Prevalence, Virulence and Antimicrobial Resistance of Vibrio cholerae in Aquatic Products and Aquaculture Environment in Shanghai
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Analysis of Vibrio Species
2.3. Identification of Virulence Genes and Antimicrobial Resistance Genes
2.4. Antimicrobial Susceptibility Tests of V. cholerae Isolates
2.5. Analysis of the Genetic Diversity of V. cholerae
2.6. Data Processing and Analysis
3. Results
3.1. Water Temperature, pH, and Salinity
3.2. Distribution and Serotypes of V. cholerae
3.3. Virulence Genes of V. cholerae Isolates
3.4. Antimicrobial Resistance Patterns of V. cholerae Isolates and Analysis of V. cholerae Resistance in Different Aquatic Samples
3.5. Antimicrobial Resistance Analysis of V. cholerae in Shrimp and Fish
3.6. Detection of V. cholerae Drug Resistance Genes
3.7. Analysis of Genetic Diversity
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
| Type of Samples (Total Sample Numbers) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sample Numbers in Different Quarters | Sample Numbers in Different Districts | ||||||||||
| Spring | Summer | Autumn | Winter | Jinshan District | Fengxian District | Qingpu District | Chongming District | Pudong New District | Jiading District | Baoshan District | Songjiang District |
| Greenhouse-cultured shrimp (n = 13) | |||||||||||
| 4 | 6 | 3 | - | 7 | 6 | - | - | - | - | - | - |
| Greenhouse-cultured shrimp culture water (n = 13) | |||||||||||
| 5 | 5 | 3 | - | 6 | 7 | - | - | - | - | - | - |
| Greenhouse-shrimp culture sediment (n = 13) | |||||||||||
| 5 | 5 | 3 | - | 6 | 7 | - | - | - | - | - | - |
| Open-air-cultured shrimp (n = 24) | |||||||||||
| 4 | 14 | 6 | - | 13 | 11 | - | - | - | - | - | - |
| Open-air-cultured shrimp culture water (n = 25) | |||||||||||
| 4 | 14 | 7 | - | 15 | 10 | - | - | - | - | - | - |
| Open-air-cultured shrimp culture sediment (n = 25) | |||||||||||
| 4 | 14 | 7 | - | 15 | 10 | - | - | - | - | - | - |
| Grass carp (n = 18) | |||||||||||
| 3 | 5 | 5 | 5 | 2 | 1 | 14 | - | - | 1 | - | - |
| Crucian carp (n = 17) | |||||||||||
| 3 | 3 | 5 | 6 | 3 | 1 | 12 | - | - | 1 | - | - |
| Fish culture water (n = 27) | |||||||||||
| 6 | 5 | 5 | 11 | 5 | 2 | 18 | - | - | 2 | - | - |
| Fish culture sediment (n = 25) | |||||||||||
| 4 | 5 | 5 | 11 | 5 | - | 18 | - | - | 2 | - | - |
| Crab (n = 10) | |||||||||||
| - | - | 10 | - | - | - | 3 | 3 | 2 | - | 1 | 1 |
| Crab culture water (n = 14) | |||||||||||
| - | - | 14 | - | - | - | 3 | 5 | 3 | - | 2 | 1 |
| Crab culture sediment (n = 14) | |||||||||||
| - | - | 14 | - | - | - | 3 | 5 | 3 | - | 2 | 1 |
| Total (n = 238) | |||||||||||
| Primer Name | Sequences (5′–3′), F/R | Annealing Temperature (°C) | Fragment Size (bp) | References |
|---|---|---|---|---|
| Serotype | ||||
| O1 | GTTTCACTGAACAGATGGG | 59 | 192 | [51] |
| GGTCATCTGTAAGTACAAC | ||||
| O139 | AGCCTCTTTATTACGGGTGG | 59 | 449 | [51] |
| GTCAAACCCGATCGTAAAGG | ||||
| Virulence gene | ||||
| ctxA | CTCAGACGGGATTTGTTAGGCACG | 55 | 302 | [8] |
| TCTATCTCTGTAGCCCCTATTACG | ||||
| ctxB | GGTTGCTTCTCATCATCGAACCAC | 58 | 460 | [8] |
| GATACACATAATAGAATTAAGGAT | ||||
| ctxAB | TGAAATAAAGCAGTCAGGTG | 50 | 778 | [19] |
| GGTATTCTGCACACAAATCAG | ||||
| tcpA | ATGCAATTATTAAAACAGCTTTTTAAG | 52 | 675 | [19] |
| TTAGCTGTTACCAAATGCAACAG | ||||
| ace | GCTTATGATGGACACCCTTTA | 55 | 283 | [8] |
| GTTTAACGCTCGCAGGGCAAA | ||||
| zot | CACTGTTGGTGATGAGCGTTATCG | 56 | 244 | [8] |
| TTTCACTTCTACCCACAGCGCTTG | ||||
| hap | GTGAACAACACGCTGGAGAA | 50 | 700 | [8] |
| CGTTGATATCCACCAAAGG | ||||
| hlyA | CAATCGTTGCGCAATCGCG | 50 | 265 | [8] |
| TTGACCTTCAGCATCACT | ||||
| rtxA | GATTCTTCCGTTCAAGCTCCG | 60 | 2751 | [8] |
| TGGTTCAGGCTGTTGCACAC | ||||
| rtxC | CGACGAAGATCATTGACGAC | 50 | 263 | [8] |
| CATCGTCGTTATGTGGTTGC | ||||
| ompU | CCAAAGCGGTGACAAAGC | 50 | 655 | [8] |
| TTCCATGCGGTAAGAAGC | ||||
| chxA | TGGTGAAGATTCTCCTGCAA | 50 | 421 | [52] |
