PfAgo-Enhanced LAMP Assay for Rapid and Specific Detection of Vibrio alginolyticus and Vibrio vulnificus

Abstract

Rapid and accurate detection of Vibrio alginolyticus and Vibrio vulnificus is important for seafood safety and foodborne infection control. In this study, we developed a detection platform that combines loop-mediated isothermal amplification (LAMP) with Pyrococcus furiosus Argonaute (PfAgo)-mediated sequence-specific cleavage. The LAMP rapidly amplified pathogen-specific target sequences under isothermal conditions, while PfAgo provides an additional layer of sequence verification through a programmable guide DNA-directed cleavage step to reduce false-positive signals caused by nonspecific amplification. Under optimized conditions, the assay achieved limits of detection of 3 × 10¹ CFU·mL⁻¹ for V. alginolyticus and 10² CFU·mL⁻¹ for V. vulnificus, with no positive signals observed among the tested non-target bacteria. In artificially contaminated salmon samples, both V. alginolyticus and V. vulnificus were detected without enrichment after simple boiling-based DNA extraction, with a practical detection limit of 2.9 × 10² CFU·mL⁻¹ in the final homogenate. Compared with culture-based methods and instrument-intensive molecular assays, the proposed LAMP-PfAgo platform exhibits a rapid two-step workflow with an added sequence-verification layer. These results support LAMP coupled with Argonaute-mediated cleavage as a practical strategy for foodborne pathogen monitoring in seafood.

1. Introduction

Vibrio alginolyticus (V. alginolyticus) and Vibrio vulnificus (V. vulnificus) are important halophilic bacteria that are widely distributed in marine and estuarine environments. Both pathogens threaten aquaculture by causing mortality in aquatic organisms and substantial economic losses [1]. V. alginolyticus can cause wound infections in humans, which may progress to severe disease, and has therefore attracted increasing attention [2]. V. vulnificus is recognized as one of the most virulent foodborne pathogens and can cause septicemia and necrotizing wound infections with high mortality rates [3]. Both species also carry virulence-associated genes and show increasing antimicrobial resistance, further complicating seafood safety management [4,5]. Rapid and sensitive detection methods are therefore needed for seafood safety control.

The high genetic relatedness and similar phenotypes of Vibrio species, particularly between V. alginolyticus and V. vulnificus, can lead to misidentification and delays in timely clinical or food-safety interventions [6]. Culture-based methods are reliable but time-consuming, whereas immunological assays require specific antibodies and may be less suitable for early and rapid pathogen detection [7]. Loop-mediated isothermal amplification (LAMP) can detect target genes under constant-temperature conditions, but conventional LAMP results often rely on gel electrophoresis or visual observation of precipitation. These results can be subjective, contamination-prone, or vulnerable to false-positive signals, indicating the need for a more specific detection workflow [8].

Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas) provide highly specific nucleic acid recognition and have been combined with LAMP to improve assay specificity. For example, LAMP-CRISPR-Cas12a has been used for specific detection of Escherichia coli O157:H7 with ultraviolet (UV)-based visual readout, reducing reliance on complex instruments and mitigating false-positive signals [9]. However, CRISPR-Cas assays still face practical constraints. Cas13a-based detection requires an additional transcription step to convert DNA into RNA, increasing assay complexity, cost, and time [10]. Cas12a can directly target double-stranded DNA, but its activity depends on protospacer adjacent motif (PAM) sequences, restricting target-site selection and assay flexibility [11]. In addition, Cas proteins can be sensitive to reaction conditions, which may affect robustness in resource-limited on-site testing [12]. Alternative nucleic acid recognition tools that are compatible with LAMP therefore remain valuable.

