Next Article in Journal
Effect of an Anti-Listeria Whey Protein-Based Edible Coating Activated with Bacteriophage on Quality Attributes and Consumer Perception of Sicilian Canestrato Fresco Cheese
Next Article in Special Issue
Protective Effects of Licochalcone A Against Alcoholic Liver Injury in Mice by Modulating the Gut–Liver Axis and TLR4/NF-κB Pathway
Previous Article in Journal
Decoding the Microbial Diversity of Indian Fermented Foods: Integrating Ethnobiology, Multi-Omics and Functional Insights
Previous Article in Special Issue
The Impact of Adding Sunflower Seed Oil Bodies to a Sugar-Free Plant-Based Ice Cream Formulation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 15
Issue 4
10.3390/foods15040688
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Anti-Inflammatory Effect of Finger Citron Extract on RAW264.7 Macrophages via NF-κB and MAPK Signaling Pathways

by
Jiateng Hu
1,2,†,
Yuanshan Yu
1,2,†,
Ying Tang
1,
Zhibin Bu
1,
Yujuan Xu
1,3,
Jijun Wu
1,3,
Gengsheng Xiao
3 and
Bo Zou
1,*
1
Sericultural & Agri-Food Research Institute, Guangdong Academy of Agricultural Sciences, Key Laboratory of Functional Foods, Ministry of Agriculture and Rural Affairs, Guangdong Key Laboratory of Agricultural Products Processing, Dong Guanzhuang Yiheng RD, Tianhe District, Guangzhou 510640, China
2
College of Food Science and Technology, South China University of Technology, Guangzhou 510640, China
3
College of Food Science and Technology, Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Foods 2026, 15(4), 688; https://doi.org/10.3390/foods15040688
Submission received: 9 January 2026 / Revised: 4 February 2026 / Accepted: 11 February 2026 / Published: 13 February 2026
(This article belongs to the Special Issue Bioactive Compounds from Plants as Functional Food Ingredients and Potential Nutraceuticals)
Browse Figures
Review Reports Versions Notes

Abstract

Finger Citron (Citrus medica L. var. sarcodactylis Swingle) holds significant potential as both a culinary ingredient and a traditional medicinal remedy; however, its precise molecular mechanisms of action remain largely unexplored. This study investigates the anti-inflammatory properties of Finger Citron extract (FCE) in RAW 264.7 macrophages stimulated by lipopolysaccharide (LPS). Using UPLC-ESI-QTF-MS, we analyzed the extract’s composition, revealing a rich presence of polyphenols and polysaccharides, with hesperidin, melitidin, and hesperetin as the predominant polyphenolic compounds. Additionally, the study elucidated the monosaccharide composition profile of polysaccharides in the extract. Furthermore, Finger Citron extract markedly suppressed the production of key inflammatory mediators, including TNF-α, IL-6, and NO. The inhibition of protein phosphorylation levels of inhibiting the mitogen-activated protein kinase (MAPK) and nuclear factor kappa-B (NF-κB) signaling was also observed, indicating that the anti-inflammatory effects of Finger Citron extract may involve the NF-κB and MAPK signaling pathway. Given these findings, Finger Citron extract has the potential to act as a natural product with anti-inflammatory activity.

Graphical Abstract

1. Introduction

Inflammation is a ubiquitous defense and healing process of biological tissues against unpleasant stimuli (e.g., irritants, damaged cells) and microbial invaders (e.g., infectious pathogens) [1]. It is crucial to highlight that inflammation may develop even without the presence of infection or significant tissue injury due to tissue dysfunction and stress [2]. Inflammation, especially long-term or chronic types of inflammation, is strongly associated with the pathogenesis of numerous diseases, which include, but are not limited to, hay fever, cancer, allergic reactions, type II diabetes mellitus, osteoarthritis, periodontal disease, abnormalities of lipid metabolism, inflammatory bowel disease, chronic obstructive pulmonary disease, and neurological-related disorders [3,4,5]. During inflammation, a diverse array of inflammatory mediators, including chemokines, cytokines, and reactive oxygen species (ROS)—like nitric oxide (NO), tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and inducible nitric oxide synthase (iNOS)—as well as different immune cells, become activated and contribute to the response [6]. The nuclear factor-κB (NF-κB) signaling pathway is a crucial mechanism in the control of inflammation and immunological responses, particularly innate immune responses, and it interacts closely with intracellular signaling pathways, such as the mitogen-activated protein kinase (MAPK) pathway [7,8]. Under inflammatory conditions, activation of two inflammatory signaling pathways, NF-κB and MAPK, leads to the release of pro-inflammatory cytokines, which in turn exacerbate the inflammatory response. Beyond internal triggers, MAPK—specifically the p38 isoform—is highly sensitive to exogenous stressors. Given its pivotal influence on cellular homeostasis, the p38 pathway is frequently cited as a high-value pharmacological target for mitigating chronic inflammation [9,10]. Reducing the inflammatory response is consequently of critical importance in maintaining local and systemic homeostasis, as well as in maintaining human health.
Macrophages play a crucial role in defending the host against foreign pathogens. Upon stimulation, such as by lipopolysaccharide (LPS), macrophages become activated and subsequently produce ROS, pro-inflammatory cytokines, and other inflammatory mediators [11]. Within these biological environments, NO frequently interacts with superoxide anions, a process that triggers nitrosative stress and the subsequent generation of reactive nitrogen species (RNS). This molecular interplay disrupts redox equilibrium, further fueling the cycle of inflammation. Because oxidative stress and inflammatory pathways are inextricably linked, clinical management of these conditions necessitates the rigorous tracking of radical concentrations and immune markers. Natural derivatives, specifically polyphenols and complex carbohydrates, demonstrate potent suppressive effects on inflammation by recalibrating enzymatic functions and cellular signaling while neutralizing oxidative damage [12].
Finger Citron (Citrus medica L. var. sarcodactylis Swingle), also commonly known as Ten Fingers Mandarin, Five Fingers Mandarin, Five Fingers Citron, or Honeyloaf Mandarin, is rich in essential nutrients and bioactive compounds, including phenolic compounds (such as flavonoids), polysaccharides, coumarins, and essential oils [13,14]. These bioactive constituents have demonstrated significant biological effects, including anti-inflammatory, antioxidant, anticancer, indigestion-relieving, and fatty liver-preventing properties [15]. Previous studies on Finger Citron have predominantly focused on extraction techniques, structural characterization, antioxidant activities of different plant parts, and immunomodulatory functions [16]. For instance, Tan et al. [17] investigated the chemical composition and antioxidant capacity of Finger Citron at different growth stages; Wu et al. [18] isolated and characterized the ZFP2 polysaccharide from Finger Citron and evaluated its effects on lipid metabolism; and Luo et al. [19] examined the anti-glycation and anti-aging activities of bergapten derived from Finger Citron. However, the molecular mechanisms underlying the anti-inflammatory effects of Finger Citron have not yet been fully clarified. Therefore, the present study aimed to explore the anti-inflammatory mechanisms of these compounds. The active ingredients were extracted from Finger Citron using a methanol solution and analyzed in detail through ultra-performance liquid chromatography-electrospray ionization-quadrupole time-of-flight mass spectrometry (UPLC-ESI-Q-TOF-MS). Based on these analyses, the study further investigated the anti-inflammatory effects of Finger Citron’s active ingredients and their potential molecular mechanisms.

2. Materials and Methods

2.1. Materials and Chemicals

Finger Citron was purchased from a local wholesale market. Gallic acid, p-coumaric acid, rutin, naringin, hesperidin, rhoifolin, melitidin, and hesperetin were obtained from Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Mass spectrometry (MS)-grade acetonitrile, methanol, and formic acid were purchased from Merck (Darmstadt, Germany). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), penicillin-streptomycin solution, and trypsin were bought from Gibco Life Technologies (Carlsbad, CA, USA). Antibodies against NFκB p65, NFκB p-p65, IκBα, p-IκBα, ERK, p-ERK, MAPK p38, MAPK p-p38, JNK, p-JNK, and β-actin were acquired from Abcam (Cambridge, UK). Commercial kits for the determination of TNF-α, IL-6, NO, and BCA were provided by Beyotime Biotechnology (Shanghai, China).