| CTTGGAGAAATGGATGCGCTG | ||||
| mshA | AAAAGTCGACAGCGAAAGCGAATAGTGG | 50 | 380 | [52] |
| AAAAGGATCCATTGCACCAGCAACTGCACC | ||||
| pilA | GCGATTGCAATTCCTCAA | 56 | 227 | [19] |
| CCTAATGCACCTGATGCT | ||||
| stn/sto | TCGCATTTAGCCAAACAGTAGAAA | 50 | 172 | [52] |
| GCTGGATTGCAACATATTTCGC | ||||
| Antimicrobial resistance gene | ||||
| β-lactams | ||||
| CARB | CAAGTACTTTYAAAACAATAGC | 48 | 535 | [53] |
| GCTGTAATACTCCKAGCAC | ||||
| blaSHV | GCGAAAGCCAGCTGTCGGGC | 62 | 304 | [54] |
| GATTGGCGGCGCTGTTATCGC | ||||
| blaTEM | ATAAAATTCTTGAAGACGAAA | 50 | 1080 | [55] |
| GACAGTTACCAATGCTTAATC | ||||
| NDM-1 | GGTTTGGCGATCTGGTTTTC | 52 | 621 | [56] |
| CGGAATGGCTCATCACGATC | ||||
| blaCTX-M | CGCTTTGCGATGTGCAG | 52 | 550 | [55] |
| ACCGCGATATCGTTGGT | ||||
| AmpC | TGATTAGCGTGTCCTATGGTGA | 60 | 1373 | [57] |
| GTCAGTAAGGCCCCCTGTTT | ||||
| Sulfonamides | ||||
| sul1 | AGGGGGC AGATGTGATCGC | 55 | 626 | [58] |
| TGTGCGGATGAAGTCAGCTCC | ||||
| sul2 | TCCGGTGGAGGCCGGTATCTGG | 55 | 191 | [58] |
| CGGGAATGCCATCTGCCTTGAG | ||||
| sul3 | TCCGTTCAGCGAATTGGTGCAG | 58 | 128 | [59] |
| TTCGTTCACGCCTTACACCAGC | ||||
| sulA | TCTTGAGCAAGCACTCCAGCAG | 58 | 299 | [59] |
| TCCAGCCTTAGCAACCACATGG | ||||
| dfrA1 | CAAGTTTACATCTGACAATGAGAACGTAT | 60 | 277 | [60] |
| ACCCTTTTGCCAGATTTGGTA | ||||
| dfrA18 | ACTGCCGTTTTCGATAATGTGG | 60 | 389 | [60] |
| TGGGTAAGACACTCGTCATGGG | ||||
| Macrolides | ||||
| ermB | AAAACTTACCCGCCATACCA | 55 | 141 | [54] |
| TTTGGCGTGTTTCATTGCTT | ||||
| ermC | GAAATCGGCTCAGGAAAAGG | 55 | 185 | [59] |
| TAGCAAACCCGTATTCCACG | ||||
| mefA | ATACCCCAGCACTCAATTCG | 56 | 186 | [61] |
| CAATCACAGCACCCAATACG | ||||
| mefC | GCTCCGGCACTACAGGCAAT | 56 | 117 | [62] |
| GCCAATGGCAGGACCACCAA | ||||
| Aminoglycoside | ||||
| aph3a | TAACAGCGATCGCGTATTTCG | 52 | 250 | [62] |
| TCCGACTCGTCCAACATCAATA | ||||
| aac(6′)-Ib | TATGAGTGGCTAAATCGAT | 55 | 395 | [63] |
| CCCGCTTTCTCGTAGCA | ||||
| armA | AGGTTGTTTCCATTTCTGAG | 53 | 591 | [64] |
| TCTCTTCCATTCCCTTCTCC | ||||
| rmtB | ATGAACATCAACGATGCCCT | 56 | 769 | [63] |
| CCTTCTGATTGGCTTATCCA | ||||
| aadA | ATCCTTCGGCGCGATTTTG | 56 | 283 | [65] |
| GCAGCGCAATGACATTCTTG | ||||
| aadE | ATGGAATTATTCCCACCTGA | 50 | 386 | [65] |
| TCAAAACCCCTATTAAAGCC | ||||
| Tetracyclines | ||||
| tetA | GCGCTNTATGCGTTGATGCA | 62 | 387 | [59] |
| ACAGCCCGTCAGGAAATT | ||||
| tetB | TACGTGAATTTATTGCTTCGG | 60 | 206 | [66] |
| ATACAGCATCCAAAGCGCAC | ||||
| tetM | TCAGTGGGAAAATACGAAGGTG | 56 | 140 | [59] |
| GAGTTTGTGCTTGTACGCCATC | ||||
| tetO | ACGGARAGTTTATTGTATACC | 56 | 171 | [59] |
| TGGCGTATCTATAATGTTGAC | ||||
| tetQ | AGAATCTGCTGTTTGCCAGTG | 56 | 169 | [59] |
| CGGAGTGTCAATGATATTGCA | ||||
| tetS | GAAAGCTTACTATACAGTAGC | 56 | 170 | [59] |
| AGGAGTATCTACAATATTTAC | ||||
| tetW | GAGAGCCTGCTATATGCCAGC | 56 | 168 | [59] |
| GGGCGTATCCACAATGTTAAC | ||||
| tetX | AGCCTTACCAATGGGTGTAAA | 56 | 280 | [59] |
| TTCTTACCTTGGACATCCCG | ||||
| Chloramphenicol | ||||
| floR | CGCCGTCATTCCTCACCTTC | 50 | 215 | [67] |
| GATCACGGGCCACGCTGTGTC | ||||
| cmlA | GCCAGCAGTGCCGTTTAT | 55 | 158 | [68] |
| GGCCACCTCCCAGTAGAA | ||||
| catI | GGTGATATGGGATAGTGTT | 52 | 348 | [53] |
| CCATCACATACTGCATGATG | ||||
| catII | GATTGACCTGAATACCTGGAA | 54 | 567 | [53] |
| CCATCACATACTGCATGATG | ||||
| catIII | CCATACTCATCCGATATTGA | 52 | 275 | [53] |
| CCATCACATACTGCATGATG | ||||
| catIV | CCGGTAAAGCGAAATTGTAT | 54 | 451 | [53] |
| CCATCACATACTGCATGATG |
| Classes of Antimicrobials | Antimicrobials | Concentration of Solution (μg/mL) | MIC of Vc (μg/mL) | |||
|---|---|---|---|---|---|---|
| Susceptible | Intermediate | Resistant | ||||
| β-lactams | Penicillins | Ampicillin (AMP) | 5120 | ≤8 | 16 | ≥32 |
| Carbapenems | Meropenem (MEM) | 5120 | ≤1 | 2 | ≥4 | |
| Imipenem (IPM) | 10240 | ≤1 | 2 | ≥4 | ||
| 1st-Generation Cephalosporins | Cefazolin (CZO) | 5120 | ≤2 | 4 | ≥8 | |
| 2nd-Generation Cephalosporins | Cefoxitin (FOX) | 5120 | ≤8 | 16 | ≥32 | |
