Integrative Analysis of Transcriptomics and Metabolomics Provides Insights into Meat Quality Differences in Hu Sheep with Different Carcass Performance
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals, Tissue Collection, Phenotyping
2.2. Meat Quality Measurements
2.3. Measurement of Muscle Fiber Indicators
2.4. Library Preparation and RNA-Seq
2.5. RNA-Seq Data Analysis
2.6. Weighted Correlation Network Analysis
2.7. Metabolite Extraction for LC-MS/MS Analysis
2.8. Statistical Analysis of the Metabolites
2.9. Joint Analysis of the Transcriptomic and Metabolomic Data
2.10. Validation of the DEGs Identified from RNA-Seq Data
3. Results
3.1. Correlation Analysis Between Muscle Fiber Indicators and Growth, Carcass, and Meat Quality Traits
3.2. Comparison of Meat Quality Characteristics in Sheep with Different Carcass Performance
3.3. DEGs Identification and Transcriptome Analysis
3.4. Identification of Hub Genes Associated with Meat Quality Traits
3.5. DEMs and Metabolome Analysis
3.6. Integrative Analysis of the Transcriptome and Metabolome
3.7. qPCR Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| DEGs | Differentially expressed genes |
| DAMs | Differentially accumulated metabolites |
| WGCNA | Weighted gene co-expression network analysis |
| TOM | Topological overlap matrix |
| LT | Longissimus thoracis |
| TPM | Transcripts per million |
| GO | Gene ontology |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| IMF | Intramuscular fat |
References
- Pethick, D.W.; Banks, R.G.; Hales, J.; Ross, I.R. Australian prime lamb—A vision for 2020. Int. J. Sheep Wool Sci. 2006, 54, 66–73. [Google Scholar]
- Hopkins, D.L.; Geesink, G.H. Protein degradation post mortem and tenderisation. In Applied Muscle Biology and Meat Science; CRC Press: Boca Raton, FL, USA, 2009. [Google Scholar]
- Mortimer, S.I.; Fogarty, N.M.; van der Werf, J.H.J.; Brown, D.J.; Swan, A.A.; Jacob, R.H.; Geesink, G.H.; Hopkins, D.L.; Hocking Edwards, J.E.; Ponnampalam, E.N.; et al. Genetic correlations between meat quality traits and growth and carcass traits in Merino sheep1. J. Anim. Sci. 2018, 96, 3582–3598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pethick, D.W.; Ball, A.J.; Banks, R.G.; Hocquette, J.F. Current and future issues facing red meat quality in a competitive market and how to manage continuous improvement. Anim. Prod. Sci. 2010, 51, 13–18. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Yuan, L.; Li, F.; Zhang, X.; Tian, H.; Ma, Z.; Zhang, D.; Zhang, Y.; Zhao, Y.; Huang, K.; et al. Whole-genome resequencing of Hu sheep identifies candidate genes associated with agronomic traits. J. Genet. Genom. 2024, 51, 866–876. [Google Scholar] [CrossRef] [Scilit]
- Fang, L.; Cai, W.; Liu, S.; Canela-Xandri, O.; Gao, Y.; Jiang, J.; Rawlik, K.; Li, B.; Schroeder, S.G.; Rosen, B.D.; et al. Comprehensive analyses of 723 transcriptomes enhance genetic and biological interpretations for complex traits in cattle. J. Dairy Sci. 2020, 103, 790–801. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Zhang, S.; Duan, Q.; Lou, M.; Ling, Y. Comprehensive analyses of 435 goat transcriptomes provides insight into male reproduction. Int. J. Biol. Macromol. 2024, 255, 127942. [Google Scholar] [CrossRef] [Scilit]