Argonaute (Ago) proteins are programmable nucleases that specifically recognize and cleave nucleic acid targets [13]. Compared with CRISPR-Cas systems, Ago proteins do not require PAM sequences, thus offering greater flexibility in target site selection. They use short guide DNAs (gDNAs) that are stable, easy to design, and readily synthesized, which reduce the off-target risks [14]. Pyrococcus furiosus Argonaute (PfAgo) from the hyperthermophilic archaeon Pyrococcus furiosus has been widely explored for nucleic acid detection because of its thermostability and high cleavage efficiency. In PfAgo-based assays, amplified nucleic acid fragments can be recognized by PfAgo-gDNA complexes, leading to probe cleavage and fluorescence signal release [15]. Recent studies have demonstrated that the integration of specific primers, exonuclease I, and PfAgo enables one-step cleavage, facilitating ultrasensitive detection of foodborne pathogens. This assay enabled rapid and sensitive detection of Salmonella Typhi and Staphylococcus aureus in actual food samples, highlighting the potential of PfAgo-based strategies for rapid foodborne pathogen screening [16]. Because LAMP and PfAgo-mediated cleavage can be integrated in a sequential workflow, their combination provides a direct route for target amplification followed by sequence-specific verification [17].

Here, we established a rapid and specific LAMP-PfAgo assay for V. alginolyticus and V. vulnificus. We optimized key parameters of the LAMP and PfAgo cleavage modules, evaluated analytical specificity and sensitivity, and tested practical applicability using artificially contaminated salmon samples. This work addresses the limitations of conventional methods and CRISPR-Cas based detection assays by developing a two-step LAMP-PfAgo detection workflow for V. alginolyticus and V. vulnificus.

2. Materials and Methods

2.1. Bacterial Strains and Genomic DNA Extraction

The standard strain and isolates of V. alginolyticus and V. vulnificus were used as target strains in this study. The biotypes of the tested V. vulnificus strains were not further determined in the present study. Several non-target bacterial species, including other Vibrio species and common foodborne pathogens, were used to evaluate the specificity of the developed assay. All strains used in this study are summarized in

Table 1. Bacterial strains used in this study.

Bacterial	Strain No.
V. alginolyticus	ATCC17749
V. alginolyticus	VA Isolates-1
V. vulnificus	ATCC 27562
V. vulnificus	VV Isolates-1
V. cholerae	CICC 23794
V. parahaemolyticus	CICC 21528
Pseudomonas fluorescens	CICC 21620
Bacillus cereus	CMCC 63301
Enterobacter sakazakii	CICC 21563
Escherichia coli	CICC 21530
Listeria monocytogenes	CICC 21662
Staphylococcus aureus	CICC 22942
Salmonella enteritidis	CICC 21482

. All strains were maintained in 40% glycerol stocks at −80 °C in our laboratory. Before use, bacterial strains were streaked onto Luria–Bertani (LB) agar plates and incubated at 37 °C for activation. A single colony was subsequently inoculated into LB broth and cultured overnight at 37 °C with shaking. All Vibrio strains were cultured in LB medium supplemented with 3% (w/v) NaCl.

Genomic DNA was extracted as described previously [18]. Briefly, 1 mL of bacterial culture was centrifuged at 12,000× g for 5 min. The pellet was resuspended in 100 μL TE buffer, boiled in a water bath at 100 °C for 10 min, and immediately placed on ice for 10 min. After centrifugation at 12,000× g for 5 min, the supernatant containing genomic DNA was collected and stored at −20 °C until use.

2.2. Design of LAMP Primers, gDNAs, and Probes

Species-specific target genes, N646_RS01740 for V. alginolyticus and AOT11_08030 for V. vulnificus, were selected based on previous genomic screening in our laboratory. Four LAMP primer sets were designed for each target pathogen using PrimerExplorer V5 software (http://primerexplorer.jp/e/index.html, accessed on 7 November 2024) according to previously established LAMP primer design principles [19,20]. Primer sequences are listed in

Table 2. LAMP primer sequences designed for V. alginolyticus.