| 3rd-Generation Cephalosporins | Cefotaxime (CTX) | 5120 | ≤1 | 2 | ≥4 | |
| 4th-Generation Cephalosporins | Cefepime (FEP) | 5120 | ≤2 | 4-8 | ≥16 | |
| Tetracyclines | Tetracycline (TET) | 5120 | ≤4 | 8 | ≥16 | |
| Doxycycline (DOX) | 5120 | ≤4 | 8 | ≥16 | ||
| Chloramphenicol | Chloromycetin (CHL) | 5120 | ≤8 | 16 | ≥32 | |
| Sulfonamides | Sulfamethoxazole (SMX) | 4864 | ≤38 | - | ≥76 | |
| Cotrimoxazole (SXT) | 4864/256 | 38/2 | - | 76/4 | ||
| Macrolides | Erythromycin (ERY) | 5120 | ≤0.5 | 1-4 | ≥8 | |
| Azithromycin (AZM) | 5120 | ≤2 | 4 | ≥8 | ||
| Aminoglycoside | Gentamycin (GEN) | 5120 | ≤4 | 8 | ≥16 | |
| Kanamycin (KAN) | 5120 | ≤16 | 32 | ≥64 | ||
| Nitrofurans | Nitrofurantoin (NIT) | 5120 | ≤32 | 64 | ≥128 | |
References
- El-Zamkan, M.A.; Ahmed, A.S.; Abdelhafeez, H.H.; Mohamed, H.M.A. Molecular characterization of Vibrio species isolated from dairy and water samples. Sci. Rep. 2023, 13, 15368. [Google Scholar] [CrossRef]
- Robert-Pillot, A.; Copin, S.; Himber, C.; Gay, M.; Quilici, M.-L. Occurrence of the three major Vibrio species pathogenic for human in seafood products consumed in France using real-time PCR. Int. J. Food Microbiol. 2014, 189, 75–81. [Google Scholar] [CrossRef]
- van Kessel, J.C.; Camilli, A. Vibrio cholerae: A fundamental model system for bacterial genetics and pathogenesis research. J. Bacteriol. 2024, 206, e0024824. [Google Scholar] [CrossRef]
- Clemens, J.D.; Nair, G.B.; Ahmed, T.; Qadri, F.; Holmgren, J. Cholera. Lancet 2017, 390, 1539–1549. [Google Scholar] [CrossRef] [PubMed]
- Mandal, S.; Mandal, M.D.; Pal, N.K. Cholera: A great global concern. Asian Pac. J. Trop. Med. 2011, 4, 573–580. [Google Scholar] [CrossRef]
- Xu, M.; Wu, J.; Chen, L. Virulence, antimicrobial and heavy metal tolerance, and genetic diversity of Vibrio cholerae recovered from commonly consumed freshwater fish. Environ. Sci. Pollut. Res. 2019, 26, 27338–27352. [Google Scholar] [CrossRef] [PubMed]
- Valarikova, J.; Korcova, J.; Ziburova, J.; Rosinsky, J.; Cizova, A.; Bielikova, S.; Sojka, M.; Farkas, P. Potential pathogenicity and antimicrobial resistance of aquatic Vibrio isolates from freshwater in Slovakia. Folia Microbiol. 2020, 65, 545–555. [Google Scholar] [CrossRef]
- Gao, X.; Miao, Z.; Li, X.; Chen, N.; Gu, W.; Liu, X.; Yang, H.; Wei, W.; Zhang, X. Pathogenicity of non-O1/O139 Vibrio cholerae and its induced immune response in Macrobrachium rosenbergii. Fish Shellfish Immunol. 2019, 92, 300–307. [Google Scholar] [CrossRef] [PubMed]
- Dua, P.; Karmakar, A.; Ghosh, C. Virulence gene profiles, biofilm formation, and antimicrobial resistance of Vibrio cholerae non-O1/non-O139 bacteria isolated from West Bengal, India. Heliyon 2018, 4, e01040. [Google Scholar] [CrossRef]
- Gugliandolo, C.; Carbone, M.; Fera, M.T.; Irrera, G.P.; Maugeri, T.L. Occurrence of potentially pathogenic vibrios in the marine environment of the Straits of Messina (Italy). Mar. Pollut. Bull. 2005, 50, 692–697. [Google Scholar] [CrossRef]
- O’Flaherty, E.; Cummins, E. antimicrobial resistance in surface water ecosystems: Presence in the aquatic environment, prevention strategies, and risk assessment. Hum. Ecol. Risk Assess. 2017, 23, 299–322. [Google Scholar] [CrossRef]
- Capkin, E.; Terzi, E.; Altinok, I. Occurrence of antimicrobial resistance genes in culturable bacteria isolated from Turkish trout farms and their local aquatic environment. Dis. Aquat. Org. 2015, 114, 127–137. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Ye, F.; Qu, J.; Dai, Z. Insight into the antimicrobial Resistance of Bacteria Isolated from Popular Aquatic Products Collected in Zhejiang, China. Pol. J. Microbiol. 2023, 72, 61–67. [Google Scholar] [CrossRef]
- Liu, J.; Wu, Q.; Xu, H.; Pan, Y.; Malakar, P.K.; Zhao, Y.; Zhang, Z. Change of antimicrobial resistance in Vibrio spp. during shrimp culture in Shanghai. Aquaculture 2024, 580, 740303. [Google Scholar] [CrossRef]