- Ai, Y.; Zhu, Y.; Wang, L.; Zhang, X.; Zhang, J.; Long, X.; Gu, Q.; Han, H. Dynamic Changes in the Global Transcriptome of Postnatal Skeletal Muscle in Different Sheep. Genes 2023, 14, 1298. [Google Scholar] [CrossRef] [Scilit]
- Johnson, C.H.; Ivanisevic, J.; Siuzdak, G. Metabolomics: Beyond biomarkers and towards mechanisms. Nat. Rev. Mol. Cell Biol. 2016, 17, 451–459. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.-H.; Tang, C.-H.; Lin, W.-Y.; Chen, K.-H.; Liang, H.-J.; Cheng, T.-J.; Lin, C.-Y. LC-MS-based lipidomics to examine acute rat pulmonary responses after nano- and fine-sized ZnO particle inhalation exposure. Nanotoxicology 2018, 12, 439–452. [Google Scholar] [CrossRef] [Scilit]
- Dan, H.; Liu, C.; Zhang, H.; Gan, M.; Wang, Y.; Chen, L.; Zhao, Y.; Liu, B.; Zhu, K.; Niu, L.; et al. Integrated transcriptomic and metabolomic analyses reveal heterosis for meat quality of Neijiang pigs. Front. Vet. Sci. 2024, 11, 1493284. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Li, F.; Zhang, X.; Yuan, L.; Tian, H.; Xu, D.; Zhang, D.; Zhang, Y.; Zhao, Y.; Huang, K.; et al. Integrating genome-wide association and transcriptome analysis to provide molecular insights into growth rates in sheep1. J. Integr. Agric. 2024. [Google Scholar] [CrossRef] [Scilit]
- Listyarini, K.; Sumantri, C.; Rahayu, S.; Islam, M.A.; Akter, S.H.; Uddin, M.J.; Gunawan, A. Hepatic Transcriptome Analysis Reveals Genes, Polymorphisms, and Molecules Related to Lamb Tenderness. Animals 2023, 13, 674. [Google Scholar] [CrossRef] [Scilit]
- Kong, L.; Yue, Y.; Li, J.; Yang, B.; Chen, B.; Liu, J.; Lu, Z. Transcriptomics and metabolomics reveal improved performance of Hu sheep on hybridization with Southdown sheep. Food Res. Int. 2023, 173, 113240. [Google Scholar] [CrossRef] [Scilit]
- Ma, K.; Song, J.; Li, D.; Liu, Z.; Wang, C.; Li, T.; Ma, Y. Insights into the differences in meat quality among different sheep breeds in the Qilian Mountains from the perspective of metabolomics and transcriptomics. Food Biosci. 2025, 63, 105693. [Google Scholar] [CrossRef] [Scilit]
- Payne, C.E.; Pannier, L.; Anderson, F.; Pethick, D.W.; Gardner, G.E. Lamb Age has Little Impact on Eating Quality. Foods 2020, 9, 187. [Google Scholar] [CrossRef] [Scilit]
- He, Z.; Wang, X.; Qi, Y.; Zhu, C.; Zhao, Z.; Zhang, X.; Liu, X.; Li, S.; Zhao, F.; Wang, J.; et al. Long-stranded non-coding RNAs temporal-specific expression profiles reveal longissimus dorsi muscle development and intramuscular fat deposition in Tianzhu white yak. J. Anim. Sci. 2023, 101, skad394. [Google Scholar] [CrossRef] [Scilit]
- Honikel, K.O. Reference methods for the assessment of physical characteristics of meat. Meat Sci. 1998, 49, 447–457. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R Package for Comparing Biological Themes Among Gene Clusters. OMICS A J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [Scilit]