Primer Name		Sequences (5′→3′)
VA-614	F3	AGTTAATCAAGCCGCCTCAG
	B3	ACCCGAGCTCACAACCTC
	FIP	TAGAGCAAAGTAAGCTCGCTCGCAAAACGTTGCGCGTGAGTT
	BIP	TTAGAAACTGCCCTTCCCGAAGCTCTTAATTGGCTCGCTGTACG
	LF	TTGCATTGCTTAGTTGGC
	LB	CGTTTAAGCGGTGAAATAGG
VA-14	F3	AGTTAATCAAGCCGCCTCAG
	B3	ACCCGAGCTCACAACCTC
	FIP	TAGAGCAAAGTAAGCTCGCTCGCAAAACGTTGCGCGTGAGTT
	BIP	TTAGAAACTGCCCTTCCCGAAGCTCTTAATTGGCTCGCTGTACG
VA-28	F3	ACTGACTGGCTCGCTCAC
	B3	GGACGCAACCAACGATGA
	FIP	CGTCCGGCGATTTCTTCCAAACCAACCCTTCACGCTACCG
	BIP	GCTATGGTTCATGGTGGACCCTGCCCCGACAGATGTTGAG
	LB	ATCCGGCTTCAACCAATTCTGC
VA-618	F3	ATCGCAATTGGCCCTGTC
	B3	TGCAATAGCGTGAAGATGGC
	FIP	GTGCCGAAGCCGTATCACCACCCGTGTTTGGTGCGTCTA
	BIP	CCACCCTGGCACCAGTCAACGCGGTAAGCACTCTTTCTCA
	LF	CGTAGAAAATGCGAGCGGAAAAT
	LB	CAGAGTGTATTGAGGCTGCAC

and

Table 3. LAMP primer sequences designed for V. vulnificus.

Primer Name		Sequences (5′→3′)
VV-51	F3	ACTGCGAGTGGTTTCCATC
	B3	GCTCTCTGGTGAAGCAAGAA
	FIP	CGCCGGATACGTACCAAAGTGATCTACCATCACTTGCTTGGC
	BIP	AACTTGCTACCGAGACCCGCCCGGCTGAAATCGATCTCAT
	LF	TGAAGCATGGCCTTTTTGGC
VV-1	F3	ACTGCGAGTGGTTTCCATC
	B3	GCTCTCTGGTGAAGCAAGAA
	FIP	CGCCGGATACGTACCAAAGTGATCTACCATCACTTGCTTGGC
	BIP	AACTTGCTACCGAGACCCGCCCGGCTGAAATCGATCTCAT
VV-512	F3	CTGCGAGTGGTTTCCATCTC
	B3	TTCCTCTGTACTGGCTCTCT
	FIP	TTAAGCTGCGCTTTTTCGCCGCTTGGCTCACCCGACTCA
	BIP	CCGCTGAAGCATGGCCTTTTTGGGTGAAGCAAGAATCCCCG
	LF	GCAAAAGATCACTCGTGATGAGAT
VV-12	F3	CTGCGAGTGGTTTCCATCTC
	B3	TTCCTCTGTACTGGCTCTCT
	FIP	TTAAGCTGCGCTTTTTCGCCGCTTGGCTCACCCGACTCA
	BIP	CCGCTGAAGCATGGCCTTTTTGGGTGAAGCAAGAATCCCCG

.

To establish the PfAgo-mediated cleavage system, three groups of 16 nt gDNAs were designed for each pathogen using SnapGene 6.0.2 software. All gDNAs were synthesized with a 5′-phosphate modification to enable PfAgo loading. Corresponding molecular beacon (MB) probes labeled with fluorescent and quenching groups were also designed for fluorescence signal generation. The sequences of all gDNAs and probes are shown in

Table 4. gDNA and probe sequence for V. alginolyticus.

Primer Group		Sequences (5′→3′)
VA-gDNA1+2	VA-gDNA1	GGTATGGCCTTTTACA
	VA-gDNA2	ATCACAGGACAGCCAG
VA-gDNA3+4	VA-gDNA3	ATGGCCTTTTACAATC
	VA-gDNA4	ACAGGACAGCCAGCTG
VA-gDNA5+6	VA-gDNA5	CGGTATGGCCTTTTAC
	VA-gDNA6	AATCACAGGACAGCCA
MB	VA-MB	5′ 6-ROX-ATGGCCTTTTACAATCACAGGACAGCCAGCT-3′ BHQ-2

Note: All gDNAs were synthesized with a 5′-phosphate modification.

and

Table 5. gDNA and probe sequence for V. vulnificus.