- Karen Alvarez-Contreras, A.; Irma Quinones-Ramirez, E.; Vazquez-Salinas, C. Prevalence, detection of virulence genes and antimicrobial susceptibility of pathogen Vibrio species isolated from different types of seafood samples at "La Nueva Viga" market in Mexico City. Antonie Van Leeuwenhoek Int. J. Gen. Mol. Microbiol. 2021, 114, 1417–1429. [Google Scholar] [CrossRef] [PubMed]
- Wali, K.B.; Essiet, U.U.; Ajayi, A.; Akintunde, G.; Olukoya, D.K.; Adeleye, A.I.; Smith, S.I. Molecular diversity and antimicrobial susceptibility profile of Vibrio species and distribution of other bacteria isolated from water Hyacinth (Eichornia crassipes) and Lagos lagoon. Biologia 2024, 79, 2189–2202. [Google Scholar] [CrossRef]
- Abowei, J.F.N. Salinity, dissolved oxygen, pH and surface water temperature conditions in Nkoro River, Niger Delta, Nigeria. Adv. J. Food Sci. Technol. 2010, 2, 36–40. [Google Scholar]
- SN/T 1022-2010; Detection of Vibrio Cholerae in Food for Import and Export. General Administration of Quality Supervision: Beijing, China, 2010.
- Fu, H.; Yu, P.; Liang, W.; Kan, B.; Peng, X.; Chen, L. Virulence, Resistance, and Genomic Fingerprint Traits of Vibrio cholerae Isolated from 12 Species of Aquatic Products in Shanghai, China. Microb. Drug Resist. 2020, 26, 1526–1539. [Google Scholar] [CrossRef] [PubMed]
- Titilawo, Y.; Sibanda, T.; Obi, L.; Okoh, A. Multiple antimicrobial resistance indexing of Escherichia coli to identify high-risk sources of faecal contamination of water. Environ. Sci. Pollut. Res. 2015, 22, 10969–10980. [Google Scholar] [CrossRef]
- Mejdi, S.; Emira, N.; Ali, M.; Hafedh, H.; Amina, B. Biochemical characteristics and genetic diversity of Vibrio spp. and Aeromonas hydrophila strains isolated from the Lac of Bizerte (Tunisia). World J. Microbiol. Biotechnol. 2010, 26, 2037–2046. [Google Scholar] [CrossRef]
- Padovan, A.; Siboni, N.; Kaestli, M.; King, W.L.; Seymour, J.R.; Gibb, K. Occurrence and dynamics of potentially pathogenic vibrios in the wet-dry tropics of northern Australia. Mar. Environ. Res. 2021, 169, 105405. [Google Scholar] [CrossRef]
- Gonçalves, E.d.G.d.R.; Lopes, M.J.S.; Oliveira, E.G.d.; Hofer, E. Associação de Vibrio cholerae com o zooplâncton de águas estuárias da Baía de São Marcos/São Luis—MA, Brasil. Rev. Soc. Bras. Med. Trop. 2004, 37, 318–323. [Google Scholar] [CrossRef]
- Machado, A.; Bordalo, A.A. Detection and Quantification of Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus in Coastal Waters of Guinea-Bissau (West Africa). Ecohealth 2016, 13, 339–349. [Google Scholar] [CrossRef]
- Batabyal, P.; Mookerjee, S.; Einsporn, M.H.; Lara, R.J.; Palit, A. Environmental drivers on seasonal abundance of riverine-estuarine V. cholerae in the Indian Sundarban mangrove. Ecol. Indic. 2016, 69, 59–65. [Google Scholar] [CrossRef]
- Sullivan, T.J.; Neigel, J.E. Effects of temperature and salinity on prevalence and intensity of infection of blue crabs, Callinectes sapidus, by Vibrio cholerae, V. parahaemolyticus, and V. vulnificus in Louisiana. J. Invertebr. Pathol. 2018, 151, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, H.A.; El Bayomi, R.M.; Hussein, M.A.; Khedr, M.H.E.; Remela, E.M.A.; El-Ashram, A.M.M. Molecular characterization, antimicrobial resistance pattern and biofilm formation of Vibrio parahaemolyticus and V-cholerae isolated from crustaceans and humans. Int. J. Food Microbiol. 2018, 274, 31–37. [Google Scholar] [CrossRef]
- Pal, B.B.; Samal, D.; Nayak, S.R.; Pany, S. Spectrum of ctxB genotypes, antibiogram profiles and virulence genes of Vibrio cholerae serogroups isolated from environmental water sources from Odisha, India. BMC Microbiol. 2023, 23, 75. [Google Scholar] [CrossRef] [PubMed]
- Igere, B.E.; Okoh, A.I.; Nwodo, U.U. Atypical and dual biotypes variant of virulent SA-NAG-Vibrio cholerae: An evidence of emerging/evolving patho-significant strain in municipal domestic water sources. Ann. Microbiol. 2022, 72, 3. [Google Scholar] [CrossRef]