- Dunn, W.B.; Erban, A.; Weber, R.J.M.; Creek, D.J.; Brown, M.; Breitling, R.; Hankemeier, T.; Goodacre, R.; Neumann, S.; Kopka, J.; et al. Mass appeal: Metabolite identification in mass spectrometry-focused untargeted metabolomics. Metabolomics 2013, 9, 44–66. [Google Scholar] [CrossRef] [Scilit]
- Kanehisa, M.; Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Weng, K.; Huo, W.; Li, Y.; Zhang, Y.; Zhang, Y.; Chen, G.; Xu, Q. Fiber characteristics and meat quality of different muscular tissues from slow- and fast-growing broilers. Poult. Sci. 2022, 101, 101537. [Google Scholar] [CrossRef] [Scilit]
- Revelle, W.R. psych: Procedures for Personality and Psychological Research; C-RAN: Vienna, Austria, 2017. [Google Scholar]
- Shao, X.; Lu, X.; Sun, X.; Jiang, H.; Chen, Y. Preliminary studies on the molecular mechanism of intramuscular fat deposition in the longest dorsal muscle of sheep. BMC Genom. 2024, 25, 592. [Google Scholar] [CrossRef] [Scilit]
- Hajihosseinlo, A.; Jafari, S.; Ajdary, M. The relationship of GH and LEP gene polymorphisms with fat-tail measurements (fat-tail dimensions) in fat-tailed Makooei breed of Iranian sheep. Adv. Biomed. Res. 2015, 4, 172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, S.; You, S.H.; Bao, J.; Gegentu; Jia, Y.S.; Cai, Y.M. Evaluation of the growth performance and meat quality of Mongolian lamb fed grass, hay or pellets of Inner Mongolian native grass. Small Rumin. Res. 2019, 181, 34–38. [Google Scholar] [CrossRef] [Scilit]
- Maltin, C.; Balcerzak, D.; Tilley, R.; Delday, M. Determinants of meat quality: Tenderness. Proc. Nutr. Soc. 2003, 62, 337–347. [Google Scholar] [CrossRef] [Scilit]
- Hopkins, D.L.; Mortimer, S.I. Effect of genotype, gender and age on sheep meat quality and a case study illustrating integration of knowledge. Meat Sci. 2014, 98, 544–555. [Google Scholar] [CrossRef] [Scilit]
- Ju, J.; Mittal, G.S. Relationships of Physical Properties of Fat-Substitutes, Cooking Methods and Fat Levels with Quality of Ground Beef Patties. J. Food Process. Preserv. 2000, 24, 125–142. [Google Scholar] [CrossRef] [Scilit]
- Watanabe, A.; Daly, C.C.; Devine, C.E. The effects of the ultimate pH of meat on tenderness changes during ageing. Meat Sci. 1996, 42, 67–78. [Google Scholar] [CrossRef] [Scilit]
- Bonny, S.P.F.; Gardner, G.E.; Pethick, D.W.; Legrand, I.; Polkinghorne, R.J.; Hocquette, J.F. Biochemical measurements of beef are a good predictor of untrained consumer sensory scores across muscles. Animal 2015, 9, 179–190. [Google Scholar] [CrossRef] [Scilit]
- O’Quinn, T.G.; Brooks, J.C.; Polkinghorne, R.J.; Garmyn, A.J.; Johnson, B.J.; Starkey, J.D.; Rathmann, R.J.; Miller, M.F. Consumer assessment of beef strip loin steaks of varying fat levels. J. Anim. Sci. 2012, 90, 626–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cama-Moncunill, R.; Cafferky, J.; Augier, C.; Sweeney, T.; Allen, P.; Ferragina, A.; Sullivan, C.; Cromie, A.; Hamill, R.M. Prediction of Warner-Bratzler shear force, intramuscular fat, drip-loss and cook-loss in beef via Raman spectroscopy and chemometrics. Meat Sci. 2020, 167, 108–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbera, S. WHCtrend, an up-to-date method to measure water holding capacity in meat. Meat Sci. 2019, 152, 134–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.; Cui, H.; Fu, R.; Zheng, M.; Liu, R.; Zhao, G.; Wen, J. The regulation of IMF deposition in pectoralis major of fast- and slow- growing chickens at hatching. J. Anim. Sci. Biotechnol. 2017, 8, 77. [Google Scholar] [CrossRef] [Scilit]