2.2. Preparation of FCE

The fresh Finger Citron was blended with twice its weight in water using a mechanical juicer and subsequently sterilized in an autoclave at 100 °C for 4 min. Following sterilization, the pulp was mixed with 80% (v/v) methanol in a 1:5 (w/v) ratio and subjected to ultrasonic treatment for 30 min. After ultrasonic treatment, the mixture was centrifuged to collect the supernatant, and the remaining residue was extracted twice more. All supernatants from the three extractions were combined. Finally, the combined extracts were concentrated under vacuum at 40 °C and lyophilized for subsequent experiments.

2.3. Phenolic Compounds Determination

The quantification of the total phenolic content (TPC) within the FCE was executed following established protocols, employing gallic acid as the reference standard [20]. To characterize the phenolic profile, an ekspertTM ultra LC 110 system equipped with a Triple TOF 5600 mass spectrometer (SCIEX, Concord, ON, Canada) was utilized. Separation was achieved on an Agilent SB-C18 column (1.8 μm, 100 mm × 2.1 mm, Agilent, Santa Clara, CA, USA), utilizing a binary solvent system of 0.1% formic acid in water (A) and acetonitrile (B). The gradient progressed from 5% to 95% B over 9 min, followed by a high-organic wash and re-equilibration. We maintained the column at 30 °C with a 0.3 mL/min flow and a 4 μL injection. Mass spectrometry was operated in dual-ion mode (100–1000 m/z) with an ion spray voltage of 5.5 kV and a source temperature of 550 °C.
For subsequent quantitative validation, an HPLC-PDA system (LC-20AT, Shimadzu, Kyoto, Japan) was employed with a Waters XBridge C18 column (5 μm, 4.6 × 250 mm). The mobile phase consisted of acidified water and acetonitrile, following a multi-step gradient reaching 50% B at the 50-minute mark. Detection was monitored across 200–800 nm, specifically focusing on peaks at 280, 320, and 360 nm, with a flow rate of 0.3 mL/min and 10 μL sample loading.

2.4. Total Saccharide Content, Monosaccharide Composition and Molecular Weight (Mw) Determination

To determine the total saccharide content, 10 g of FCE was prepared by extracting with water (1:30, m/v) at 90 °C for 2 h. The mixture was then centrifuged at 6000 rpm for 5 min, and the supernatant was collected and concentrated under vacuum at 50 °C to a final volume of 100 mL. The extract was deproteinized using the Sevag method [21]. The crude polysaccharide solution was then combined with cold anhydrous ethanol to achieve an 80% (v/v) saturation, followed by a 12-h incubation at 4 °C. The resulting precipitate was harvested, rinsed twice with 80% ethanol, and subjected to vacuum desiccation at 50 °C. Total saccharide quantification was performed via the phenol-sulfuric acid colorimetric assay, adopting D-glucose as the calibration standard [22].
For monosaccharide profiling, the extract underwent acid-promoted hydrolysis using trifluoroacetic acid (TFA) at 110 °C for a duration of 5 h within sealed glass ampoules. Post-hydrolysis, residual TFA was eliminated through nitrogen-assisted evaporation with methanol. The liberated sugars were subsequently derivatized with 1-phenyl-3-methyl-5-pyrazolone (PMP) and purified. The final filtrate (0.22 μm) was analyzed using a Shimadzu LC-20AT HPLC (Kyoto, Japan) system equipped with a PDA detector [23].
The weight-average molecular weight (Mw) was characterized via high-performance gel permeation chromatography (HPGPC) according to established protocols [23]. Briefly, 5 mg of the extract was reconstituted in 0.05 mol/L NaCl and passed through a 0.22 μm membrane. Analysis was conducted on a Waters 2695 platform utilizing tandem TSK-gel columns (G-5000PWXL, 300 × 7.8 mm, 10 μm, and G-3000PWXL, 300 × 7.8 mm, 6 μm) and a 2414 differential refractive index detector. Elution was performed with a 0.05 mol/L NaCl mobile phase at 1 mL/min, maintaining a constant column temperature of 40 °C.

2.5. Cell Culture

Murine RAW 264.7 macrophages were sourced from the Cell Biology Institute of the Chinese Academy of Sciences (Shanghai, China). Culture maintenance was performed using DMEM medium enriched with 10% FBS and a standard antibiotic cocktail (100 U/mL penicillin and 100 μg/mL streptomycin). The cellular environment was strictly regulated at 37 °C within a humidified incubator containing 5% CO2 and 95% atmospheric air.

2.6. Cell Viability

The metabolic activity of RAW 264.7 cells was evaluated via the MTT colorimetric assay, following established protocols [24]. Macrophages were initially plated in 96-well blocks at 5 × 104 and allowed to adhere for 24 h at 37 °C. The culture medium was then replaced with 100 μL of FCE at concentrations spanning 150 to 750 μg/mL. For comparison, a negative control group received only DMEM, while the positive control was challenged with 10 μg/mL of LPS. Each experimental condition was performed in sextuplicate. Following a 24-h treatment period, 10 μL of MTT reagent was introduced to each well for a 4-h incubation. The resulting formazan crystals were solubilized in DMSO after the supernatant was discarded. Finally, optical density was quantified at 570 nm utilizing a BioTek (Winooski, VT, USA) microplate reader.

2.7. NO, TNF-α and IL-6 Determination

RAW264.7 macrophages in the exponential phase were harvested and equilibrated to a density of 1 × 106 cells/mL, with 2 mL of the suspension seeded into each well of 6-well plates. Following a 24-h stabilization period at 37 °C under 5% CO2, the original medium was discarded. After removal of the culture medium, cells in the experimental groups were pretreated with 0.75 mL of FCE at different concentrations (final concentrations of 150, 300, 500, and 750 μg/mL) for 1 h, followed by the introduction of 0.75 mL LPS to reach a terminal concentration of 10 μg/mL. Conversely, the blank control was replenished with an equal volume of basal medium, while the model group was stimulated solely with LPS (final concentration: 10 μg/mL).
Post-incubation, the conditioned media were harvested, partitioned into aliquots, and preserved at −80 °C. NO production was quantified via the Griess diazotization reaction. Briefly, 50 μL of supernatant was reacted sequentially with Griess Reagents I and II in a 96-well format, and the optical density was recorded at 540 nm. Pro-inflammatory cytokines (TNF-α and IL-6) were assayed utilizing commercial ELISA kits in strict accordance with the manufacturer’s protocols to evaluate their secretion profiles.

2.8. Real-Time RT-PCR

Following the cellular interventions detailed in Section 2.7, total RNA was isolated utilizing the Trizol method (Invitrogen, Carlsbad, CA, USA). The structural integrity of the harvested RNA was corroborated via agarose gel electrophoresis. Reverse transcrition was subsequently executed to synthesize complementary DNA (cDNA) using a specialized kit (Toyobo, Osaka, Japan), employing oligonucleotide primers custom-synthesized by Sangon Biotech (Shanghai, China; sequences listed in Table 1).
Quantitative real-time PCR was conducted on an Applied Biosystems ViiATM 7 platform (ABI, Foster City, CA, USA) incorporating AceQ qPCR SYBR® Green Master Mix (Nanjing, China), adhering to the methodology established Yin et al. [25]. Each biological specimen was processed in triplicate to ensure technical reproducibility. The amplification protocol initiated with a 10-minute hot-start at 95 °C, followed by 45 cycles of denaturation (95 °C for 15 s), annealing (60 °C for 30 s), and extension (72 °C for 20 s). Finally, the 2−ΔΔCT algorithm was applied to normalize and determine the relative fold-change in gene transcription.