Primer Group		Sequences (5′→3′)
VV-gDNAs1+2	VV-gDNA1	AAAGCGCAGCTTAATC
	VV-gDNA2	ACACGTTACCACTCAA
VV-gDNAs3+4	VV-gDNA3	AAGCGCAGCTTAATCA
	VV-gDNA4	CACGTTACCACTCAAT
VV-gDNAs5+6	VV-gDNA5	AGCGCAGCTTAATCAC
	VV-gDNA6	ACGTTACCACTCAATA
MB	VV-MB	5′-6-NED-AAGCGCAGCTTAATCACACGTTACCACTCA-3′BHQ2

Note: All gDNAs were synthesized with a 5′-phosphate modification.

. The design strategy was based on the programmable cleavage characteristics of Argonaute-mediated nucleic acid detection systems.

All primers, gDNAs, and molecular beacon probes were synthesized by GenScript Biotech Corporation (Nanjing, China). PfAgo (Cat. No. JY0316-L) was purchased from Tiosbio (Beijing, China). Bst 3.0 DNA polymerase, isothermal amplification buffer, and dNTPs were purchased from New England Biolabs (Ipswich, MA, USA).

2.3. LAMP Reaction and Optimization Conditions

The LAMP reaction was performed in a total volume of 25 μL containing outer primers (F3/B3, 0.2 μmol/L each), inner primers (FIP/BIP, 0.8 μmol/L each), loop primers (LF/LB, 0.4 μmol/L each), 1.4 mmol/L dNTPs, 6.0 mmol/L MgSO₄, 1× isothermal amplification buffer, 0.32 U/μL Bst 3.0 DNA polymerase, 2 μL genomic DNA template, and nuclease-free water to volume. Amplification was initially conducted at 65 °C for 40 min, consistent with commonly reported LAMP conditions for foodborne pathogen detection [8].

To improve amplification efficiency, key reaction parameters were systematically optimized, including Mg²⁺ concentration (2.0–10.0 mM), dNTP concentration (1.0–1.8 mM), amplification temperature (60–65 °C), Bst 3.0 DNA polymerase dosage, and inner-to-outer primer ratio (2:1–10:1). During optimization, only one parameter was varied at a time while all other reaction conditions were kept constant. Amplification performance was evaluated according to fluorescence intensity and threshold cycle (Ct) values obtained from real-time fluorescence monitoring.

2.4. Optimization of PfAgo-Mediated Cleavage Reaction Conditions

The PfAgo cleavage reaction was performed in a total volume of 20 μL containing 2 μL PfAgo protein (Tiosbio, JY0316-L), 1 μL gDNA, 0.5 μL Mn²⁺ solution, 2 μL 10× PfAgo Endonuclease Reaction Buffer (supplied with the commercial PfAgo protein), 1 μL molecular beacon probe, 2 μL LAMP product, and nuclease-free water to final volume. The final concentrations of gDNA, Mn²⁺, and molecular beacon probe were initially set at 0.5 μM, 1 mM, and 0.5 μM, respectively.

Following LAMP, the PfAgo-assisted nucleic acid detection step was performed as previously described with minor modifications [17]. In total, 2 μL of the LAMP product was transferred to the PfAgo cleavage reaction mixture. The PfAgo-mediated cleavage reaction was then incubated at 95 °C for 30 min, followed by fluorescence measurement. The fluorescence signal was generated through a target-dependent PfAgo cleavage cascade. Briefly, 5′-phosphorylated gDNAs guided PfAgo to cleave the LAMP amplicons at specific sites. The resulting short DNA fragments served as secondary guides to direct PfAgo-mediated cleavage of the molecular beacon probe, separating the fluorophore from the quencher and producing fluorescence signals [21].

The PfAgo cleavage system was further optimized by varying gDNA concentration (0–1.0 μmol/L), PfAgo protein dosage, Mn²⁺ concentration (0–1.0 mmol/L), and cleavage reaction time (5–30 min). All optimization experiments were performed under otherwise identical conditions, and fluorescence intensity was used as the primary evaluation indicator.

2.5. Specificity and Sensitivity Evaluation

The specificity of the developed LAMP-PfAgo assay was evaluated using genomic DNA extracted from target strains and non-target bacterial species listed in Table 1. Nuclease-free water was used as the negative control. Cross-reactivity within the tested bacterial panel was assessed according to fluorescence signal generation after amplification and PfAgo cleavage.