- Zago, V.; Zambon, M.; Civettini, M.; Zaltum, O.; Manfrin, A. Virulence-associated factors in Vibrio cholerae non-O1/non-O139 and V. mimicus strains isolated in ornamental fish species. J. Fish Dis. 2017, 40, 1857–1868. [Google Scholar] [CrossRef]
- Li, X.; Wu, Y.; Sun, X.; Ma, J.; Li, X.; Liu, C.; Xie, H. Non-O1/non-O139 Vibrio cholerae bacteraemia in mainland China from 2005 to 2019: Clinical, epidemiological and genetic characteristics. Epidemiol. Infect. 2020, 148, e186. [Google Scholar] [CrossRef]
- Hageman, S.J. Regulation of Hemagglutinin/Protease (HAP) in Classical and El Tor Biotype Vibrio cholerae Strains; California State University: Fresno, CA, USA, 2004. [Google Scholar]
- Kislichkina, A.A.; Stepanshina, V.N.; Nizova, A.V.; Maiskaia, N.V.; Mukhina, T.N.; Mironova, R.I.; Shemiakin, I.G. Vibrio cholerae strains certification. Zhurnal Mikrobiol. Epidemiol. Immunobiol. 2012, 6, 22–26. [Google Scholar]
- Meyer, N.; Stephan, R.; Cernela, N.; Horlbog, J.A.; Biggel, M. Genomic characteristics of clinical non-toxigenic Vibrio cholerae isolates in Switzerland: A cross-sectional study. Swiss Med. Wkly. 2024, 154, 3437. [Google Scholar] [CrossRef]
- Chow, K.H.; Ng, T.K.; Yuen, K.Y.; Yam, W.C. Detection of RTX toxin gene in Vibrio cholerae by PCR. J. Clin. Microbiol. 2001, 39, 2594–2597. [Google Scholar] [CrossRef] [PubMed]
- Goel, A.K.; Jiang, S.C. Genetic determinants of virulence, antibiogram and altered biotype among the Vibrio cholerae O1 isolates from different cholera outbreaks in India. Infect. Genet. Evol. 2010, 10, 815–819. [Google Scholar] [CrossRef] [PubMed]
- Abioye, O.E.; Nontongana, N.; Osunla, C.A.; Okoh, A.I. antimicrobial resistance and virulence genes profiling of Vibrio cholerae and Vibrio mimicus isolates from some seafood collected at the aquatic environment and wet markets in Eastern Cape Province, South Africa. PLoS ONE 2023, 18, e0290356. [Google Scholar] [CrossRef]
- Ottaviani, D.; Medici, L.; Talevi, G.; Napoleoni, M.; Serratore, P.; Zavatta, E.; Bignami, G.; Masini, L.; Chierichetti, S.; Fisichella, S.; et al. Molecular characterization and drug susceptibility of non-O1/O139 V. cholerae strains of seafood, environmental and clinical origin, Italy. Food Microbiol. 2018, 72, 82–88. [Google Scholar] [CrossRef]
- Nur, A.H.; Ceccarelli, D.; Grim, C.J.; Taviani, E.; Jina, C.; Abdus, S.; Munirul, A.; Abul, K.S.; Sack, R.B.; Anwar, H.; et al. Distribution of virulence genes in clinical and environmental Vibrio cholerae strains in Bangladesh. Appl. Environ. Microbiol. 2013, 79, 5782–5785. [Google Scholar] [CrossRef] [PubMed]
- Asmaa, B.M.B.T.; Abou Elez, R.M.M.; Ibrahim, E.; Samah, S.A.; Hend, S.N.; Eman, N.A. Genotypic characterization and antimicrobial resistance of Vibrio cholerae and Vibrio parahaemolyticus isolated from milk, dairy products, and humans with respect to inhibitory activity of a probiotic Lactobacillus rhamenosus. LWT—Food Sci. Technol. 2021, 150, 111930. [Google Scholar] [CrossRef]
- Chiavelli, D.A.; Marsh, J.W.; Taylor, R.K. The mannose-sensitive hemagglutinin of Vibrio cholerae promotes adherence to zooplankton. Appl. Environ. Microbiol. 2001, 67, 3220–3225. [Google Scholar] [CrossRef]
- Ayan, M.; Rima, T.; Sekhar Chatterjee, N.; Amit, G.; Ritam, S.; Hemanta, K.; Rani Saha, D.; Manoj, K.C.; Nyunt Wai, S.; Amit, P. Cytotoxic and inflammatory responses induced by outer membrane vesicle-associated biologically active proteases from Vibrio cholerae. Infect. Immun. 2016, 84, 1478–1490. [Google Scholar] [CrossRef]
- Rajpara, N.; Vinothkumar, K.; Mohanty, P.; Singh, A.K.; Singh, R.; Sinha, R.; Nag, D.; Koley, H.; Bhardwaj, A.K. Synergistic Effect of Various Virulence Factors Leading to High Toxicity of Environmental V. cholerae Non-O1/Non-O139 Isolates Lacking ctx Gene: Comparative Study with Clinical Strains. PLoS ONE 2013, 8, e76200. [Google Scholar] [CrossRef]