2.9. Western Blotting

As described in Section 2.7, cells were subjected to the indicated treatments. After treatment, cytoplasmic and nuclear proteins were separately isolated using a commercial protein extraction kit (Beyotime, Shanghai, China) in accordance with the manufacturer’s protocol. Protein levels were quantified by the bicinchoninic acid (BCA) method using a commercially available assay kit (Jiancheng, Nanjing, China). Western blot analysis was conducted following the procedure previously reported by Zou et al. [26]. Band intensities were quantified by densitometric analysis using Quantity One software (version 4.62; Bio-Rad Laboratories, Hercules, CA, USA).

2.10. Statistical Analysis

All results are reported as mean ± SD. Group differences were assessed by one-way ANOVA using SPSS 24.0 (Chicago, IL, USA), with Tukey’s test applied for pairwise comparisons. Statistical significance was defined as p < 0.05.

3. Results

3.1. Analysis of Key Compounds in FCE

The FCE contained 18.21 mg GAE/g of total phenolics and 204.12 mg/g of total saccharide content, corresponding to 1.82% phenolics and 20.4% total saccharide content of the extract, respectively.

3.1.1. TPC and Phenolic Compounds Analysis in FCE

As shown in Table 2, the total phenolic content of the FCE was determined to contain 18.21 mg GAE/g. To further elucidate the specific composition of phenolic compounds in the FCE in more depth, a UPLC-ESI-QTOF-MS analysis was performed. The identification of the phenolic compounds was based on mass spectrometry, characteristic absorption wavelength, retention times (tR) of standards comparison, and the literature. The results are presented in Table 2 and Figure 1, where a total of eight phenolic compounds were identified, including six flavonoids such as rutin, naringin, hesperidin, rhoifolin, melitidin and hesperetin, and two phenolic acids like gallic acid and p-coumaric acid (Figure 1).
Peak 1 shows a molecular ion [M-H]− at m/z 169.0142, with a fragment at m/z 125 resulting from the loss of a carboxylic acid group (COO), consistent with gallic acid [27]. Therefore, this compound was identified as gallic acid. Peak 2 shows a molecular ion [M-H]− at m/z 163.0400. The fragment ion at m/z 119 is characteristic of the decarboxylation of coumaric acid [22], suggesting that this compound is p-coumaric acid. Peak 3, with a molecular formula of C27H30O16 and a molecular ion [M-H]− at m/z 609.1461, exhibited a fragment ion at m/z 301, which is generated by the de-glycosylation of m/z 308, indicating the presence of rutin [26]. Peak 4, with a molecular formula of C27H32O14 and a molecular ion [M-H]− at m/z 579.1719, showed a fragment ion at m/z 459, corresponding to the loss of a rhamnose unit. Additionally, the fragment ion at m/z 271, resulting from the loss of a pyranose glucose unit, is in agreement with the literature reports on naringin, as identified by Zou et al. [24]. The remaining compounds were identified using a similar approach, comparing their mass spectral data with known standards and the literature.
Subsequently, we quantitatively analyzed the polyphenols in the FCE. The results showed that hesperidin, melitidin, and hesperetin were present in relatively high concentrations, measuring 370.20 μg/g, 136.24 μg/g, and 109.07 μg/g, respectively.

3.1.2. Total Saccharide Content, Mw and Monosaccharide Composition of Crude Polysaccharide in FCE

The total saccharide content of FCE was determined to be 204.12 mg/g, as presented in Table 3, illustrating the monosaccharide composition of the saccharides in FCE, which primarily consisted of mannose, glucosamine, glucose, and galactose, with their molar ratios arranged in the order of 0.07:0.03:2.77:0.08. Notably, glucose was the predominant monosaccharide, followed by mannose.
Gel permeation chromatography (GPC) analysis revealed four distinct peaks (Table 4), indicating that the saccharides in FCE consist of four fractions. The molecular weights (Mw) of these fractions were measured at 1769 Da, 1387 Da, 789 Da, and 501 Da, with corresponding peak area percentages of 3.36%, 9.50%, 31.24%, and 55.89%, respectively. This distribution suggests that the saccharides in the extract are predominantly oligosaccharides, with an average molecular weight of 717.7 Da.
The polydispersity index (PDI), defined as the ratio of the weight-average molecular weight (Mw) to the number-average molecular weight (Mn) (Mw/Mn), serves as a crucial parameter for evaluating the molecular weight distribution of polymeric substances. It provides insight into the overall dispersion of polymer chains, ranging from large to small molecules. A PDI value closer to 1 signifies a narrower molecular weight distribution, indicating higher consistency. For the four fractions of Finger Citron saccharides, the PDI values were 1.29, 1.27, 1.24, and 1.21, respectively, demonstrating a trend toward increasing molecular weight uniformity as the fraction changes.

3.2. Anti-Inflammatory Activities of FCE

3.2.1. Cytotoxicity of FCE

The cytotoxicity of FCE on RAW264.7 macrophages was evaluated using the MTT assay after 24 h of treatment at concentrations ranging from 150 to 750 μg/mL. As shown in Figure 2, no cytotoxic effects were observed within the tested concentration range. Compared with the control group, FCE treatment resulted in cell viability values above 100% (111.2–127%), indicating that FCE did not impair cellular metabolic activity. Given that RAW264.7 macrophages remained viable and metabolically stable across all tested concentrations, the selected range was considered suitable for subsequent anti-inflammatory experiments. Therefore, concentrations of 150, 300, 500, and 750 μg/mL were selected for further experiments.

3.2.2. Effects of FCE on the Production of NO and Pro-Inflammatory Cytokines

The effect of FCE on NO secretion by RAW264.7 cells is presented in Figure 3A. NO secretion significantly increased after 24 h of LPS stimulation compared to the control group (p < 0.05). In contrast, FCE treatment dose-dependently attenuated this LPS-induced NO production, with the most pronounced inhibition (44.94% reduction) observed at the 750 μg/mL concentration. The influence of FCE on TNF-α and IL-6 secretion in RAW264.7 cells is depicted in Figure 3B,C. The levels of TNF-α and IL-6 produced by cells were enhanced 10.5- and 85.5-fold after incubation with LPS, respectively. However, pretreatment with FCE significantly inhibited TNF-α and IL-6 secretion (p < 0.05) in a dose-dependent response.

3.2.3. Effects of FCE on the Gene Expression of iNOS and Pro-Inflammatory Cytokines

To investigate the effects of FCE on the gene expression, NO generation, and pro-inflammatory cytokine expression, we utilized RT-PCR to measure the mRNA expression levels of iNOS, TNF-α, and IL-6. As demonstrated in Figure 4, LPS stimulation significantly elevated the mRNA levels of iNOS, TNF-α, and IL-6 (p < 0.05). However, in FCE-pretreated cells, we discovered an inhibitory impact on TNF-α and IL-6 mRNA expression. Specifically, TNF-α mRNA levels were lowered by 95.7%, while the IL-6 mRNA levels were reduced by 86.7% in the high-dose FCE-pretreatment group compared with the LPS-treated group. This result further validates the potential of FCE in modulating the expression of these key inflammatory mediators.