To determine the limit of detection (LOD), overnight cultures of V. alginolyticus and V. vulnificus were serially diluted 10-fold in sterile saline. Bacterial concentrations were determined by plate counting, and genomic DNA extracted from each dilution was used as the template for the optimized LAMP-PfAgo assay. The lowest bacterial concentration that consistently produced detectable fluorescence signals in three independent experiments was defined as the limit of detection (LOD), according to previously reported molecular diagnostic evaluation criteria [22].

2.6. Preparation of Artificially Contaminated Samples

Artificial contamination experiments were performed to evaluate the practical applicability of the LAMP-PfAgo method for detecting V. alginolyticus and V. vulnificus in food samples. Briefly, 22.5 g of salmon was placed into a stomacher bag containing 225 mL of alkaline peptone water (APW). Target bacterial suspensions were prepared at approximately 100-fold higher concentrations than the intended final contamination levels, with the highest prepared suspension concentration of approximately 10⁸ CFU·mL⁻¹. For each contamination level, 2.5 mL of bacterial suspension was added to the corresponding sample to obtain final bacterial concentrations ranging from approximately 10⁶ to 10⁰ CFU·mL⁻¹ in the homogenates. After homogenization, 1 mL of each homogenate was collected for genomic DNA extraction and tested using the established LAMP-PfAgo method.

2.7. Statistical Analysis

All experiments were performed in triplicate, and the results are presented as mean ± standard deviation (SD). Statistical analysis and graphical visualization were performed using GraphPad Prism 8.0 software (GraphPad Software, Boston, MA, USA). Differences among groups were analyzed by one-way analysis of variance (ANOVA), with p < 0.05 considered statistically significant. Different lowercase letters indicate significant differences among groups.

3. Results

3.1. Optimization of the LAMP System

The LAMP conditions were independently optimized for V. alginolyticus and V. vulnificus to establish efficient upstream amplification modules for the subsequent PfAgo-mediated detection assay. For V. alginolyticus, four primer sets were evaluated using genomic DNA as the template. Among them, VA-618 produced an early amplification curve with a stable fluorescence signal and was selected for further optimization (Figure 1a). The inner-to-outer (I/O) primer ratio was then screened, and an I/O ratio of 6:1 yielded rapid amplification onset with a high ΔRn value (Figure 1b). Further optimization showed that 1.4 mM dNTPs, 6 mM Mg²⁺, and 1.0 μL Bst 3.0 DNA polymerase supported rapid and stable amplification (Figure 1c–e). Although several temperatures generated detectable amplification, 65 °C provided rapid signal development and was selected as the reaction temperature for the V. alginolyticus LAMP assay (Figure 1f).

The same optimization strategy was applied to the V. vulnificus LAMP system. Primer set VV-51 showed the earliest amplification among the four candidate primer sets and was selected for subsequent assays (Figure 2a). Screening of primer ratios indicated that an I/O ratio of 4:1 produced rapid amplification and a strong fluorescence response (Figure 2b). For the reaction components, 1.8 mM dNTPs and 4 mM Mg²⁺ produced favorable amplification profiles (Figure 2c,d). In the Bst 3.0 DNA polymerase screening, the plotted curves indicate that 1.6 μL supported efficient amplification (Figure 2e). For temperature optimization, 65 °C enabled rapid amplification and was selected for the V. vulnificus LAMP reaction (Figure 2f). Together, these results established species-specific optimized LAMP systems for V. alginolyticus and V. vulnificus, providing reliable amplified products for downstream PfAgo cleavage.

3.2. Establishment and Optimization of the LAMP-PfAgo System

To identify the suitable gDNA combinations for PfAgo-mediated cleavage, three candidate gDNA groups were evaluated for both V. alginolyticus and V. vulnificus. For V. alginolyticus, the tested gDNA groups generated distinguishable fluorescence signals relative to the no-template control (NTC) (p < 0.05) (Figure 3a). For V. vulnificus, the candidate gDNA groups also differed in fluorescence intensity, allowing selection of the group with the strongest signal and clearest separation from the negative control (Figure 3b). These results demonstrated that different gDNA combinations exhibited distinct cleavage efficiencies toward amplified target sequences. Therefore, the VA-gDNA1+2 combination for V. alginolyticus and the VV-gDNA3+4 combination for V. vulnificus were selected for subsequent optimization experiments.