- Tengfei, X.; Qingping, W.; Jumei, Z.; Xiaoke, X.; Jianheng, C. Comparison of Vibrio parahaemolyticus isolates from aquatic products and clinical by antimicrobial susceptibility, virulence, and molecular characterisation. Food Control 2017, 71, 315–321. [Google Scholar] [CrossRef]
- Qianxing, W.; Ali Zaman, V.; Nazanin, O.; Vahab Hassan, K.; Abbas, M.; Parand, K.; Ebrahim, K. Antimicrobial resistance among clinical Vibrio cholerae non-O1/non-O139 isolates: Systematic review and meta-analysis. Pathog. Glob. Health 2023, 117, 235–244. [Google Scholar] [CrossRef]
- Das, B.; Verma, J.; Kumar, P.; Ghosh, A.; Ramamurthy, T. antimicrobial resistance in Vibrio cholerae: Understanding the ecology of resistance genes and mechanisms. Vaccine 2020, 38, A83–A92. [Google Scholar] [CrossRef] [PubMed]
- Lalumera, G.M.; Calamari, D.; Galli, P.; Castiglioni, S.; Crosa, G.; Fanelli, R. Preliminary investigation on the environmental occurrence and effects of antimicrobials used in aquaculture in Italy. Chemosphere 2004, 54, 661–668. [Google Scholar] [CrossRef] [PubMed]
- Chiou, J.; Li, R.; Chen, S. CARB-17 Family of β-Lactamases Mediates Intrinsic Resistance to Penicillins in Vibrio parahaemolyticus. Antimicrob. Agents Chemother. 2015, 59, 3593–3595. [Google Scholar] [CrossRef] [PubMed]
- Stephen, J.; Lekshmi, M.; Ammini, P.; Kumar, S.H.; Varela, M.F. Membrane Efflux Pumps of Pathogenic Vibrio Species: Role in Antimicrobial Resistance and Virulence. Microorganisms 2022, 10, 382. [Google Scholar] [CrossRef]
- Cheney, L.; Payne, M.; Kaur, S.; Lan, R. Multilevel Genome Typing Describes Short- and Long-Term Vibrio cholerae Molecular Epidemiology. Msystems 2021, 6, e0013421. [Google Scholar] [CrossRef]
- Hackbusch, S.; Wichels, A.; Gimenez, L.; Doepke, H.; Gerdts, G. Potentially human pathogenic Vibrio spp. in a coastal transect: Occurrence and multiple virulence factors. Sci. Total Environ. 2020, 707, 136113. [Google Scholar] [CrossRef]
- Hossain, Z.Z.; Farhana, I.; Tulsiani, S.M.; Beguml, A.; Jensen, P.K.M. Transmission and Toxigenic Potential of Vibrio cholerae in Hilsha Fish Tenualosa ilisha) for Human Consumption in Bangladesh. Front. Microbiol. 2018, 9, 222. [Google Scholar] [CrossRef]
- Jiang, L.; Hu, X.; Xu, T.; Zhang, H.; Sheng, D.; Yin, D. Prevalence of antimicrobial resistance genes and their relationship with antimicrobials in the Huangpu river and the drinking water sources, Shanghai, China. Sci. Total Environ. 2013, 458–460, 267–272. [Google Scholar] [CrossRef]
- Knapp, C.W.; Zhang, W.; Sturm, B.S.M.; Graham, D.W. Differential fate of erythromycin and beta-lactam resistance genes from swine lagoon waste under different aquatic conditions. Environ. Pollut. 2010, 158, 1506–1512. [Google Scholar] [CrossRef] [PubMed]
- Dallenne, C.; Da Costa, A.; Decre, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef]
- Sneha, K.G.; Anas, A.; Jayalakshmy, K.V.; Jasmin, C.; Das, P.V.V.; Pai, S.S.; Pappu, S.; Nair, M.; Muraleedharan, K.R.; Sudheesh, K.; et al. Distribution of multiple antimicrobial resistant Vibrio spp. across Palk Bay. Reg. Stud. Mar. Sci. 2016, 3, 242–250. [Google Scholar] [CrossRef]
- Zago, V.; Veschetti, L.; Patuzzo, C.; Malerba, G.; Lleo, M.M. Shewanella algae and Vibrio spp. strains isolated in Italian aquaculture farms are reservoirs of antimicrobial resistant genes that might constitute a risk for human health. Mar. Pollut. Bull. 2020, 154, 111057. [Google Scholar] [CrossRef]
- Pei, R.; Kim, S.-C.; Carlson, K.H.; Pruden, A. Effect of River Landscape on the sediment concentrations of antimicrobials and corresponding antimicrobial resistance genes (ARG). Water Res. 2006, 40, 2427–2435. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Su, Y.; Deng, Y.; Guo, Z.; Cheng, C.; Ma, H.; Liu, G.; Xu, L.; Feng, J. Spatial and temporal variation of antimicrobial resistance in marine fish cage-culture area of Guangdong, China. Environ. Pollut. 2019, 246, 463–471. [Google Scholar] [CrossRef]
- Shinde, A.H.; Raval, I.H.; Haldar, S. SXT int harboring bacteria as effective indicators to determine high-risk reservoirs of multiple antimicrobial resistance in different aquatic environments of western coast of Gujarat, India. Ecol. Indic. 2020, 113, 106143. [Google Scholar] [CrossRef]
- Lv, B.; Cui, Y.; Tian, W.; Li, J.; Xie, B.; Yin, F. Abundances and profiles of antimicrobial resistance genes as well as co-occurrences with human bacterial pathogens in ship ballast tank sediments from a shipyard in Jiangsu Province, China. Ecotoxicol. Environ. Saf. 2018, 157, 169–175. [Google Scholar] [CrossRef]
- Jo, H.; Raza, S.; Farooq, A.; Kim, J.; Unno, T. Fish farm effluents as a source of antimicrobial resistance gene dissemination on Jeju Island, South Korea. Environ. Pollut. 2021, 276, 116764. [Google Scholar] [CrossRef]
- Huang, S.; Dai, W.; Sun, S.; Zhang, X.; Zhang, L. Prevalence of Plasmid-Mediated Quinolone Resistance and Aminoglycoside Resistance Determinants among Carbapeneme Non-Susceptible Enterobacter cloacae. PLoS ONE 2012, 7, e47636. [Google Scholar] [CrossRef]
- Dahanayake, P.S.; Hossain, S.; Wickramanayake, M.V.K.S.; Wimalasena, S.H.M.P.; Heo, G.J. Manila clam (Ruditapes philippinarum) marketed in Korea as a source of vibrios harbouring virulence and β-lactam resistance genes. Lett. Appl. Microbiol. 2020, 71, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Ouoba, L.I.I.; Lei, V.; Jensen, L.B. Resistance of potential probiotic lactic acid bacteria and bifidobacteria of African and European origin to antimicrobials: Determination and transferability of the resistance genes to other bacteria. Int. J. Food Microbiol. 2008, 121, 217–224. [Google Scholar] [CrossRef]
- Aminov, R.I.; Chee-Sanford, J.C.; Garrigues, N.; Teferedegne, B.; Krapac, I.J.; White, B.A.; Mackie, R.I. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of gram-negative bacteria. Appl. Environ. Microbiol. 2002, 68, 1786–1793. [Google Scholar] [CrossRef]
- Maynard, C.; Fairbrother, J.M.; Bekal, S.; Sanschagrin, F.; Levesque, R.C.; Brousseau, R.; Masson, L.; Larivière, S.; Harel, J. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob. Agents Chemother. 2003, 47, 3214–3221. [Google Scholar] [CrossRef] [PubMed]
- Su, H.; Hu, X.; Xu, Y.; Xu, W.; Huang, X.; Wen, G.; Yang, K.; Li, Z.; Cao, Y. Persistence and spatial variation of antimicrobial resistance genes and bacterial populations change in reared shrimp in South China. Environ. Int. 2018, 119, 327–333. [Google Scholar] [CrossRef] [PubMed]








| Type of Samples | Total Number of Samples | Positive Number of Samples (%) |
|---|---|---|
| Greenhouse-cultured shrimp | 13 | 12 (92.3) |
| Greenhouse-cultured shrimp culture water | 13 | 10 (76.9) |
| Greenhouse-cultured shrimp culture sediment | 13 | 9 (69.2) |
| Open-air-cultured shrimp | 24 | 18 (75.0) |
| Open-air-cultured shrimp culture water | 25 | 17 (68.0) |
| Open-air-cultured shrimp culture sediment | 25 | 15 (60.0) |
| Grass carp | 18 | 7 (38.9) |
| Crucian carp | 17 | 5 (29.4) |
| Fish culture water | 27 | 11 (40.7) |
| Fish culture sediment | 25 | 10 (40.0) |
| Crab | 10 | 0 (0.0) |
| Crab culture water | 14 | 0 (0.0) |
| Crab culture sediment | 14 | 0 (0.0) |
| Total | 238 | 114 (47.9) |
| Type of Samples | Detection Rate of V. cholerae in Different Quarters (%) | |||
|---|---|---|---|---|
| Spring | Summer | Autumn | Winter | |
| Greenhouse-cultured shrimp | 75.0 | 100.0 | 100.0 | - |
| Greenhouse-cultured shrimp culture water | 60.0 | 100.0 | 66.7 | - |
| Greenhouse-cultured shrimp culture sediment | 60.0 | 80.0 | 66.7 | - |
| Open-air-cultured shrimp | 100.0 | 71.4 | 66.7 | - |
| Open-air-cultured shrimp culture water | 100.0 | 64.3 | 57.1 | - |
| Open-air-cultured shrimp culture sediment | 75.0 | 50.0 | 71.4 | - |
| Grass carp | 0.0 | 80.0 | 40.0 | 20.0 |
| Crucian carp | 33.3 | 33.3 | 40.0 | 16.7 |