3.3. Effects of FCE on NF-κB and MAPKs Signaling Pathways

To further investigate the mechanism of anti-inflammatory effects of FCE, we analyzed its impact on the regulation of the NF-κB signaling pathway first. As illustrated in Figure 5, in unstimulated control cells, we observed higher levels of IκBα in the cytoplasm and relatively low levels of NF-κB p65 in the nucleus. However, when treated with LPS, the level of IκBα in the cytoplasm decreased significantly (p < 0.05), whereas during the same time, the level of NF-κB p65 in the nucleus increased significantly (p < 0.05), a change that suggests activation of the NF-κB signaling pathway. Notably, compared with the LPS-treated group, the FCE-treated cells exhibited a significant dose-dependent effect at different doses: the cytoplasmic level of IκBα was dramatically enhanced, whereas the nuclear level of NF-κB p65 was decreased. Specifically, compared to the LPS group, FCE treatment resulted in a relative increase in cytoplasmic IκBα levels by 12.8%, 20%, and 48.6%, respectively (increasing with dose), while correspondingly decreasing the level of NF-κB p65 in the nucleus. These results strongly suggest that FCE may exert its anti-inflammatory effects by modulating the subcellular localization of IκBα and NF-κB p65, key molecules in the NF-κB signaling pathway.
To explore the potential involvement of FCE in the MAPK signaling pathway, the expression levels of JNK, p38, and ERK, as well as their phosphorylated forms, were assessed. As shown in Figure 5, LPS stimulation resulted in a significant increase in the phosphorylation of JNK, p38, and ERK (p < 0.05), suggesting activation of the MAPK pathway. In comparison, FCE treatment was associated with a reduction in the phosphorylation levels of these kinases relative to the LPS-treated group. Overall, these results indicate that FCE may modulate MAPK pathway activity, at least in part, through effects on the phosphorylation status of JNK, p38, and ERK.
The phosphorylation-to-total protein ratio plots presented in the lower panel of Figure 5 provide more intuitive evidence of the regulatory potency of LPS and FCE on the actual activation status of the NF-κB and MAPK pathways. The use of phosphorylation ratios (p-IκBα/IκBα, p-p65/p65, p-ERK/ERK, p-p38/p38, and p-JNK/JNK) effectively eliminates interference arising from differences in basal protein expression. It therefore represents a critical indicator for assessing the initiation of signal transduction. The results showed that LPS stimulation significantly increased the ratios of p-IκBα/IκBα and p-p65/p65 (p < 0.05), suggesting enhanced phosphorylation of IκBα and p65, which is generally associated with IκBα degradation and subsequent nuclear translocation of p65. These changes indicate activation of the NF-κB signaling pathway under LPS stimulation. In parallel, marked elevations in the ratios of p-ERK/ERK and p-p38/p38 were observed, implying that the MAPK kinase cascade was also activated and may contribute to the amplification of the pro-inflammatory response. In comparison, treatment with FCE resulted in significantly lower p-IκBα/IκBα and p-p65/p65 ratios relative to the LPS group, suggesting that FCE may attenuate the excessive phosphorylation of IκBα and limit p65 phosphorylation and nuclear translocation. In addition, the reductions in p-ERK/ERK and p-p38/p38 ratios indicate that FCE at 750 μg/mL may suppress MAPK-associated upstream pro-inflammatory signaling. Collectively, these phosphorylation ratio analyses suggest that FCE does not primarily affect total protein abundance but may modulate pathway activation by inhibiting key phosphorylation events. Such coordinated regulation of both NF-κB and MAPK signaling pathways may contribute to the observed attenuation of LPS-induced inflammatory responses, providing mechanistic insight into the potential role of FCE in regulating cellular signal transduction.

4. Discussion

Inflammation is a fundamental defense mechanism of the body, playing a pivotal role in counteracting external threats and promoting wound healing [28]. However, when the inflammatory response becomes excessive or prolonged, it can result in tissue damage and contribute to the onset of various inflammation-related diseases. During inflammatory activity, the overproduction of nitric oxide and pro-inflammatory cytokines, such as IL-6 and TNF-α, can inflict significant harm on tissues and cells, ultimately leading to a spectrum of inflammation-associated disorders [29]. Among these cytokines, IL-6 and TNF-α serve as key regulators of the inflammatory response in macrophages, each playing a crucial role. IL-6 primarily facilitates the proliferation and differentiation of B and T cells, which are essential for maintaining immune system function. In contrast, TNF-α, while exhibiting certain anti-inflammatory properties during developmental stages and contributing to overall health maintenance, can have severe pathological consequences when excessively produced. Accumulating evidence indicates that elevated levels of TNF-α are closely linked to the onset and progression of a range of immune-mediated inflammatory disorders. In particular, dysregulated TNF-α signaling has been implicated in chronic joint inflammation observed in rheumatoid arthritis and psoriatic arthritis [30,31]. Aberrant TNF-α expression is also recognized as a key contributor to intestinal inflammation in inflammatory bowel disease as well as the cutaneous immune responses characteristic of psoriasis [32]. Moreover, increased TNF-α activity has been reported in ocular inflammatory conditions such as non-infectious uveitis, further underscoring its broad involvement in complex inflammatory pathologies [33].
In the present study, FCE markedly reduced the levels of NO, IL-6, and TNF-α in LPS-induced RAW264.7 macrophages, consistent with previous reports on the anti-inflammatory activity of Finger Citron [34]. In parallel, the mRNA expression levels of iNOS, IL-6, and TNF-α were significantly downregulated in a dose-dependent manner following FCE treatment. These results indicate that within an appropriate concentration range, FCE effectively attenuates inflammatory responses by suppressing the transcriptional activation of key inflammatory mediators, thereby reducing their downstream protein production.
The NF-κB signaling pathway plays a pivotal role in regulating inflammatory responses by modulating the transcription of inflammation-related genes, including iNOS. In LPS-stimulated macrophages, activation of this pathway is generally characterized by a series of coordinated events. Specifically, cytoplasmic IκBα undergoes phosphorylation and subsequent degradation, which releases NF-κB dimers from their inhibitory complex. The liberated NF-κB then translocates into the nucleus, where the p65 subunit becomes more prominently enriched. Upon nuclear translocation, NF-κB binds to κB elements within the promoter regions of target genes, thereby promoting the transcription of downstream inflammatory mediators. This process is often accompanied by the increased production of pro-inflammatory cytokines, such as IL-6 and TNF-α, highlighting the central involvement of the NF-κB signaling pathway in inflammatory regulation. In the present study, FCE was observed to significantly attenuate IκBα phosphorylation and reduce the nuclear translocation of p65, suggesting that FCE may interfere with NF-κB pathway activation. This inhibitory effect on NF-κB signaling could partially account for the decreased expression of iNOS, IL-6, and TNF-α at both the mRNA and protein levels. Collectively, these results imply that the anti-inflammatory effects of FCE are, at least in part, associated with its modulatory influence on the NF-κB signaling pathway in macrophages.
In addition to NF-κB, the mitogen-activated protein kinase (MAPK) signaling pathway is widely recognized as another key regulator of LPS-induced inflammatory responses. The MAPK family mainly consists of three subfamilies—ERK, JNK, and p38 MAPK—all of which are involved in macrophage activation and cytokine production. Previous studies have demonstrated that LPS-induced activation of p38 MAPK contributes to the regulation of inflammatory genes, including iNOS and TNF-α [35]. Moreover, JNK signaling has also been reported to influence iNOS expression and activity [36]. Consistent with earlier findings [37], the present study confirmed that LPS stimulation activated the MAPK pathway in RAW264.7 cells. Importantly, our results further showed that FCE markedly suppressed LPS-induced phosphorylation of p38, JNK, and ERK. These observations suggest that the anti-inflammatory activity of FCE may be associated with its ability to inhibit phosphorylation events within key MAPK signaling components. Given that MAPK phosphorylation is known to facilitate the production of pro-inflammatory cytokines, such as TNF-α, the suppression of this pathway by FCE may contribute to the attenuation of the inflammatory response. Therefore, this study suggests that FCE may modulate LPS-induced inflammation through the regulation of MAPK pathway activation, providing mechanistic insight into its potential anti-inflammatory effects. Moreover, increasing evidence suggests that the NF-κB and MAPK signaling pathways are not independent but instead exhibit considerable crosstalk during LPS-induced inflammatory responses. Activation of MAPK cascades has been reported to facilitate NF-κB transcriptional activity by modulating upstream kinases or transcriptional co-regulators, thereby amplifying the expression of pro-inflammatory genes. Conversely, inhibition of MAPK phosphorylation may attenuate NF-κB activation and downstream cytokine production. In this context, the simultaneous suppression of NF-κB signaling and MAPK phosphorylation observed in FCE-treated macrophages suggests that these pathways may be coordinately regulated. Although the precise molecular interactions between NF-κB and MAPK pathways were not directly investigated in this study, the concurrent inhibition of both signaling axes may contribute synergistically to the overall anti-inflammatory effects of FCE.
The anti-inflammatory activity of FCE is likely attributable to its diverse profile of bioactive compounds. Chemical analysis revealed that FCE contains 1.82% total phenolics and 20.4% crude polysaccharides, alongside coumarins and alkaloids. These results align with the work of Salerno et al. [38], who identified flavonoids—including neohesperidin, melitidin, naringin, and hesperidin—as the predominant polyphenolic constituents in Finger Citron. Such polyphenols are recognized as natural modulators of inflammatory signaling, capable of interfering with TLR4-mediated activation of the NF-κB and MAPK pathways [39]. By inhibiting IκBα degradation and MAPK phosphorylation, these compounds can suppress the transcription of iNOS and pro-inflammatory cytokines. Notably, rutin has been shown to promote healing in ulcerative colitis by reducing serum TNF-α levels [40]. Consequently, the molecular mechanisms observed in this study—specifically the inhibition of iNOS expression, the prevention of NF-κB nuclear translocation, and the suppression of MAPK phosphorylation—are consistent with the known effects of polyphenols. While hesperidin, hesperetin, and rutin were identified here as major components, they likely represent significant contributors to the overall anti-inflammatory profile of the extract.
Beyond phenolics, FCE contains abundant saccharides, primarily in the form of low-molecular-weight oligosaccharides (average molecular weight: 717.77 Da). Our analysis identified glucose and mannose as the primary monosaccharides (molar ratio 2.77:0.07), which contrasts with the 103 kDa polysaccharide (CMSPB80-1) isolated by Peng et al. [41]. This discrepancy likely stems from the extraction methodology; in this study, 80% methanol was utilized to optimize phenolic recovery, which concurrently precipitated macromolecular polysaccharides while enriching for low-molecular-weight saccharides. Consistent with Wang et al. [42], glucose was the dominant monosaccharide. Emerging evidence suggests that such oligosaccharides possess high bioavailability and may modulate macrophage responsiveness by attenuating intracellular oxidative stress and suppressing MAPK-mediated cytokine production [43]. Furthermore, glucose and mannose rich plant polysaccharides have been reported to reduce macrophage activation via p38 and JNK dependent mechanisms [44]. Therefore, these oligosaccharides may play a role in the observed downregulation of iNOS expression and the subsequent reduction in NO production.
Both phenolic compounds and polysaccharides are recognized for their potent anti-inflammatory activities, exerted through the inhibition of cytokine production, enzymatic activity, and cellular infiltration [45]. In the context of Finger Citron, these two fractions collectively characterize the extract’s bioactivity. Previous studies on other plant sources, such as Jujube peel [46] and lentil hull [47], similarly demonstrate that combined phenolic and carbohydrate profiles correlate with the suppression of NO, iNOS, and MAPK activation. Our findings show that FCE significantly inhibits the LPS-induced transcription of pro-inflammatory cytokines, such as IL-8, corroborating research by Peng et al. [48], Borgatti et al. [49], and Xie et al. [50]. Additionally, Trombetta et al. [51] demonstrated that Finger Citron peel extract regulates NF-κB activation and reduces oxidative stress in HUVECs. In summary, the anti-inflammatory properties of FCE are closely associated with the suppression of pro-inflammatory mediators (NO and TNF-α) through the modulation of NF-κB and MAPK signaling. While the relative contribution of each chemical fraction remains to be fully elucidated, FCE represents a promising natural complex for the development of anti-inflammatory interventions.
This study explored the anti-inflammatory effects of Finger Citron’s mixed components and the mechanisms behind them. However, due to the complex and diverse composition of Finger Citron, further research is essential to gain a clearer understanding of its anti-inflammatory properties. To this end, we propose the following directions for future research:
First, the comprehensive isolation and purification of Finger Citron’s active components should be undertaken to accurately pinpoint which compounds are most crucial to its anti-inflammatory effects. This approach will help elucidate the chemical basis of Finger Citron’s anti-inflammatory mechanism, offering valuable insights for deeper investigation. Second, to thoroughly assess the anti-inflammatory potential of Finger Citron and delve deeper into its mechanisms of action, in vivo studies using animal models are recommended. By developing suitable inflammatory models, we can evaluate the true anti-inflammatory efficacy of Finger Citron’s components in a biological context and corroborate the anti-inflammatory activity observed in in vitro studies. This comprehensive approach will not only enhance our understanding of Finger Citron’s anti-inflammatory capabilities but also provide robust scientific evidence supporting its potential use in anti-inflammatory therapies.
In summary, isolating and purifying active compounds, alongside conducting in vivo studies in animal models, represent crucial next steps in advancing our understanding of Finger Citron’s anti-inflammatory mechanisms. These efforts will lay a strong foundation for developing Finger Citron into a promising anti-inflammatory agent or functional food ingredient.