The reaction parameters of the PfAgo cleavage system were further optimized to improve fluorescence signal intensity and detection efficiency for both target pathogens. For the V. alginolyticus detection system, fluorescence intensity increased with increasing gDNA and Mn²⁺ concentrations and reached maximum values at 0.75 μM gDNA and 0.75 mM Mn²⁺, respectively (Figure 4a,c). The highest fluorescence signal was obtained with 8 μL PfAgo protein (Figure 4b). Thus, the optimized PfAgo cleavage conditions for V. alginolyticus were 0.75 μM gDNA, 0.75 mM Mn²⁺, and 8 μL PfAgo protein.

For the V. vulnificus detection system, the optimized conditions were identified as 1.0 μM gDNA, 0.5 mM Mn²⁺, and 6 μL PfAgo protein, based on the highest fluorescence intensities observed under these conditions (Figure 5a–c).

3.3. Sensitivity and Specificity Evaluation

The specificity and sensitivity of the optimized LAMP-PfAgo systems for V. alginolyticus and V. vulnificus were evaluated using target and non-target bacterial strains.

For the V. alginolyticus detection system, strong fluorescence signals were observed only for the standard strain and isolates of V. alginolyticus, whereas non-target bacteria produced weak signals and were judged negative (Figure 6a). These results indicate that the assay specifically detected the tested V. alginolyticus strains within the bacterial panel used in this study. In the sensitivity assay, positive fluorescence signals were detected in bacterial suspensions ranging from 3 × 10⁶ to 3 × 10¹ CFU·mL⁻¹, whereas the fluorescence intensity at 3 × 10⁰ CFU·mL⁻¹ did not differ significantly from the negative sample (Figure 6b). The LOD of the V. alginolyticus LAMP-PfAgo assay was determined to be 3 × 10¹ CFU·mL⁻¹.

The V. vulnificus detection system exhibited specific detection of the tested V. vulnificus strains, with no obvious fluorescence signals observed for the non-target bacteria included in this study (Figure 7a). In the sensitivity evaluation, the LOD of the V. vulnificus LAMP-PfAgo assay was 10² CFU·mL⁻¹ (Figure 7b).

3.4. Artificial Contamination Assay

To assess the applicability of the LAMP-PfAgo assay in a food matrix, salmon samples artificially contaminated with V. alginolyticus or V. vulnificus were analyzed without enrichment culture after boiling-based DNA extraction (Figure 8a). For V. alginolyticus, real-time fluorescence curves increased rapidly for samples prepared with final contamination levels from 2.9 × 10⁶ to 2.9 × 10² CFU·mL⁻¹ in the sample homogenate, whereas lower concentrations remained at background levels (Figure 8b). Endpoint fluorescence analysis further separated the positive groups from the negative controls, with robust ΔRn values retained at the 2.9 × 10² CFU·mL⁻¹ level (Figure 8c). Similar results were obtained for V. vulnificus. Positive fluorescence curves were observed for salmon samples prepared with final contamination levels from 7.3 × 10⁶ to 7.3 × 10² CFU·mL⁻¹ in the sample homogenate, while the 7.3 × 10¹ and 7.3 × 10⁰ CFU·mL⁻¹ groups remained comparable to the no-template control (Figure 8d). Endpoint fluorescence analysis confirmed that the positive groups were distinguishable from the negative controls down to 7.3 × 10² CFU·mL⁻¹ (Figure 8e). These results indicate that the LAMP-PfAgo assay can detect both V. alginolyticus and V. vulnificus in salmon samples under the tested conditions. For both pathogens, the practical detection limit was approximately 10² CFU·mL⁻¹ in the final homogenate.

4. Discussion

This study establishes a two-step LAMP-PfAgo workflow that couples rapid isothermal amplification with Argonaute-mediated sequence verification for the detection of V. alginolyticus and V. vulnificus. LAMP provides high-yield amplification under constant temperature, whereas PfAgo adds a programmable cleavage step guided by short gDNAs. In this assay, molecular beacon cleavage is mediated by target-derived secondary guide fragments generated after PfAgo cleavage of the LAMP amplicons. This two-layer recognition strategy is well suited to Vibrio detection, where closely related species and nonspecific amplification can complicate interpretation.

V. alginolyticus and V. vulnificus are both important marine and seafood-associated pathogens, but their high relatedness to other Vibrio species can make species-level identification difficult [6]. Culture-based identification remains reliable but is time-consuming, whereas conventional PCR shortens detection time but still requires thermal cycling instrumentation and laboratory infrastructure, with reported detection limits typically around 10²–10³ CFU mL⁻¹ [23]. Although traditional LAMP assays are sensitive, their reliance on nonspecific signal readouts can lead to false-positive results [8]. The PfAgo-mediated secondary recognition step used here addresses this limitation by adding sequence verification after LAMP, thereby improving confidence in positive signals while preserving the simplicity of a two-step workflow. Consistent with this design, the assay achieved a detection limit of 3 × 10¹ CFU mL⁻¹ for V. alginolyticus and remained detectable in salmon samples without enrichment, with a practical detection limit of 2.9 × 10² CFU mL⁻¹ in the final sample. For V. vulnificus detection, Tian et al. established a visual LAMP assay targeting the gyrB gene, with a reported analytical sensitivity of 10 fg·μL⁻¹ genomic DNA and a 30 min reaction at 65 °C [24]. Yang et al. developed an RPA-lateral flow strip assay for raw seafood that completed detection within 35 min at 37 °C, with a sensitivity of 2 copies or 10⁻¹ CFU per reaction; in spiked seafood samples, the method detected 1 CFU per 10 g after enrichment [25]. A concise comparison of the present assay with representative nucleic acid detection methods is provided in

Table 6. Comparison of the present LAMP-PfAgo assay with previously reported nucleic acid detection methods for related foodborne pathogens.

Target	Method	LOD	Assay Time	Equipment/Readout	Sample	Reference
V. alginolyticus V. vulnificus	LAMP-PfAgo	3 × 101 CFU·mL−1 for V. alginolyticus, 102 CFU·mL−1 for V. vulnificus, 2.9 × 102 CFU·mL−1 in the final sample for V. alginolyticus and 7.3 × 102 CFU·mL−1 in the final sample for V. vulnificus	40 min LAMP and 30 min PfAgo cleavage	Constant-temperature amplification device plus fluorescence readout	Bacterial suspensions, spiked salmon	This study
V. vulnificus	Visual LAMP	10 fg uL−1 genomic DNA	30 min at 65 °C	Water bath or heating block, visual readout	Aquatic products and environmental water	[24]
V. vulnificus	RPA-LFS	2 genome copies or 10−1 CFU per reaction, 1 CFU/10 g in spiked seafood after enrichment	35 min at 37 °C	Low-temperature incubator plus lateral flow strip	Raw seafood	[25]
V. vulnificus	RAA-CRISPR/Cas12a	2 copies per reaction	40 min	Isothermal amplification plus UV/fluorescence visual readout	Spiked blood, stool and shrimp samples	[26]
V. cholerae V. vulnificus	Duplex RPA-LFS	101 gene copies per reaction, 1 CFU/10 g in spiked food	30 min at 37 °C and 5 min strip visualization	Low-temperature incubator plus three-segment lateral flow strip	Spiked shrimp and clinical samples	[27]
V. vulnificus	RAA combined with dual-target test strip	10 CFU·mL−1 for gyrB and 100 CFU·mL−1 for vvhA	Within 50 min including sample preparation	Low-temperature isothermal amplification plus test strip/smartphone grayscale analysis	Oyster, fish and shrimp	[28]
V. alginolyticus	RPA-CRISPR/Cas13a-LFD	10 copies uL−1	<50 min	Isothermal amplification plus lateral flow dipstick	Bacterial isolates and infected mouse blood	[7]
E. coli O157:H7 S. aureus, S. typhimurium C. sakazakii	Endo V-activated PfAgo detection (VPN)	101 CFU·mL−1 for four foodborne pathogens	RPA/Endo V step plus 40 min PfAgo cleavage	Isothermal amplification plus fluorescence readout	Beef and milk samples	[29]

Note: LOD values are reported as described in the cited studies and are not directly interchangeable because template types, sample preparation procedures and matrix validation differed among assays. RPA, recombinase polymerase amplification; RAA, recombinase-aided amplification; LFS/LFD, lateral flow strip/dipstick.