- Sztalryd, C.; Brasaemle, D.L. The perilipin family of lipid droplet proteins: Gatekeepers of intracellular lipolysis. Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 2017, 1862, 1221–1232. [Google Scholar] [CrossRef] [Scilit]
- Gao, K.; Han, S.; Li, Z.; Luo, Z.; Lv, S.; Choe, H.M.; Paek, H.J.; Quan, B.; Kang, J.; Yin, X. Analysis of metabolome and transcriptome of longissimus thoracis and subcutaneous adipose tissues reveals the regulatory mechanism of meat quality in MSTN mutant castrated male finishing pigs. Meat Sci. 2024, 207, 109370. [Google Scholar] [CrossRef] [Scilit]
- Ma, L.; Zhang, M.; Jin, Y.; Erdenee, S.; Hu, L.; Chen, H.; Cai, Y.; Lan, X. Comparative Transcriptome Profiling of mRNA and lncRNA Related to Tail Adipose Tissues of Sheep. Front. Genet. 2018, 9, 365. [Google Scholar] [CrossRef] [Scilit]
- Ramayo-Caldas, Y.; Ballester, M.; Fortes, M.R.S.; Esteve-Codina, A.; Castelló, A.; Noguera, J.L.; Fernández, A.I.; Pérez-Enciso, M.; Reverter, A.; Folch, J.M. From SNP co-association to RNA co-expression: Novel insights into gene networks for intramuscular fatty acid composition in porcine. BMC Genom. 2014, 15, 232. [Google Scholar] [CrossRef] [Scilit]
- Gunawan, A.; Listyarini, K.; Harahap, R.S.; Jakaria; Roosita, K.; Sumantri, C.; Inounu, I.; Akter, S.H.; Islam, M.A.; Uddin, M.J. Hepatic transcriptome analysis identifies genes, polymorphisms and pathways involved in the fatty acids metabolism in sheep. PLoS ONE 2021, 16, e0260514. [Google Scholar] [CrossRef] [Scilit]
- Ma, L.; Mondal, A.K.; Murea, M.; Sharma, N.K.; Tönjes, A.; Langberg, K.A.; Das, S.K.; Franks, P.W.; Kovacs, P.; Antinozzi, P.A.; et al. The Effect of ACACB cis-Variants on Gene Expression and Metabolic Traits. PLoS ONE 2011, 6, e23860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Zeng, Z.; Wei, J.; Jiang, L.; Ma, Q.; Wu, M.; Huang, X.; Ye, S.; Li, Y.; Ma, D.; et al. Sema4d is required for the development of the hindbrain boundary and skeletal muscle in zebrafish. Biochem. Biophys. Res. Commun. 2013, 433, 213–219. [Google Scholar] [CrossRef] [Scilit]
- Kamei, Y.; Hatazawa, Y.; Uchitomi, R.; Yoshimura, R.; Miura, S. Regulation of Skeletal Muscle Function by Amino Acids. Nutrients 2020, 12, 261. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Ning, B.; Chen, X.; Li, C.; Liu, M.; Yue, Z.; Liu, L.; Li, F. Effects of the SLC38A2–mTOR Pathway Involved in Regulating the Different Compositions of Dietary Essential Amino Acids–Lysine and Methionine on Growth and Muscle Quality in Rabbits. Animals 2022, 12, 3406. [Google Scholar] [CrossRef] [Scilit]