5. Conclusions

Finger Citron extract is rich in polyphenols and oligosaccharides, including key compounds such as hesperidin, naringin, and rutin, which exhibit significant in vitro anti-inflammatory activity. In the RAW264.7 macrophage model induced by LPS, the extract effectively inhibited NO production, reduced the secretion of TNF-α and IL-6, and downregulated the expression of mRNA for iNOS, TNF-α, and IL-6. The anti-inflammatory effects of Finger Citron extract are believed to be mediated, at least in part, through the regulation of protein phosphorylation, which in turn modulates the expression of inflammatory mediators and genes associated with the NF-κB and MAPK signaling pathways. As a result, Finger Citron may serve as a natural source of compounds with in vitro ant-inflammatory activity, warranting further investigation to clarify its biological relevance and potential applications.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/foods15040688/s1. Table S1. UPLC-ESI-QTF-MS identification of Citrus medica ‘Finger Citron’ polyphenol extract composition. Figure S1. MS/MS spectra and fragmentation patterns of Rutin (A); Gallic acid (B); Gallic acid (C); p-coumaric acid (D); Hesperetin (E); Rhoifolin (F); Naringin (G). Figure S2. Liquid chromatogram of methanol extract of Citrus medica ‘Fingered’ (A: 280 nm; B: 320 nm; C: 350 nm) and 8 kinds of polyphenol standards (D). Note: (1. Gallic acid, 2. p-Coumaric acid, 3. Rutin; 4. Naringin; 5. Hesperidin; 6. Anacardiin; 7. Melitidin; 8. Hesperetin).

