scilit]
- Sanchiz, A.; Cuadrado, C.; Dieguez, M.C.; Ballesteros, I.; Rodriguez, J.; Crespo, J.F.; de las Cuevas, N.; Rueda, J.; Linacero, R.; Cabanillas, B.; et al. Thermal processing effects on cashew and pistachio allergenicity. Food Chem. 2018, 245, 595–602. [Google Scholar] [CrossRef] [Scilit]
- Cuadrado, C.; Cheng, H.; Sanchiz, Á.; Ballesteros, I.; Easson, M.; Grimm, C.C.; del Dieguez, M.C.; Linacero, R.; Burbano, C.; Maleki, S.J. Influence of enzymatic hydrolysis on the allergenic reactivity of processed cashew and pistachio. Food Chem. 2018, 241, 372–379. [Google Scholar] [CrossRef] [Scilit]
- Haddad, J.; Louka, N.; Gadouleau, M.; Juhel, F.; Allaf, K. Application du nouveau procédé de séchage/texturation par Détente Instantanée Contrôlée DIC aux poissons: Impact sur les caractéristiques physico-chimiques du produit fini. Sci. Aliment. 2001, 21, 481–498. [Google Scholar] [CrossRef] [Scilit]
- Guillamón, E.; Burbano, C.; Cuadrado, C.; Muzquiz, M.; Pedrosa, M.M.; Sánchez, M.; Cabanillas, B.; Crespo, J.F.; Rodriguez, J.; Haddad, J.; et al. Effect of an instantaneous controlled pressure drop on in vitro allergenicity to lupins (Lupinus albus var Multolupa). Int. Arch. Allergy Immunol. 2008, 145, 9–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cuadrado, C.; Cabanillas, B.; Pedrosa, M.M.; Muzquiz, M.; Haddad, J.; Allaf, K.; Rodriguez, J.; Crespo, J.F.; Burbano, C. Effect of instant controlled pressure drop on IgE antibody reactivity to peanut, lentil, chickpea and soybean proteins. Int. Arch. Allergy Immunol. 2011, 156, 397–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iniesto, E.; Jimenez, A.; Prieto, N.; Cabanillas, B.; Burbano, C.; Pedrosa, M.M.; Rodriguez, J.; Muzquiz, M.; Crespo, J.F.; Cuadrado, C.; et al. Real Time PCR to detect hazelnut allergen coding sequences in processed foods. Food Chem. 2013, 138, 1976–1981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchiz, A.; Ballesteros, I.; Martin, A.; Rueda, J.; Pedrosa, M.M.; del Dieguez, M.C.; Rovira, M.; Cuadrado, C.; Linacero, R. Detection of pistachio allergen coding sequences in food products: A comparison of two real time PCR approaches. Food Control 2017, 75, 262–270. [Google Scholar] [CrossRef] [Scilit]
- Sanchiz, A.; Ballesteros, I.; Marqués, E.; Dieguez, M.C.; Rueda, J.; Cuadrado, C.; Linacero, R. Evaluation of locked nucleic acid and TaqMan probes for specific detection of cashew nut in processed food by real time PCR. Food Control 2018, 89, 227–234. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A. Why the need for qPCR publication guidelines?-The case for MIQE. Methods 2010, 50, 217–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Villa, C.; Costa, J.; Gondar, C.; Oliveira, M.B.P.P.; Mafra, I. Effect of food matrix and thermal processing on the performance of a normalised quantitative real-time PCR approach for lupine (Lupinus albus) detection as a potential allergenic food. Food Chem. 2018, 262, 251–259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez, E.; Cuadrado, C.; Burbano, C.; Jimenez, M.A.; Rodriguez, J.; Crespo, J.F. Effects of autoclaving and high pressure on allergenicity of hazelnut proteins. J. Clin. Bioinform. 2012, 2, 2043–9113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vicente, F.; Sanchiz, A.; Rodríguez-Pérez, R.; Pedrosa, M.; Quirce, S.; Haddad, J.; Besombes, C.; Linacero, R.; Allaf, K.; Cuadrado, C. Influence of instant controlled pressure drop (DIC) on allergenic potential of tree nuts. Molecules 2020, 25, 1742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bustin, S.A.; Beaulieu, J.F.; Huggett, J.; Jaggi, R.; Kibenge, F.S.B.; Olsvik, P.A.; Penning, L.C.; Toegel, S. MIQE précis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments. BMC Mol. Biol. 2010, 11. [Google Scholar] [CrossRef] [Scilit]
- Prieto, N.; Iniesto, E.; Burbano, C.; Cabanillas, B.; Pedrosa, M.M.; Rovira, M.; Rodríguez, J.; Muzquiz, M.; Crespo, J.F.; Cuadrado, C.; et al. Detection of almond allergen coding sequences in processed foods by real time PCR. J. Agric. Food Chem. 2014, 62, 5617–5624. [Google Scholar] [CrossRef] [Scilit]
- Linacero, R.; Ballesteros, I.; Sanchiz, Á.; Prieto, N.; Elisa, I.; Martinez, Y.; Pedrosa, M.; Muzquiz, M.; Cabanillas, B.; Rovira, M.; et al. Detection by Real Time PCR of Walnut Allergen Coding Sequences in Processed Foods. Food Chem. 2016, 202, 334–340. [Google Scholar] [CrossRef] [Scilit]
- Sanchiz, A.; Ballesteros, I.; López-García, A.; Ramírez, A.; Rueda, J.; Cuadrado, C.; Linacero, R. Chestnut allergen detection in complex food products: Development and validation of a real-time PCR method. LWT-Food Sci. Technol. 2020, 123, 109067. [Google Scholar] [CrossRef] [Scilit]
- Boughellout, H.; Choiset, Y.; Rabesona, H.; Chobert, J.M.; Haertle, T.; Mounir, S.; Allaf, K.; Zidoune, M.N. Effect of instant controlled pressure drop (DIC) treatment on milk protein’s immunoreactivity. Food Agric. Immunol. 2015, 26, 71–81. [Google Scholar] [CrossRef] [Scilit]
- Takács, K.; Guillamon, E.; Pedrosa, M.M.; Cuadrado, C.; Burbano, C.; Muzquiz, M.; Haddad, J.; Allaf, K.; Maczó, A.; Polgár, M.; et al. Study of the effect of instant controlled pressure drop (DIC) treatment on IgE-reactive legume-protein patterns by electrophoresis and immunoblot. Food Agric. Immunol. 2014, 25, 173–185. [Google Scholar] [CrossRef] [Scilit]








| Nut | Name | Sequence (5′→3′) | Final Concentration (nM) | Length (Bases) | Amplicon Size |
|---|---|---|---|---|---|
| Hazelnut | Cor a 9 fw | GTCAAAGTGGAAGGCAGGCTT | 250 | 21 | 101 |
| Cor a 9 rv | TCCCGCTCTTGCTCACTCTC | 250 | 20 | ||
| Cor a 9 probe | 6FAM-ATGGGAGCGACAGGAGAGACAAGAG-BHQ1 | 100 | 26 | ||
| Pistachio | Pis v 1 fw | GGCAAAGCTCGTACTTCTCCT | 250 | 21 | 81 |
| Pis v 1 rv | TCCACAGTAGCGCGGTAGAT | 250 | 20 | ||
| Pis v 1 probe | 6FAM-GACGGAAG-BHQ1 | 100 | 8 | ||
| Cashew | Ana o 1 fw | AGAAAGGACGGGAACGAGAG | 250 | 20 | 65 |
| Ana o 1 rv | TTCATCAACGCCACCAGTT | 250 | 19 | ||
| Ana o 1 probe | 6FAM-ATGAGGAGGAAGAAGAAGAATGGG-BHQ1 | 100 | 24 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sanchiz, A.; Cuadrado, C.; Haddad, J.; Linacero, R. Effect of Instant Controlled Pressure Drop (DIC) Treatment on the Detection of Nut Allergens by Real Time PCR. Foods 2020, 9, 729. https://doi.org/10.3390/foods9060729
Sanchiz A, Cuadrado C, Haddad J, Linacero R. Effect of Instant Controlled Pressure Drop (DIC) Treatment on the Detection of Nut Allergens by Real Time PCR. Foods. 2020; 9(6):729. https://doi.org/10.3390/foods9060729
Chicago/Turabian StyleSanchiz, Africa, Carmen Cuadrado, Joseph Haddad, and Rosario Linacero. 2020. "Effect of Instant Controlled Pressure Drop (DIC) Treatment on the Detection of Nut Allergens by Real Time PCR" Foods 9, no. 6: 729. https://doi.org/10.3390/foods9060729
APA StyleSanchiz, A., Cuadrado, C., Haddad, J., & Linacero, R. (2020). Effect of Instant Controlled Pressure Drop (DIC) Treatment on the Detection of Nut Allergens by Real Time PCR. Foods, 9(6), 729. https://doi.org/10.3390/foods9060729