| Fish culture water | 33.3 | 60.0 | 100.0 | 9.1 |
| Fish culture sediment | 0.0 | 80.0 | 100.0 | 9.1 |
| Total | 54.8 | 70.0 | 39.1 | 12.1 |
| Virulence Pattern | Number of Virulence Genes | Number of Strains | Detection Rate (%) |
|---|---|---|---|
| rtxA | 1 | 3 | 1.4 |
| rtxC | 1 | 0.5 | |
| ompU | 7 | 3.3 | |
| rtxA-ompU | 2 | 1 | 0.5 |
| hlyA-ompU | 1 | 0.5 | |
| rtxC-ompU | 1 | 0.5 | |
| hap-rtxC-chxA | 3 | 1 | 0.5 |
| hap-hlyA-rtxC | 12 | 5.6 | |
| hap-hlyA-rtxC-chxA | 4 | 8 | 3.7 |
| hap-hlyA-rtxA-rtxC | 12 | 5.6 | |
| hap-hlyA-rtxC-mshA | 1 | 0.5 | |
| hap-hlyA-rtxC-ompU | 6 | 2.8 | |
| hap-hlyA-rtxC-mshA | 5 | 2.3 | |
| hap-hlyA-rtxC-stn/sto | 1 | 0.5 | |
| hap-rtxA-rtxC-chxA | 2 | 0.9 | |
| hap-hlyA-rtxC-ompU-stn/sto | 5 | 1 | 0.5 |
| hap-hlyA-rtxA-rtxC-ompU | 41 | 19.2 | |
| hlyA-rtxA-rtxC-ompU-chxA | 1 | 0.5 | |
| hap-hlyA-rtxA-rtxC-mshA | 3 | 1.4 | |
| hap-hlyA-rtxC-ompU-chxA | 5 | 2.3 | |
| hap-rtxA-rtxC-chxA-mshA | 1 | 0.5 | |
| hap-hlyA-rtxA-rtxC-chxA | 13 | 6.1 | |
| hap-hlyA-rtxA-rtxC-chxA-mshA | 6 | 4 | 1.9 |
| hap-hlyA-rtxA-rtxC-ompU-chxA | 28 | 13.1 | |
| hap-hlyA-rtxA-rtxC-ompU-mshA | 19 | 8.9 | |
| hap-hlyA-rtxA-rtxC-chxA-pilA | 1 | 0.5 | |
| hap-rtxA-rtxC-ompU-mshA-pilA | 1 | 0.5 | |
| hap-hlyA-rtxC-ompU-chxA-mshA | 8 | 3.7 | |
| hap-hlyA-rtxA-rtxC-ompU-chxA-mshA | 7 | 20 | 9.3 |
| hap-hlyA-rtxA-rtxC-ompU-mshA-pilA | 1 | 0.5 | |
| hap-hlyA-rtxC-ompU-chxA-mshA-stn/sto | 1 | 0.5 |
| Resistance Pattern | Number of Antimicrobials | Number of Antimicrobial Classes | Number of Strains | MAR Index |
|---|---|---|---|---|
| SMX | 1 | 1 | 7 | 0.05 |
| AMP | 1 | 1 | ||
| CZO-SMX | 2 | 2 | 1 | 0.11 |
| AMP-SMX | 2 | 28 | ||
| SMX-ERY | 2 | 9 | ||
| AMP-ERY | 2 | 3 | ||
| SMX-SXT | 1 | 2 | ||
| AMP-CZO-SMX | 3 | 3 | 8 | 0.16 |
| CZO-SMX-ERY | 3 | 2 | ||
| AMP-SMX-SXT | 2 | 6 | ||
| CZO-FEP-SMX | 2 | 1 | ||
| AMP-CZO-ERY | 3 | 2 | ||
| SMX-SXT-ERY | 2 | 7 | ||
| AMP-SMX-ERY | 3 | 66 | ||
| AMP-SMX-SXT-ERY | 4 | 3 | 9 | 0.21 |
| AMP-CZO-SMX-ERY | 4 | 23 | ||
| OFL-SMX-SXT-ERY | 3 | 1 | ||
| AMP-TET-SMX-SXT | 3 | 1 | ||
| AMP-TET-DOX-SMX | 3 | 1 | ||
| AMP-FEP-SMX-SXT | 3 | 1 | ||
| AMP-FEP-SMX-ERY | 4 | 5 | ||
| AMP-CZO-FEP-SMX | 3 | 1 | ||
| AMP-CZO-SMX-SXT | 3 | 1 | ||
| CZO-SMX-SXT-ERY | 3 | 1 | ||
| AMP-TET-SMX-SXT-ERY | 5 | 4 | 2 | 0.26 |
| AMP-CZO-FEP-SMX-SXT | 3 | 2 | ||
| AMP-SMX-SXT-AZM-KAN | 4 | 1 | ||
| AMP-SMX-SXT-ERY-KAN | 4 | 1 | ||
| AMP-CZO-SMX-SXT-ERY | 4 | 10 | ||
| AMP-CZO-TET-SMX-ERY | 5 | 1 | ||
| AMP-CZO-FOX-CTX-SMX | 3 | 1 | ||
| AMP-CZO-FEP-SMX-ERY | 4 | 2 | ||
| AMP-FEP-SMX-SXT-ERY | 4 | 1 | ||
| AMP-CZO-CTX-FEP-SMX-ERY | 6 | 4 | 1 | 0.32 |
| AMP-CZO-FEP-SMX-SXT-ERY | 4 | 1 | ||
| AMP-IPM-CZO-SMX-ERY-AZM | 5 | 1 | ||
| AMP-CZO-TET-SMX-SXT-ERY | 5 | 1 | ||
| AMP-CZO-FOX-CTX-FEP-TET-SMX-SXT | 8 | 4 | 1 | 0.42 |
| AMP-CZO-FOX-CTX-FEP-TET-SMX-SXT-ERY | 9 | 5 | 1 | 0.47 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Liu, J.; Yang, X.; Lan, W.; Zhao, Y.; Sun, X. Prevalence, Virulence and Antimicrobial Resistance of Vibrio cholerae in Aquatic Products and Aquaculture Environment in Shanghai. Foods 2025, 14, 3824. https://doi.org/10.3390/foods14223824
Li Y, Liu J, Yang X, Lan W, Zhao Y, Sun X. Prevalence, Virulence and Antimicrobial Resistance of Vibrio cholerae in Aquatic Products and Aquaculture Environment in Shanghai. Foods. 2025; 14(22):3824. https://doi.org/10.3390/foods14223824
Chicago/Turabian StyleLi, Yingqi, Junjun Liu, Xin Yang, Weiqing Lan, Yong Zhao, and Xiaohong Sun. 2025. "Prevalence, Virulence and Antimicrobial Resistance of Vibrio cholerae in Aquatic Products and Aquaculture Environment in Shanghai" Foods 14, no. 22: 3824. https://doi.org/10.3390/foods14223824
APA StyleLi, Y., Liu, J., Yang, X., Lan, W., Zhao, Y., & Sun, X. (2025). Prevalence, Virulence and Antimicrobial Resistance of Vibrio cholerae in Aquatic Products and Aquaculture Environment in Shanghai. Foods, 14(22), 3824. https://doi.org/10.3390/foods14223824