Author Contributions

Conceptualization, G.X. and B.Z.; methodology, Y.T.; software, validation, and formal analysis, J.H. and Y.Y.; investigation, Z.B. and J.W.; resources, G.X.; data curation, Y.T.; writing—original draft preparation, J.H. and Y.Y.; writing—review and editing, B.Z.; visualization, B.Z.; supervision, B.Z., Y.X. and G.X.; project administration, Y.X.; funding acquisition, Y.X. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the Guangdong Provincial Special Fund for Modern Agriculture Industry Technology Innovation Teams (2024CXTD10), the Talent Training Program of Guangdong Academy of Agricultural Sciences (R2022PY-QY009), Special Funding for the Construction of the High-Level Academy of Agricultural Sciences (NYQS202623) and Guangdong Provincial Talent Project (NYLJ202505).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Li, X.; Li, C.; Zhang, W.; Wang, Y.; Qian, P.; Huang, H. Inflammation and Aging: Signaling Pathways and Intervention Therapies. Inflamm. Aging Signal. Pathw. Interv. Ther. 2023, 8, 239. [Google Scholar] [CrossRef]
  2. Liberale, L.; Badimon, L.; Montecucco, F.; Lüscher, T.F.; Libby, P.; Camici, G.G. Inflammation, Aging, and Cardiovascular Disease. J. Am. Coll. Cardiol. 2022, 79, 837–847. [Google Scholar] [CrossRef] [PubMed]
  3. Denk, D.; Greten, F.R. Inflammation: The Incubator of the Tumor Microenvironment. Trends Cancer 2022, 8, 901–914. [Google Scholar] [CrossRef] [PubMed]
  4. Arifuzzaman, M.; Collins, N.; Guo, C.-J.; Artis, D. Nutritional Regulation of Microbiota-Derived Metabolites: Implications for Immunity and Inflammation. Immunity 2024, 57, 14–27. [Google Scholar] [CrossRef]
  5. Deraison, C.; Vergnolle, N. Pharmacology of Intestinal Inflammation and Repair. Annu. Rev. Pharmacol. Toxicol. 2025, 65, 301–314. [Google Scholar] [CrossRef]
  6. Kim, H.-H.; Dixit, V.D. Defying “IL-11ness” by Inhibiting Inflammation: Strategy for Health and Longevity. Cell Metab. 2024, 36, 1911–1913. [Google Scholar] [CrossRef]
  7. Lamabadusuriya, D.; Jayasena, H.; Bopitiya, A.; De Silva, A.; Mmpt, J. Obesity-Driven Inflammation and Cancer Risk: A Comprehensive Review. Semin. Cancer Biol. 2025, 114, 256–266. [Google Scholar] [CrossRef]
  8. Mao, H.; Zhao, X.; Sun, S. NF-ΚB in Inflammation and Cancer. Cell. Mol. Immunol. 2025, 22, 811–839. [Google Scholar] [CrossRef] [PubMed]
  9. Singh, S.P.; Dosch, A.R.; Mehra, S.; De Castro Silva, I.; Bianchi, A.; Garrido, V.T.; Zhou, Z.; Adams, A.; Amirian, H.; Box, E.W.; et al. Tumor Cell-Intrinsic P38 MAPK Signaling Promotes IL1⍺-Mediated Stromal Inflammation and Therapeutic Resistance in Pancreatic Cancer. Cancer Res. 2024, 84, 1320–1332. [Google Scholar] [CrossRef]
  10. Múnera-Rodríguez, A.M.; Múnera-Rodríguez, A.M.; Múnera-Rodríguez, A.M.; Múnera-Rodríguez, A.M.; Múnera-Rodríguez, A.M. Sulforaphane-Mediated Immune Regulation through Inhibition of NF-KB and MAPK Signaling Pathways in Human Dendritic Cells. Biomed. Pharmacother. 2024, 177, 117056. [Google Scholar] [CrossRef]
  11. Liu, J.; Han, X.; Zhang, T.; Tian, K.; Li, Z.; Luo, F. Reactive Oxygen Species (ROS) Scavenging Biomaterials for Anti-Inflammatory Diseases: From Mechanism to Therapy. J. Hematol. Oncol. 2023, 16, 116. [Google Scholar] [CrossRef]
  12. Shen, N.; Wang, T.; Gan, Q.; Liu, S.; Wang, L.; Jin, B. Plant Flavonoids: Classification, Distribution, Biosynthesis, and Antioxidant Activity. Food Chem. 2022, 383, 132531. [Google Scholar] [CrossRef]
  13. Karp, D.; Hu, X. The Citron (Citrus medica L.) in China. In The Citron Compendium; Springer: Cham, Switzerland, 2023; pp. 217–263. [Google Scholar]
  14. Wu, Z.; Li, H.; Yang, Y.; Zhan, Y.; Tu, D. Variation in the components and antioxidant activity of Citrus medica L. var. sarcodactylis essential oils at different stages of maturity. Ind. Crops Prod. 2013, 46, 311–316. [Google Scholar] [CrossRef]
  15. Ali Mahdi, A.; Al-Ansi, W.; Ismael Ahmed, M.; Wang, H. Bioactive Compounds and Functional Benefits of the Foshou Fruit: A Review. J. Food Nutr. Res. 2018, 6, 486–491. [Google Scholar] [CrossRef]
  16. Sun, Y.; Zheng, J.; Zhang, T.; Chen, M.; Li, D.; Liu, R.; Li, X.; Wang, H.; Sun, T. Review of Polysaccharides from Citrus medica L. var. sarcodactylis. (Fingered citron): Their Extraction, Purification, Structural Characteristics, Bioactivity and Potential Applications. Int. J. Biol. Macromol. 2024, 282, 136640. [Google Scholar] [CrossRef]
  17. Tan, T.; Xu, M.; Hong, X.; Li, Z.; Li, J.; Jiao, B.; Zhao, X. Quantitative Analysis of Flavonoids and Coumarins from Fingered Citron in Different Growth Periods and Their Regulatory Effects on Oxidative Stress. Foods 2025, 14, 180. [Google Scholar] [CrossRef]
  18. Wu, C.; Dong, L.; Zhou, J.; Wan, S.; Qin, Z.; Gao, H. A Novel Polysaccharide of Citrus medica L. var. sarcodactylis Swingle: Purification, Structural Characterization, and Hypolipidemic Effects. Food Chem. X 2026, 33, 103559. [Google Scholar] [CrossRef] [PubMed]
  19. Luo, X.; Wang, J.; Chen, H.; Zhou, A.; Song, M.; Zhong, Q.; Chen, H.; Cao, Y. Identification of Flavoanoids From Finger Citron and Evaluation on Their Antioxidative and Antiaging Activities. Front. Nutr. 2020, 7, 584900. [Google Scholar] [CrossRef] [PubMed]
  20. Zeng, D.; Xiao, G.; Xu, Y.; Zou, B.; Wu, J.; Yu, Y. Protein and polyphenols involved in sediment formation in cloudy litchi juice. Food Sci. Biotechnol. 2019, 28, 945–953. [Google Scholar] [CrossRef] [PubMed]
  21. Sevag, M.; Lackman, D.B.; Smolens, J. The isolation of the components of streptococcal nucleoproteins in serologically active form. J. Biol. Chem. 1938, 124, 425–436. [Google Scholar] [CrossRef]
  22. DuBois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric Method for Determination of Sugars and Related Substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
  23. Hu, T.-G.; Zhu, W.-L.; Yu, Y.-S.; Zou, B.; Xu, Y.-J.; Xiao, G.-S.; Wu, J.-J. The variation on structure and immunomodulatory activity of polysaccharide during the longan pulp fermentation. Int. J. Biol. Macromol. 2022, 222, 599–609. [Google Scholar] [CrossRef]
  24. Zou, B.; Li, T.; Xu, Y.; Yu, Y.; Wu, J. Structural identification and antioxidant potency evaluation of pomelo vinegar polyphenols. Food Biosci. 2022, 47, 01674. [Google Scholar] [CrossRef]