. Compared with these assays, the present LAMP-PfAgo method retains the rapid and simple features of isothermal amplification, while introducing PfAgo-mediated sequence verification after amplification. This additional recognition step provides stronger target confirmation and may reduce false-positive signals caused by nonspecific amplification, which is advantageous for species-level identification of closely related Vibrio pathogens.

Compared with CRISPR-Cas-based detection systems, the LAMP-PfAgo assay offers a complementary route with flexible target design. LAMP-CRISPR/Cas12a assays can achieve extremely low detection limits [30], but Cas12a recognition depends on PAM sequences and requires careful reaction optimization [11]. In addition, Cas13a-based assays require an additional transcription step, which increases assay complexity and time [31]. In contrast, PfAgo does not require PAM sequences and uses short, stable gDNAs for target recognition [13]. Previous studies have shown that Ago-based detection systems combined with isothermal amplification can reach detection limits as low as 6.68 CFU·mL⁻¹ [32], supporting the broader feasibility of this strategy.

The specificity results further support the value of the PfAgo verification step. The developed assay distinguished the tested target Vibrio species from the non-target bacteria included in this study. This is important because high genetic similarity among Vibrio species can cause misidentification in some molecular assays [33]. The PfAgo-mediated sequence-specific cleavage therefore helps compensate for the nonspecific amplification risk inherent to LAMP [14]. V. cholerae and V. parahaemolyticus are also major seafood-associated pathogens with greater recognized importance in human disease. In the present study, they were included as non-target Vibrio species for specificity evaluation, whereas V. alginolyticus and V. vulnificus were selected as target organisms to evaluate the LAMP-PfAgo strategy. Although the specificity panel included V. parahaemolyticus and V. cholerae as seafood- and foodborne-associated non-target Vibrio species, other closely related species, such as V. fluvialis, V. mimicus, and V. harveyi, were not included in the present study. In addition, V. vulnificus biotype information was not fully evaluated in the present study. Therefore, further validation using defined biotype 1 and biotype 2 strains is needed before extending the assay claim to all V. vulnificus biotypes. Including these species in future studies would further strengthen the specificity evaluation and support broader validation of the assay using closely related Vibrio species and foodborne or environmental isolates.

The artificial contamination experiment demonstrated that the assay can detect both V. alginolyticus and V. vulnificus in salmon samples with a practical LOD of approximately 10² CFU·mL⁻¹ in the final sample homogenate under the tested conditions. This workflow is faster than conventional culture-based methods, which often require 24–72 h [23], and may be more suitable for rapid screening in food safety monitoring. However, performance in additional seafood matrices and field settings remains to be evaluated.

Overall, the LAMP-PfAgo assay combines LAMP-based isothermal amplification with sequence-specific Argonaute cleavage. Within the tested sample types and bacterial panels, this strategy improved analytical specificity while maintaining practical sensitivity, supporting its further development for on-site foodborne pathogen detection.

5. Conclusions

This study demonstrates a two-step LAMP-PfAgo detection strategy for V. alginolyticus and V. vulnificus that combines rapid LAMP with guide-directed Argonaute cleavage. The assay achieved specific detection of the tested target strains with limits of detection of 3 × 10¹ CFU·mL⁻¹ for V. alginolyticus and 10² CFU·mL⁻¹ for V. vulnificus. In artificially contaminated salmon samples, the practical detection limits were 2.9 × 10² CFU·mL⁻¹ for V. alginolyticus and 7.3 × 10² CFU·mL⁻¹ for V. vulnificus in the final homogenates. These results support LAMP-PfAgo as a practical route for sequence-verified seafood pathogen screening, while further work is needed to validate broader matrices, closed-tube operation, and multiplex detection.