- Sun, F.; Piao, M.; Zhang, X.; Zhang, S.; Wei, Z.; Liu, L.; Bu, Y.; Xu, S.; Zhao, X.; Meng, X.; et al. Multi-Omics Analysis of Transcriptomic and Metabolomics Profiles Reveal the Molecular Regulatory Network of Marbling in Early Castrated Holstein Steers. Animals 2022, 12, 3398. [Google Scholar] [CrossRef] [Scilit]







| Gene Name | Primer Sequences (5′–3′) | Annealing Temperature (°C) | Product Length (bp) |
|---|---|---|---|
| RASD1 | GAGGACTTCCACCGCAAGTTCTAC | 60.5 °C | 144 bp |
| CAGGCTGAACACCAGGATGAACAC | |||
| PTGS2 | CCAGACAAGTAGGCTAATCCTG | 53.3 °C | 160 bp |
| GTTAAACTCAGCAGCAATACGG | |||
| KCNH6 | ACACCATCATCCGCAAGTTCG | 56.3 °C | 106 bp |
| ACACCATCATCCGCAAGTTCG | |||
| CCL21 | TCACTGGTCCTGAGCATCCTTGT | 61.2 °C | 124 bp |
| CAATGTTGGCGGGAATCTTCTTTCG | |||
| ASTN1 | ATCTCAGGCAACACGGAGGACAT | 60.3 °C | 141 bp |
| ATGCTGTGGTTCTTCGGTTGGATC | |||
| CNGA2 | CCCAACATCTTCCGAATCAGC | 54.6 °C | 105 bp |
| TACCCCAAAGCCGATGGAC | |||
| UXT | GCAAGTGGATTTGGGCTGTAAC | 58.5 °C | 180 bp |
| ATGGAGTCCTTGGTGAGGCTGT |
| HHS | LHS | p-Value | |
|---|---|---|---|
| No. | 10 | 10 | |
| Body weight (kg) | 50.26 ± 1.01 | 37.44 ± 0.90 | <0.001 |
| Body length (cm) | 69.30 ± 1.08 | 64.70 ± 0.79 | 0.003 |
| Body height (cm) | 77.00 ± 0.71 | 71.30 ± 0.86 | <0.001 |
| Chest circumference (cm) | 91.80 ± 1.35 | 83.40 ± 1.17 | <0.001 |
| Body mass index (kg/cm2) | 0.0085 ± 0.00021 | 0.0074 ± 0.00015 | <0.001 |
| Live weight before slaughter (kg) | 51.27 ± 0.89 | 37.27 ± 0.63 | <0.001 |
| Carcass weight (kg) | 28.06 ± 0.31 | 19.96 ± 0.11 | <0.001 |
| Carcass length (cm) | 86.50 ± 1.15 | 79.80 ± 0.61 | <0.001 |
| Chest circumference of carcass (cm) | 78.50 ± 0.81 | 70.70 ± 0.45 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Zhao, L.; Tian, H.; Ma, Z.; Zhang, Q.; Pu, M.; Cao, P.; Zhang, D.; Zhang, Y.; Zhao, Y.; et al. Integrative Analysis of Transcriptomics and Metabolomics Provides Insights into Meat Quality Differences in Hu Sheep with Different Carcass Performance. Foods 2025, 14, 2477. https://doi.org/10.3390/foods14142477
Zhang X, Zhao L, Tian H, Ma Z, Zhang Q, Pu M, Cao P, Zhang D, Zhang Y, Zhao Y, et al. Integrative Analysis of Transcriptomics and Metabolomics Provides Insights into Meat Quality Differences in Hu Sheep with Different Carcass Performance. Foods. 2025; 14(14):2477. https://doi.org/10.3390/foods14142477
Chicago/Turabian StyleZhang, Xiaoxue, Liming Zhao, Huibin Tian, Zongwu Ma, Qi Zhang, Mengru Pu, Peiliang Cao, Deyin Zhang, Yukun Zhang, Yuan Zhao, and et al. 2025. "Integrative Analysis of Transcriptomics and Metabolomics Provides Insights into Meat Quality Differences in Hu Sheep with Different Carcass Performance" Foods 14, no. 14: 2477. https://doi.org/10.3390/foods14142477
APA StyleZhang, X., Zhao, L., Tian, H., Ma, Z., Zhang, Q., Pu, M., Cao, P., Zhang, D., Zhang, Y., Zhao, Y., Cheng, J., Xu, Q., Xu, D., Yang, X., Li, X., Wu, W., Li, F., & Wang, W. (2025). Integrative Analysis of Transcriptomics and Metabolomics Provides Insights into Meat Quality Differences in Hu Sheep with Different Carcass Performance. Foods, 14(14), 2477. https://doi.org/10.3390/foods14142477