  25. Yin, J.L.; Shackel, N.A.; Zekry, A.; McGuinness, P.H.; Richards, C.; Van Der Putten, K.; Mccaughan, G.; Eris, J.M.; Bishop, G.A. Real-time reverse transcriptase–polymerase chain reaction (RT–PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I. Immunol. Cell Biol. 2001, 79, 213–221. [Google Scholar] [CrossRef]
  26. Zou, B.; Xiao, G.; Qian, M.C.; Wu, J.; Yu, Y.; Fu, M. Persimmon vinegar polyphenols protect against hydrogen peroxide-induced cellular oxidative stress via Nrf2 signalling pathway. Food Chem. 2018, 255, 23–30. [Google Scholar] [CrossRef] [PubMed]
  27. Zou, B.; Wu, J.; Yu, Y.; Xiao, G.; Xu, Y. Evolution of the antioxidant capacity and phenolic contents of persimmon during fermentation. Food Sci. Biotechnol. 2017, 26, 563–571. [Google Scholar] [CrossRef] [PubMed]
  28. Tu, H.; Li, Y. Inflammation Balance in Skeletal Muscle Damage and Repair. Front. Immunol. 2023, 14, 1133355. [Google Scholar] [CrossRef]
  29. Zaman, B.; Mostafa, I.; Hassan, T.; Ahmed, S.; Esha, N.J.I.; Chowdhury, F.A.; Bosu, T.; Chowdhury, H.N.; Mallick, A.; Islam, M.S.; et al. Tolperisone Hydrochloride Improves Motor Functions in Parkinson’s Disease via MMP-9 Inhibition and by Downregulating P38 MAPK and ERK1/2 Signaling Cascade. Biomed. Pharmacother. 2024, 174, 116438. [Google Scholar] [CrossRef] [PubMed]
  30. Hu, F.; Shi, L.; Liu, X.; Chen, Y.; Zhang, X.; Jia, Y.; Liu, X.; Guo, J.; Zhu, H.; Liu, H.; et al. Proinflammatory phenotype of B10 and B10pro cells elicited by TNF-α in rheumatoid arthritis. Ann. Rheum. Dis. 2024, 83, 576–588. [Google Scholar] [CrossRef]
  31. Voci, S.; Gagliardi, A.; Ambrosio, N.; Zannetti, A.; Cosco, D. Lipid- and polymer-based formulations containing TNF-α inhibitors for the treatment of inflammatory bowel diseases. Drug Discov. Today 2024, 29, 104090. [Google Scholar] [CrossRef]
  32. Rudbaek, J.J.; Borbye-Lorenzen, N.; Poulsen, G.J.; Koziol, A.; Skogstrand, K.; Jess, T. Inflammatory Markers at Birth and Risk of Early-Onset Inflammatory Bowel Disease. Gastroenterology 2024, 167, 1225–1227.e4. [Google Scholar] [CrossRef]
  33. Østergaard, M.; Boesen, M.; Maksymowych, W.P.; Lambert, R.G.; Bubb, M.R.; Kubassova, O.; Valenzuela, G.; Reddy, J.; Colgan, S.; Klyachkin, Y.; et al. Effect of Apremilast on Hand and Whole-Body MRI Assessments of Inflammation in Patients with Psoriatic Arthritis (MOSAIC): A Phase 4, Multicentre, Single-Arm, Open-Label Study. Lancet Rheumatol. 2024, 7, e118–e126. [Google Scholar] [CrossRef]
  34. Yang, Y.; Tian, A.; Wu, Z.; Wei, Y.; Hu, X.; Guo, J. Finger Citron Extract Ameliorates Glycolipid Metabolism and Inflammation by Regulating GLP-1 Secretion via TGR5 Receptors in Obese Rats. Evid.-Based Complement. Altern. Med. 2021, 2021, 6623379. [Google Scholar]
  35. Mohan Kumar Ramar Jeeva, L.; Ramachandran, S.; Chidambaram, K.; Kandasamy, R. Ziziphus mauritiana Lam attenuates inflammation via downregulating NFκB pathway in LPS-stimulated RAW 264.7 macrophages & OVA-induced airway inflammation in mice models. J. Ethnopharmacol. 2022, 295, 115445. [Google Scholar]
  36. Zhang, D.; Wang, W.; Ou, H.; Ning, J.; Zhou, Y.; Ke, J.; Hou, A.; Chen, L.; Li, P.; Ma, Y.; et al. Identification of chalcone analogues as anti-inflammatory agents through the regulation of NF-κB and JNK activation. RSC Med. Chem. 2024, 15, 2002–2017. [Google Scholar] [CrossRef]
  37. Kim, S.; Wang, R.; Sanjeevram Dhandapani Kang, K.; Cho, I.-H.; Kim, Y.-J. Novel modified probiotic gold nanoparticles loaded with ginsenoside CK exerts an anti-inflammation effect via NF-κB/MAPK signaling pathways. Arab. J. Chem. 2024, 17, 105650. [Google Scholar] [CrossRef]
  38. Salerno, R.; Casale, F.; Calandruccio, C.; Procopio, A. Characterization of flavonoids in Citrus bergamia (Bergamot) polyphenolic fraction by liquid chromatography–High resolution mass spectrometry (LC/HRMS). PharmaNutrition 2016, 4, S1–S7. [Google Scholar] [CrossRef]
  39. Wang, Y.; Ye, L.; Yan, R.; Guo, C.; Mu, M.; Sun, Y.; Zhou, H.; Zhao, G. Ilex asprella-derived polysaccharide activates macrophage via TLR4-mediated NF-κB and MAPK signaling pathways. J. Funct. Foods 2024, 122, 106527. [Google Scholar] [CrossRef]
  40. Wei, H.; Wang, X.; Wang, J.; Ren, S.; Mur, L.A.J.; Lu, D.; Cao, D. Flavonoids from sour jujube leaves: Ultrasound-assisted extraction, UPLC-QQQ-MS/MS quantification, and ameliorative effect on DSS-induced ulcerative colitis in mice. Ultrason. Sonochem. 2025, 114, 107279. [Google Scholar] [CrossRef]
  41. Peng, B.; Yang, J.; Huang, W.; Peng, D.; Bi, S.; Song, L.; Wen, Y.; Zhu, J.; Chen, Y.; Yu, R. Structural characterization and immunoregulatory activity of a novel heteropolysaccharide from bergamot (Citrus medica L. var. sarcodactylis) by alkali extraction. Ind. Crops Prod. 2019, 140, 111617. [Google Scholar] [CrossRef]
  42. Wang, S.; Yang, Y.; Wang, Q.; Wu, Z.; Liu, X.; Chen, S.; Zhou, A. Structural characterization and immunomodulatory activity of a polysaccharide from finger citron extracted by continuous phase-transition extraction. Int. J. Biol. Macromol. 2023, 240, 124491. [Google Scholar] [CrossRef]
  43. Xu, W.; Li, X.-J.; Zhong, Y.-S.; He, J.-Q.; Xie, W.; Kang, Y.-K.; Ying, H.-Z.; Yu, C.-H. Structural characterizations and antiaging activities of hydrolyzed low-molecular-weight polysaccharides from Polygoni Multiflori Radix Praeparata. Carbohydr. Polym. 2025, 356, 123381. [Google Scholar] [CrossRef]
  44. Mizuno, M.; Minato, K. Anti-inflammatory and immunomodulatory properties of polysaccharides in mushrooms. Curr. Opin. Biotechnol. 2024, 86, 103076. [Google Scholar] [CrossRef]
  45. Hu, F.; Liu, C.; Wang, F.; Zhou, C.; Zhu, M.; Sun-Waterhouse, D.; Wang, Z. Phenolic compounds from Chaenomeles speciosa alleviate inflammation in lipopolysaccharide-treated RAW264.7 macrophages via the NF-κB and MAPK pathways. Food Sci. Hum. Wellness 2022, 12, 1071–1080. [Google Scholar] [CrossRef]
  46. Shen, D.; Wu, C.; Fan, G.; Li, T.; Dou, J.; Zhu, J.; Li, C.; Kou, X. Jujube peel polyphenols synergistically inhibit lipopolysaccharide-induced inflammation through multiple signaling pathways in RAW 264.7 cells. Food Chem. Toxicol. 2022, 164, 113062. [Google Scholar] [CrossRef]
  47. Peng, L.; Guo, F.; Pei, M.; Tsao, R.; Wang, X.; Jiang, L.; Sun, Y.; Xiong, H. Anti-inflammatory effect of lentil hull (Lens culinaris) extract via MAPK/NF-κB signaling pathways and effects of digestive products on intestinal barrier and inflammation in Caco-2 and Raw264.7 co-culture. J. Funct. Foods 2022, 92, 105044. [Google Scholar] [CrossRef]
