Development and Application of InDel Markers for Authentication of the Korean Herbs Zanthoxylum schinifolium and Zanthoxylum piperitum
Abstract
:1. Introduction
2. Materials and Methods
2.1. Comparison of Cp Genomes and Identification of Hypervariable Loci
2.2. Sample Collection and Genomic DNA Isolation
2.3. Development and Validation of the InDel Molecular Marker
2.4. RFLP Analysis to Identify Suitable InDel Markers
3. Results
3.1. Comparative Analysis of the Cp Genomes of Various Zanthoxylum Species
3.2. Development of InDel Markers to Discriminate between Z. Schinifolium and Z. Piperitum
3.3. Utilization of InDel Markers in the Korean Food Market
4. Discussion
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Sun, X.W.; Duan, Z.X. Progress in the studies on medicinal plants of the genus Zanthoxylum Linn. Yao xuexuebao Acta Pharm. Sin. 1996, 31, 231–240. [Google Scholar]
- Epifano, F.; Curini, M.; Carla Marcotullio, M.; Genovese, S. Searching for novel cancer chemopreventive plants and their products: The genus Zanthoxylum. Curr. Drug Targets 2011, 12, 1895–1902. [Google Scholar] [CrossRef] [PubMed]
- Arun, K.; Paridhavi, M. An ethno botanical phytochemical and pharmacological utilization of widely distributed species Zanthoxylum: A comprehensive overview. Int. J. Pharm. Invent. 2012, 2, 24–35. [Google Scholar]
- Patiño, L.O.J.; Prieto, R.J.A.; Cuca, S.L.E. Zanthoxylum genus as potential source of bioactive compounds. Bioact. Compd. Phytomed. InTech 2012, 185–218. [Google Scholar] [CrossRef] [Green Version]
- Appelhans, M.S.; Reichelt, N.; Groppo, M.; Paetzold, C.; Wen, J. Phylogeny and biogeography of the pantropical genus Zanthoxylum and its closest relatives in the proto-Rutaceae group (Rutaceae). Mol. Phylogenet. Evol. 2018, 126, 31–44. [Google Scholar] [CrossRef]
- Negi, J.S.; Bisht, V.K.; Bh, A.K.; Singh, P.; Sundriyal, R.C. Chemical constituents and biological activities of the genus Zanthoxylum: A review. Afr. J. Pure Appl. Chem. 2011, 5, 412–416. [Google Scholar]
- Supabphol, R.; Tangjitjareonkun, J. Chemical constituents and biological activities of Zanthoxylum limonella (Rutaceae): A review. Trop. J. Pharm. Res. 2014, 13, 2119–2130. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.; Jeong, C.H.; Bae, Y.I.; Shim, K.H. Chemical components of Zanthoxylum schinifolium and Zanthoxylum piperitum leaves. Korean J. Food Preserv. 2000, 7, 189–194. [Google Scholar]
- Ko, Y.S.; Han, H.J. Chemical constituents of Korean chopi (Zanthoxylum piperitum) and sancho (Zanthoxylum schinifolium). Korean J. Food Sci. Technol. 1996, 28, 19–27. [Google Scholar]
- Yang, X. Aroma constituents and alkylamides of red and green huajiao (Zanthoxylum bungeanum and Zanthoxylum schinifolium). J. Agric. Food Chem. 2008, 56, 1689–1696. [Google Scholar] [CrossRef]
- Lee, T.B. Coloured Flora of Korea; Hyangmunsa: Seoul, Korea, 2003; Volume 1. [Google Scholar]
- Chung, T.H. Korean Flora; Shinjisa: Seoul, Korea, 1957; p. 1025. (in Korean) [Google Scholar]
- Nakai, T. Notulæ and PlantasJaponiæ&Koreæ XXXIX. ShokubutsugakuZasshi 1930, 44, 507–537. [Google Scholar]
- Gupta, D.D.; Mandi, S.S. Species specific AFLP markers for authentication of Zanthoxylum acanthopodium & Zanthoxylum oxyphyllum. J. Med. Plants 2013, 6, 1–9. [Google Scholar]
- Feng, S.; Yang, T.; Liu, Z.; Chen, L.; Hou, N.; Wang, Y.; Wei, A. Genetic diversity and relationships of wild and cultivated Zanthoxylum germplasms based on sequence-related amplified polymorphism (SRAP) markers. Genet. Resour. Crop Evol. 2015, 62, 1193–1204. [Google Scholar] [CrossRef]
- Kim, W.J.; Ji, Y.; Lee, Y.M.; Kang, Y.M.; Choi, G.; Moon, B.C. Development of Molecular Markers for the authentication of Zanthoxyli Pericarpium by the analysis of rDNA-ITS DNA barcode regions. Korea J. Herbol. 2015, 30, 41–47. [Google Scholar] [CrossRef]
- Feng, S.; Yang, T.; Li, X.; Chen, L.; Liu, Z.; Wei, A. Genetic relationships of Chinese prickly ash as revealed by ISSR markers. Biologia 2015, 70, 45–51. [Google Scholar] [CrossRef]
- Lee, J.; Lee, H.J.; Kim, K.; Lee, S.C.; Sung, S.H.; Yang, T.J. The complete chloroplast genome sequence of Zanthoxylum piperitum. Mitochondrial DNA Part A 2016, 27, 3525–3526. [Google Scholar] [CrossRef]
- Liu, Y.; Wei, A. The complete chloroplast genome sequence of an economically important plant, Zanthoxylum bungeanum (Rutaceae). Conserv. Genet. Resour. 2017, 9, 25–27. [Google Scholar] [CrossRef]
- Lee, H.J.; Koo, H.J.; Lee, J.; Lee, S.C.; Lee, D.Y.; Giang, V.N.L.; Kim, M.; Shim, H.; Park, J.Y.; Yoo, K.O.; et al. Authentication of Zanthoxylum species based on integrated analysis of complete chloroplast genome sequences and metabolite profiles. J. Agric. Food Chem. 2017, 65, 10350–10359. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Librado, P.; Rozas, J. DnaSPv5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [Green Version]
- Yan-Lin, S.; Wan-Geun, P.; Oh-Woung, K.; Soon-Kwan, H. The internal transcribed spacer rDNA specific markers for identification of Zanthoxylum piperitum. Afr. J. Biotechnol. 2010, 9, 6027–6039. [Google Scholar]
- Feng, S.; Liu, Z.; Chen, L.; Hou, N.; Yang, T.; Wei, A. Phylogenetic relationships among cultivated Zanthoxylum species in China based on cpDNA markers. Tree Genet. Genomes 2016, 12, 45. [Google Scholar] [CrossRef]
- Zhao, L.L.; Feng, S.J.; Tian, J.Y.; Wei, A.Z.; Yang, T.X. Internal transcribed spacer 2 (ITS 2) barcodes: A useful tool for identifying Chinese Zanthoxylum. Appl. Plant Sci. 2018, 6, e01157. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.; Liu, J.; Yu, J.; Wang, L.; Zhou, S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS ONE 2012, 7, e35071. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Yang, Y.; Henry, R.J.; Rossetto, M.; Wang, Y.; Chen, S. Plant DNA barcoding: From gene to genome. Biol. Rev. 2015, 90, 157–166. [Google Scholar] [CrossRef]
- Kress, W.J.; Erickson, D.L. A two-locus global DNA barcode for land plants: The coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2007, 2, e508. [Google Scholar] [CrossRef] [Green Version]
- Whitlock, B.A.; Hale, A.M.; Groff, P.A. Intraspecific inversions pose a challenge for the trnH-psbA plant DNA barcode. PLoS ONE 2010, 5, e11533. [Google Scholar] [CrossRef] [Green Version]
No. | Species | Research Group | GenBank Accession Number | Sequence Length (bp) |
---|---|---|---|---|
1 | Z. schinifolium | Crop Science and Biotechnology, Department of Plant Sciences, Seoul National University, Korea | KT321318 | 158,963 |
2 | Z. piperitum | KT153018 | 158,154 | |
3 | Z. simulans | College of Forestry, Northwest A&F University, China | MF716524 | 158,461 |
4 | Z. sp. | MF716521 | 158,572 |
No. | Scientific Name | Common Name | Collection Site | Collection Number |
---|---|---|---|---|
1 | Zanthoxylum schinifolium | Sanchonamu | Hyogok-ri, Ganjeon-myeon, Gurye-gun, Jeollanam-do, Korea | NIBRVP0000278863 |
2 | Galcheon-ri, Seo-myeon, Yangyang-gun, Gangwon-do, Korea | NIBRVP0000448009 | ||
3 | Daebubuk-dong, Danwon-gu, Ansan-si, Gyeonggi-do, Korea | NIBRVP0000538396 | ||
4 | Wondeok-ri, Jincheon-eup, Jincheon-gun, Chungcheongbuk-do, Korea | NIBRVP0000538545 | ||
5 | Sucheol-ri, Punggi-eup, Yeongju-si, Gyeongsangbuk-do, Korea | NIBRVP0000538696 | ||
6 | Cheongsu-ri, Hangyeong-myeon, Jeju-si, Jeju-do, Korea | NIBRVP0000538748 | ||
7 | Gujora-ri, Irun-myeon, Geoje-si, Gyeongsangnam-do, Korea | NIBRVP0000538812 | ||
8 | Zanthoxylum piperitum | Chopinamu | Hangyeong-myeon, Jeju-si, Jeju-do, Korea | NIBRVP0000354345 |
9 | Guseong-ri, Jugwang-myeon, Goseong-gun, Gangwon-do, Korea | NIBRVP0000470134 | ||
10 | Seongu-ri, Onjeong-myeon, Uljin-gun, Gyeongsangbuk-do, Korea | NIBRVP0000538333 | ||
11 | Jungjang-ri, Anmyeon-eup, Taean-gun, Chungcheongnam-do, Korea | NIBRVP0000538652 | ||
12 | Cheongsu-ri, Hangyeong-myeon, Jeju-si, Jeju-do, Korea | NIBRVP0000538652 | ||
13 | Husapo-ri, Bubuk-myeon, Miryang-si, Gyeongsangnam-do, Korea | NIBRVP0000538646 |
No. | Markets | Material Component | Origin |
---|---|---|---|
1 | A | Dried or powdered seeds and pericarps: sancho products (50–300g) | China |
2 | B | China | |
3 | C | China | |
4 | D | Korea | |
5 | E | China | |
6 | F | China | |
7 | G | China | |
8 | H | China | |
9 | I | Korea | |
10 | J | Korea | |
11 | K | Dried or powdered seeds and pericarps: chopi products (20–300g) | Korea |
12 | L | Korea | |
13 | M | Korea | |
14 | N | Korea | |
15 | O | Korea | |
16 | P | Korea |
Marker Name | Locus | Location | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Product Range (bp) | Mean Pairwise Distance |
---|---|---|---|---|---|---|
ZanID1 | trnH-psbA | 35..578 | GATTCACAATCCACTGCCTTGAT | GCTCATAACTTCCCTCTAGACCT | 513–533 | 0.02833 |
ZanID2 | psbZ-trnG | 38882..39545 | GTGGGTATCCTTAATTCTCTCATC | GATACTCTCTTCAGGGTAATTCCA | 547–662 | 0.05067 |
ZanID3 | trnfM-rps14 | 39040..39730 | GGAGGGATCAAACTTCTGGAAC | AGAACCACTATACTATCACGGTCA | 576–691 | 0.05367 |
ZanID4 | trnF-ndhK | 51439..52158 | GATTTGAGCAAGGAATCCCCATTTG | TCTTCATTTTGACCCGATATTCAA | 573–712 | 0.02667 0.03133 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.; Shin, J.; Cho, S.-S.; Hwang, Y.-P.; Choi, C. Development and Application of InDel Markers for Authentication of the Korean Herbs Zanthoxylum schinifolium and Zanthoxylum piperitum. Foods 2019, 8, 658. https://doi.org/10.3390/foods8120658
Kim Y, Shin J, Cho S-S, Hwang Y-P, Choi C. Development and Application of InDel Markers for Authentication of the Korean Herbs Zanthoxylum schinifolium and Zanthoxylum piperitum. Foods. 2019; 8(12):658. https://doi.org/10.3390/foods8120658
Chicago/Turabian StyleKim, Yonguk, Jawon Shin, Seung-Sik Cho, Yong-Pil Hwang, and Chulyung Choi. 2019. "Development and Application of InDel Markers for Authentication of the Korean Herbs Zanthoxylum schinifolium and Zanthoxylum piperitum" Foods 8, no. 12: 658. https://doi.org/10.3390/foods8120658