Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation of Yeast Strains
2.2. Scanning Electron Microscopy
2.3. Identification and Phylogenetic Analysis of the Isolated Yeast
2.4. Growth Conditions for Shake Flask Fermentation
2.5. RT-qPCR Assays for Yeast
2.6. Fermentation in 5 L Fermenter
2.7. Analysis Methods
2.8. Statistical Analysis
3. Results
3.1. Isolation of the 2-PE-Producing Strains
3.2. Effect of Fermentation Medium Composition on 2-PE Production
3.3. Effect of Different Nitrogen Source Conditions on 2-Phenylethanol Biosynthesis Genes
3.4. Effect of pH and Inoculum Proportion on 2-PE Production
3.5. Using ISPR Technology to Alleviate Inhibitory Effects and Enhance 2-PE Production
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| 2-PE | 2-Phenylethonal |
| AKG | α-Ketoglutaric acid |
| CHO | Chorismate |
| DAHP | 3-Deoxy-D-arabino-heptulosonic acid 7-phosphate |
| E4P | Erythrose-4-phosphate |
| EMP | Embden–Meyerhof–Parnas pathway |
| FDA | Food and drug administration |
| GLU | Glutamate |
| GRAS | Generally recognized as safe |
| ISPR | In situ product recovery |
| Phe | Phenylalanine |
| PAA | Phenylacetate |
| PABA | Para-Aminobenzoic acid |
| PAC | Phenylacetaldehyde |
| PEP | Phosphoenolpyruvate |
| PPP | Pentose phosphate pathway |
| PPY | Phenylpyruvate |
| PREP | Prephenate |
| S3P | Shikimate-3-phosphate |
| SHIK | Shikimate |
| TYR | Tyrosine |
Appendix A

| Primers | Sequence (5′–3′) | Description |
|---|---|---|
| NS1 | GTAGTCATATGCTTGTCTC | Amplification of 18S rRNA fragment for sequencing |
| NS8 | TCCGCAGGTTCACCTACGGA | |
| qP-actin-F | GCCCCAGAAGCTTTGTTCCA | Amplification of β-actin for RT-qPCR |
| qP-actin-R | GATGGAGCCAAAGCGGTGAT | |
| qP-aro3-F | TTGTTTCTCCTTGGGTGCCA | Amplification of aro3 for RT-qPCR |
| qP-aro3-R | TTCAGTGCCCACGATAGCAG | |
| qP-aro3-F2 | ACTGTTGGCTGGAAAGGGTT | Amplification of aro3 for RT-qPCR |
| qP-aro3-R2 | TGGCACCCAAGGGAAACAA | |
| qP-aro4-F | CGTCGGCTGGAAAGGTCTAA | Amplification of aro4 for RT-qPCR |
| qP-aro4-R | GAGATTCGGTGGTTCTGGCA | |
| qP-aro7-F | ACTTCGGTTCTGTTGCCACT | Amplification of aro7 for RT-qPCR |
| qP-aro7-R | CTCGTTGGTAGGGTCCACAC | |
| qP-pha2-F | GCCAGCAAGACTTTGAGGGT | Amplification of pha2 for RT-qPCR |
| qP-pha2-R | GCTGCTGGGAGGTACTCAAC | |
| qP-aro8-F | TCACCCAAGCCTCCTTTTCC | Amplification of aro8 for RT-qPCR |
| qP-aro8-R | TGGCTAAAACGTCCCAGTCC | |
| qP-aro9-F | ATGTCATCCTTTCTGGCGGG | Amplification of aro9 for RT-qPCR |
| qP-aro9-R | TGGGACTCTCTGTCGAAGGT | |
| qP-aro10-F | GATTTCGCGTTTCCTTCGCA | Amplification of aro10 for RT-qPCR |
| qP-aro10-R | CTGCACCGTCACCTTCAAAC | |
| qP-adh2-F | CGCAGTCGTTAAGGCTACCA | Amplification of adh2 for RT-qPCR |
| qP-adh2-R | CCCACGTAAGAGCCGACAAT | |
| qP-zwf1-F | TCCCGCCTTATTTGGGCTTT | Amplification of zwf1 for RT-qPCR |
| qP-zwf1-R | CGACGTTGGCACTTTTCTCG | |
| qP-tdh3-F | ACTGTCCACTCTTTGACTGCT | Amplification of tdh3 for RT-qPCR |
| qP-tdh3-R | CGACGGTTGGGACTCTGAAA |
| β-actin | pha2 | aro4 | aro7 | aro8 | aro9 | aro10 | adh2 | tdh3 | zwf1 | aro3 | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CK | 21.41 | 26.54 | 21.99 | 26.15 | 23.28 | 21.76 | 20.40 | 23.52 | 19.58 | ND | 31.35 |
| 21.71 | 26.45 | 22.02 | 26.21 | 23.28 | 21.82 | 20.74 | 23.57 | 18.18 | 20.89 | 32.20 | |
| 21.22 | 26.21 | 21.81 | 25.67 | 23.24 | 21.65 | 20.67 | 23.32 | 18.06 | 20.96 | 32.29 | |
| Yeast extract + | 21.53 | 26.41 | 22.66 | 25.95 | 23.98 | 22.12 | 20.91 | 21.37 | 17.32 | 21.38 | 33.42 |
| 20.98 | 26.34 | 22.53 | 25.84 | 23.55 | 22.00 | 20.49 | 21.14 | 17.28 | 20.44 | ND | |
| 21.15 | 26.26 | 22.52 | 25.56 | 23.79 | 21.96 | 20.46 | 21.36 | 17.09 | 21.45 | 33.42 | |
| Corn steep liquor - | 20.76 | 27.07 | 23.81 | 25.57 | 24.66 | 22.36 | 20.98 | 22.53 | 17.86 | 20.69 | ND |
| 21.91 | 28.14 | 24.59 | 26.40 | 25.68 | 23.25 | 21.92 | 23.06 | 18.96 | 21.87 | ND | |
| 21.02 | 27.33 | 24.04 | 26.19 | 24.79 | 22.59 | 21.20 | 23.83 | 18.09 | 20.96 | ND |
References
- Zhan, Y.; Shi, J.; Xiao, Y.; Zhou, F.; Wang, H.; Xu, H.; Li, Z.; Yang, S.; Cai, D.; Chen, S. Multilevel Metabolic Engineering of Bacillus Licheniformis for De Novo Biosynthesis of 2-Phenylethanol. Metab. Eng. 2022, 70, 43–54. [Google Scholar] [CrossRef] [PubMed]
- Martínez, O.; Sánchez, A.; Font, X.; Barrena, R. Bioproduction of 2-Phenylethanol and 2-Phenethyl Acetate by Kluyveromyces Marxianus through the Solid-State Fermentation of Sugarcane Bagasse. Appl. Microbiol. Biotechnol. 2018, 102, 4703–4716. [Google Scholar] [CrossRef]
- Hua, D.; Xu, P. Recent Advances in Biotechnological Production of 2-Phenylethanol. Biotechnol. Adv. 2011, 29, 654–660. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Wang, Y.; Ye, D.; Duan, L.; Duan, C.; Yan, G. Effect of the Addition of Branched-Chain Amino Acids to Non-Limited Nitrogen Synthetic Grape Must on Volatile Compounds and Global Gene Expression during Alcoholic Fermentation. Aust. J. Grape Wine Res. 2018, 24, 197–205. [Google Scholar] [CrossRef]
- Chantasuban, T.; Santomauro, F.; Gore-Lloyd, D.; Parsons, S.; Henk, D.; Scott, R.J.; Chuck, C. Elevated Production of the Aromatic Fragrance Molecule, 2-Phenylethanol, Metschnikowia Pulcherrima through Both De Novo and Ex Novo Conversion in Batch and Continuous Modes. J. Chem. Technol. Biotechnol. 2018, 93, 2118–2130. [Google Scholar] [CrossRef]
- Zhu, Y.-J.; Zhou, H.-T.; Hu, Y.-H.; Tang, J.-Y.; Su, M.-X.; Guo, Y.-J.; Chen, Q.-X.; Liu, B. Antityrosinase and Antimicrobial Activities of 2-Phenylethanol, 2-Phenylacetaldehyde and 2-Phenylacetic Acid. Food Chem. 2011, 124, 298–302. [Google Scholar] [CrossRef]
- Hayward, A.C. Biology and Epidemiology of Bacterial Wilt Caused by Pseudomonas Solanacearum. Annu. Rev. Phytopathol. 1991, 29, 65–87. [Google Scholar] [CrossRef]
- Zou, X.; Wei, Y.; Jiang, S.; Xu, F.; Wang, H.; Zhan, P.; Shao, X. ROS Stress and Cell Membrane Disruption Are the Main Antifungal Mechanisms of 2-Phenylethanol against Botrytis Cinerea. J. Agric. Food Chem. 2022, 70, 14468–14479. [Google Scholar] [CrossRef]
- Sun, S.; Tang, N.; Han, K.; Wang, Q.; Xu, Q. Effects of 2-Phenylethanol on Controlling the Development of Fusarium Graminearum in Wheat. Microorganisms 2023, 11, 2954. [Google Scholar] [CrossRef]
- Mitri, S.; Koubaa, M.; Maroun, R.G.; Rossignol, T.; Nicaud, J.-M.; Louka, N. Bioproduction of 2-Phenylethanol through Yeast Fermentation on Synthetic Media and on Agro-Industrial Waste and by-Products: A Review. Foods 2022, 11, 109. [Google Scholar] [CrossRef]
- Bernardino, A.R.S.; Torres, C.A.V.; Crespo, J.G.; Reis, M.A.M. Biotechnological 2-Phenylethanol Production: Recent Developments. Molecules 2024, 29, 5761. [Google Scholar] [CrossRef] [PubMed]
- Mei, J.; Min, H.; Lü, Z. Enhanced Biotransformation of L-Phenylalanine to 2-Phenylethanol Using an In Situ Product Adsorption Technique. Process Biochem. 2009, 44, 886–890. [Google Scholar] [CrossRef]
- Oliveira, S.M.M.; Gomes, S.D.; Sene, L.; Christ, D.; Piechontcoski, J. Production of Natural Aroma by Yeast in Wastewater of Cassava Starch Industry. Eng. Agric. 2015, 35, 721–732. [Google Scholar] [CrossRef][Green Version]
- Schrader, J.; Etschmann, M.; Sell, D.; Hilmer, J.-M.; Rabenhorst, J. Applied Biocatalysis for the Synthesis of Natural Flavour Compounds-Current Industrial Processes and Future Prospects. Biotechnol. Lett. 2004, 26, 463–472. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.; Jiao, X.; Ye, L.; Yu, H. Metabolic Engineering Strategies for De Novo Biosynthesis of Sterols and Steroids in Yeast. Bioresour. Bioprocess. 2021, 8, 110. [Google Scholar] [CrossRef]
- Liang, Z.; Zhi, H.; Fang, Z.; Zhang, P. Genetic Engineering of Yeast, Filamentous Fungi and Bacteria for Terpene Production and Applications in Food Industry. Food Res. Int. 2021, 147, 110487. [Google Scholar] [CrossRef]
- Li, H.; Ma, W.; Wang, W.; Gao, S.; Shan, X.; Zhou, J. Synergetic Engineering of Multiple Pathways for De Novo (2S)-Naringenin Biosynthesis in Saccharomyces Cerevisiae. ACS Sustain. Chem. Eng. 2024, 12, 59–71. [Google Scholar] [CrossRef]
- Wang, Z.; Bai, X.; Guo, X.; He, X. Regulation of Crucial Enzymes and Transcription Factors on 2-Phenylethanol Biosynthesis via Ehrlich Pathway in Saccharomyces Cerevisiae. J. Ind. Microbiol. Biotechnol. 2017, 44, 129–139. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Xu, S.; Li, Y.; Shi, G. Improvement of 2-Phenylethanol Production in Saccharomyces Cerevisiae by Evolutionary and Rational Metabolic Engineering. PLoS ONE 2021, 16, e0258180. [Google Scholar] [CrossRef]
- Zhu, L.; Wang, J.; Xu, S.; Shi, G. Improved Aromatic Alcohol Production by Strengthening the Shikimate Pathway in Saccharomyces Cerevisiae. Process Biochem. 2021, 103, 18–30. [Google Scholar] [CrossRef]
- Chreptowicz, K.; Sternicka, M.K.; Kowalska, P.D.; Mierzejewska, J. Screening of Yeasts for the Production of 2-phenylethanol (Rose Aroma) in Organic Waste-based Media. Lett. Appl. Microbiol. 2018, 66, 153–160. [Google Scholar] [CrossRef] [PubMed]
- Shu, C.-H.; Jhou, S.-S.; Nirwana, W.O. Temperature Control and In Situ Product Recovery Strategies to Enhance the Bioconversion of L-Phenylalanine into 2-Phenylethanol. J. Chem. Technol. Biotechnol. 2021, 96, 899–908. [Google Scholar] [CrossRef]
- Tian, S.; Liang, X.; Chen, J.; Zeng, W.; Zhou, J.; Du, G. Enhancement of 2-Phenylethanol Production by a Wild-Type Wickerhamomyces Anomalus Strain Isolated from Rice Wine. Bioresour. Technol. 2020, 318, 124257. [Google Scholar] [CrossRef] [PubMed]
- Pringle, A.T.; Forsdyke, J.; Rose, A.H. Scanning Electron Microscope Study of Saccharomyces Cerevisiae Spheroplast Formation. J. Bacteriol. 1979, 140, 289–293. [Google Scholar] [CrossRef]
- Long, J.; Cai, J.; Gao, X.; Wang, Y.-C.; Huang, X.-M.; Zhu, L. Investigation on Screening, Identification, and Fermentation Characteristics of Yunnan Olive in the Fermented Liquid Utilizing Five Strains of Saccharomyces Cerevisiae. Arch. Microbiol. 2024, 206, 164. [Google Scholar] [CrossRef]
- Zhao, Y.; Li, S.; Shu, Q.; Yang, X.; Deng, Y. Highly Efficient Production of 2-Phenylethanol by Wild-Type Saccharomyces Bayanus Strain. Bioresour. Technol. 2024, 403, 130867. [Google Scholar] [CrossRef]
- Muyanlı, E.B.; Yılmaz, R. RT-qPCR Based Quantitative Analysis of ARO and ADH Genes in Saccharomyces Cerevisiae and Metschnikowia Pulcherrima Strains Growth White Grape Juice. Mol. Biol. Rep. 2024, 51, 547. [Google Scholar] [CrossRef]
- Cheirsilp, B.; Torpee, S. Enhanced Growth and Lipid Production of Microalgae under Mixotrophic Culture Condition: Effect of Light Intensity, Glucose Concentration and Fed-Batch Cultivation. Bioresour. Technol. 2012, 110, 510–516. [Google Scholar] [CrossRef] [PubMed]
- Slaughter, J.C.; McKernan, G. The Influence of Pantothenate Concentration and Inoculum Size on the Fermentation of a Defined Medium by Saccharomyces Cerevisiae. J. Inst. Brew. 1988, 94, 14–18. [Google Scholar] [CrossRef]
- Helmstaedt, K.; Strittmatter, A.; Lipscomb, W.N.; Braus, G.H. Evolution of 3-Deoxy-D-Arabino-Heptulosonate-7-Phosphate Synthase-Encoding Genes in the Yeast Saccharomyces Cerevisiae. Proc. Natl. Acad. Sci. USA 2005, 102, 9784–9789. [Google Scholar] [CrossRef]
- Liu, H.; Xiao, Q.; Wu, X.; Ma, H.; Li, J.; Guo, X.; Liu, Z.; Zhang, Y.; Luo, Y. Mechanistic Investigation of a D to N Mutation in DAHP Synthase That Dictates Carbon Flux into the Shikimate Pathway in Yeast. Comm. Chem. 2023, 6, 152. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Wang, F.; Yu, Y.; Ding, S.; Chen, T.; Sun, W.; Liang, C.; Yu, B.; Ying, H.; Liu, D.; et al. Effect of Quorum-Sensing Molecule 2-Phenylethanol and ARO Genes on Saccharomyces Cerevisiae Biofilm. Appl. Microbiol. Biotechnol. 2021, 105, 3635–3648. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Yang, X.; Lin, B.; Huang, J.; Tao, Y. Cofactor Self-Sufficient Whole-Cell Biocatalysts for the Production of 2-Phenylethanol. Metab. Eng. 2017, 44, 143–149. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Fink, G.R. Feedback Control of Morphogenesis in Fungi by Aromatic Alcohols. Genes Dev. 2006, 20, 1150–1161. [Google Scholar] [CrossRef]
- Corre, J.; Lucchini, J.J.; Mercier, G.M.; Cremieux, A. Antibacterial Activity of Phenethyl Alcohol and Resulting Membrane Alterations. Res. Microbiol. 1990, 141, 483–497. [Google Scholar] [CrossRef]







| Time (min) | Mobile Phases A (%) | Mobile Phases B (%) |
|---|---|---|
| 0 | 99 | 1 |
| 7 | 99 | 1 |
| 15 | 70 | 30 |
| 30 | 0 | 100 |
| 35 | 0 | 100 |
| 35.1 | 99 | 1 |
| 42 | 99 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, C.; Fan, T.; Wang, Z.; Yu, J.; Guo, X.; Jiang, W.; Miao, L.; Yang, H. Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters. Foods 2025, 14, 2444. https://doi.org/10.3390/foods14142444
Zhang C, Fan T, Wang Z, Yu J, Guo X, Jiang W, Miao L, Yang H. Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters. Foods. 2025; 14(14):2444. https://doi.org/10.3390/foods14142444
Chicago/Turabian StyleZhang, Chenshuo, Tingwen Fan, Zhichun Wang, Jiamu Yu, Xiaoming Guo, Wei Jiang, Lili Miao, and Huaiyi Yang. 2025. "Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters" Foods 14, no. 14: 2444. https://doi.org/10.3390/foods14142444
APA StyleZhang, C., Fan, T., Wang, Z., Yu, J., Guo, X., Jiang, W., Miao, L., & Yang, H. (2025). Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters. Foods, 14(14), 2444. https://doi.org/10.3390/foods14142444