  48. Peng, C.-H.; Ker, Y.-B.; Weng, C.-F.; Peng, C.-C.; Huang, C.-N.; Lin, L.-Y.; Peng, R.Y. Insulin Secretagogue Bioactivity of Finger Citron Fruit (Citrus medica L. var. Sarcodactylis Hort, Rutaceae). J. Agric. Food Chem. 2009, 57, 8812–8819. [Google Scholar] [CrossRef]
  49. Borgatti, M.; Mancini, I.; Bianchi, N.; Guerrini, A.; Lampronti, I.; Rossi, D.; Sacchetti, G.; Gambari, R. Bergamot (Citrus bergamia Risso) fruit extracts and identified components alter expression of interleukin 8 gene in cystic fibrosis bronchial epithelial cell lines. BMC Biochem. 2011, 12, 15. [Google Scholar] [CrossRef] [PubMed]
  50. Xie, J.; Zhang, X.; Zhang, L. Negative regulation of inflammation by SIRT1. Pharmacol. Res. 2013, 67, 60–67. [Google Scholar] [CrossRef] [PubMed]
  51. Trombetta, D.; Cimino, F.; Cristani, M.; Mandalari, G.; Saija, A.; Ginestra, G.; Speciale, A.; Chirafisi, J.; Bisignano, G.; Waldron, K.; et al. In Vitro Protective Effects of Two Extracts from Bergamot Peels on Human Endothelial Cells Exposed to Tumor Necrosis Factor-α (TNF-α). J. Agric. Food Chem. 2010, 58, 8430–8436. [Google Scholar] [CrossRef] [PubMed]
Foods 15 00688 g001aFoods 15 00688 g001b
Figure 1. HPLC chromatograms of FCE ((A), 280 nm; (B), 320 nm, (C), 350 nm). Peak number identities are displayed in Table 2.
Figure 1. HPLC chromatograms of FCE ((A), 280 nm; (B), 320 nm, (C), 350 nm). Peak number identities are displayed in Table 2.
Foods 15 00688 g001aFoods 15 00688 g001b
Foods 15 00688 g002
Figure 2. Effects of FCE on the cell viability of RAW264.7 macrophages. Values are expressed as the mean ± SD (n = 6). The significant difference is represented by different lowercase letters (a, b, c, d, and e; p < 0.05).
Figure 2. Effects of FCE on the cell viability of RAW264.7 macrophages. Values are expressed as the mean ± SD (n = 6). The significant difference is represented by different lowercase letters (a, b, c, d, and e; p < 0.05).
Foods 15 00688 g002
Foods 15 00688 g003
Figure 3. Effects of FCE on NO (A), TNF-α (B) and IL-6 (C) secretion of RAW264.7 macrophages. Values are expressed as the mean ± SD (n = 3). The significant difference is represented by different lowercase letters (a, b, c, and d; p < 0.05).
Figure 3. Effects of FCE on NO (A), TNF-α (B) and IL-6 (C) secretion of RAW264.7 macrophages. Values are expressed as the mean ± SD (n = 3). The significant difference is represented by different lowercase letters (a, b, c, and d; p < 0.05).
Foods 15 00688 g003
Foods 15 00688 g004
Figure 4. Effects of FCE on the iNOS (A), TNF-α (B), and IL-6 (C) mRNA levels in RAW 264.7. Values are expressed as the mean ± SD (n = 3). The significant difference is represented by different lowercase letters (a, b, c, d, and e; p < 0.05).
Figure 4. Effects of FCE on the iNOS (A), TNF-α (B), and IL-6 (C) mRNA levels in RAW 264.7. Values are expressed as the mean ± SD (n = 3). The significant difference is represented by different lowercase letters (a, b, c, d, and e; p < 0.05).
Foods 15 00688 g004
Foods 15 00688 g005
Figure 5. Effects of FCE on protein phosphorylation of NF-κB and MAPK in RAW 264.7. Values are expressed as the mean ± SD (n = 3). The significant difference is represented by different lowercase letters (a, b, c, d, and e; p < 0.05).
Figure 5. Effects of FCE on protein phosphorylation of NF-κB and MAPK in RAW 264.7. Values are expressed as the mean ± SD (n = 3). The significant difference is represented by different lowercase letters (a, b, c, d, and e; p < 0.05).
Foods 15 00688 g005
Table 1. Primers used for real-time RT-PCR.
Table 1. Primers used for real-time RT-PCR.
NamePrimerSequenceSize
GAPDHForwardGGAGAAACCTGCCAAGTATGATGAC102 bp
ReverseGAGACAACCTGGTCCTCAGTGTA
TNF-αForwardGCCTCTCTACCTTGTTGCCTCCT110 bp
ReverseAGTGATGTAGCGACAGCCTGGT
IL-6ForwardGAGTCACAGAAGGAGTGGCT107 bp
ReverseACGCACTAGGTTTGCCGAGT
INOSForwardCTCCCAGCACAAAGGGCTCAA116 bp
ReverseGCACTCTCTTGCGGACCATCT
Table 2. Qualitative and quantitative analysis of phenolic compounds in FCE.
Table 2. Qualitative and quantitative analysis of phenolic compounds in FCE.
Phenolics[M-H]− m/zMS/MS m/zFormulaConcentration (μg/g)
Total phenolics 18.21 ± 1.18 mg GAE/g
1Gallic acid169.0142125C7H6O532.53 ± 2.31 d
2p-Coumaric acid163.0400119, 117C9H8O318.04 ± 1.43 e
3Rutin609.1461301, 300C27H30O1668.59 ± 13.34 c
4Naringin579.1719459, 271, 151C27H32O1444.17 ± 2.38 c
5Hesperidin609.1842325, 301C28H34O15370.20 ± 8.77 a
6Rhoifolin577.1351269, 211C27H30O1451.56 ± 6.56 c
7Melitidin723.2130621, 271C33H40O18136.24 ± 3.98 b
8Hesperetin301.0717301, 255, 215, 164C16H14O6109.07 ± 5.69 b
The different letters show a significant difference (p < 0.05).
Table 3. Total saccharide content, Mw, and monosaccharide composition of polysaccharide in FCE.
Table 3. Total saccharide content, Mw, and monosaccharide composition of polysaccharide in FCE.
Total Saccharide (mg/g)MwMolar Ratio
MannoseGlucosamineGlucoseGalactose
204.12 ± 6.45717.770.070.032.770.08
Table 4. Molecular weight analysis of Citrus medica ‘Finger Citron’ oligosaccharides.
Table 4. Molecular weight analysis of Citrus medica ‘Finger Citron’ oligosaccharides.
RT (min)Mp (Da)Mw (Da)Mn (Da)Percentage of Peak Area (%)PDI (Mw/Mn)
44.7751638176913753.361.29
45.3861299138710919.501.27
46.80475978963831.241.24
47.94749250141455.891.21
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, J.; Yu, Y.; Tang, Y.; Bu, Z.; Xu, Y.; Wu, J.; Xiao, G.; Zou, B. Anti-Inflammatory Effect of Finger Citron Extract on RAW264.7 Macrophages via NF-κB and MAPK Signaling Pathways. Foods 2026, 15, 688. https://doi.org/10.3390/foods15040688

AMA Style

Hu J, Yu Y, Tang Y, Bu Z, Xu Y, Wu J, Xiao G, Zou B. Anti-Inflammatory Effect of Finger Citron Extract on RAW264.7 Macrophages via NF-κB and MAPK Signaling Pathways. Foods. 2026; 15(4):688. https://doi.org/10.3390/foods15040688

Chicago/Turabian Style

Hu, Jiateng, Yuanshan Yu, Ying Tang, Zhibin Bu, Yujuan Xu, Jijun Wu, Gengsheng Xiao, and Bo Zou. 2026. "Anti-Inflammatory Effect of Finger Citron Extract on RAW264.7 Macrophages via NF-κB and MAPK Signaling Pathways" Foods 15, no. 4: 688. https://doi.org/10.3390/foods15040688

APA Style

Hu, J., Yu, Y., Tang, Y., Bu, Z., Xu, Y., Wu, J., Xiao, G., & Zou, B. (2026). Anti-Inflammatory Effect of Finger Citron Extract on RAW264.7 Macrophages via NF-κB and MAPK Signaling Pathways. Foods, 15(4), 688. https://doi.org/10.3390/foods15040688

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop