Next Article in Journal
The Road to Re-Use of Spice By-Products: Exploring Their Bioactive Compounds and Significance in Active Packaging
Next Article in Special Issue
Honeysuckle as a Bio-Enhancer in Monascus purpureus Fermentation: Synergistic Improvement of Monacolin K Yield and Flavor Complexity
Previous Article in Journal
Sourdough Microbiota for Improving Bread Preservation and Safety: Main Directions and New Strategies
Previous Article in Special Issue
Plant Growth-Promoting Rhizobacteria Enhance Sweet Cherry Root System Development Through the Production of Volatile Organic Compounds
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters

1
State Key Laboratory of Microbial Diversity and Innovative Utilization, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China
2
State Key Laboratory of Animal Biotech Breeding, College of Biological Sciences, China Agricultural University, Beijing 100193, China
3
Technology Development and Transfer Center, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China
4
Department of Life Sciences, Imperial College London, South Kensington Campus, London SW7 2AZ, UK
5
School of Life Science, Dalian Minzu University, Dalian 116600, China
6
University of Chinese Academy of Sciences, Beijing 100049, China
7
Beijing Key Laboratory of Genetic Element Biosourcing & Intelligent Design for Biomanufacturing, Beijing 100101, China
*
Authors to whom correspondence should be addressed.
Foods 2025, 14(14), 2444; https://doi.org/10.3390/foods14142444
Submission received: 3 June 2025 / Revised: 2 July 2025 / Accepted: 9 July 2025 / Published: 11 July 2025

Abstract

2-Phenylethanol (2-PE), an aromatic alcohol with a rose-like fragrance, is widely used in the food, pharmaceutical, and high-end cosmetic industries. In this study, a high-yield 2-PE-producing strain was isolated and identified as Saccharomyces cerevisiae based on morphological characterization and taxonomic identification. Fermentation medium components (carbon and nitrogen sources) were optimized through single-factor experiments in shaking flasks, and fermentation medium with 40 g/L glucose, 5 g/L malt extract, 1.75 g/L corn steep liquor, 2.5 g/L yeast extract, 5 g/L malt extract, 1.75 g/L corn steep liquor was considered suitable for 2-PE production. RT-qPCR results indicated that corn steep liquor activates expression of genes related to the shikimate pathway and Ehrlich pathway (pha2, aro4, aro8, and aro9), thereby promoting the synthesis of 2-PE through these pathways. Excess yeast extract inhibited the expression of aro8 and aro9, while enhancing the expression of tdh3 and adh2, thus promoting the de novo synthesis of 2-PE. Furthermore, fermentation in a 5 L bioreactor was applied to investigate the effects of feeding strategies, inoculum proportion, and pH on 2-PE production. With a pH of 5.5 and10% inoculum proportion, the supplementation of the substrate L-Phe led to a 2-PE production of 4.81 g/L after 24 h of fermentation. Finally, in situ product recovery (ISPR) techniques was applied to alleviate 2-PE cytotoxicity, achieving a production of 6.41 g/L. This process offers a promising strategy for producing 2-PE efficiently and naturally, paving the way for further industrial applications in food, pharmaceutical, and cosmetic sectors.

1. Introduction

2-Phenylethanol (2-PE) is an aromatic alcohol derivative that possesses a characteristic and pleasant rose-like fragrance. 2-PE is widely utilized in daily applications due to its GRAS (Generally Recognized as Safe) status [1]. This designation confirms its safety for intentional use in food and beverage applications under specified conditions. 2-PE is used as an essential ingredient in high-quality cosmetic perfumes for creating rose-type and other floral scent profiles [2,3]. The high-boiling-point of 2-PE contributes to the aromatic profile of various alcoholic beverages. It readily forms esters with acids in wine, which contribute distinctly to the pleasant fruity aroma of wine [4]. Additionally, 2-PE is commonly employed as a flavoring agent in beverages, pastries, ice cream, and chewing gum [5]. 2-PE also exhibits significant antimicrobial properties. Researchers have explored the potential of 2-PE as an antimicrobial agent for protecting fruits, food products, and flowers [6,7]. According to Zou et al., 2-PE effectively inhibits the growth of Botrytis cinerea both in lab cultures and on strawberry, reducing natural disease while maintaining fruit quality under room temperature storage conditions [8]. Sun et al. have reported that 2-PE interferes with protein synthesis and degradation in Fusarium graminearum, significantly reducing deoxynivalenol production and providing effective control against Fusarium head blight in wheat [9]. Given its widespread use, the global demand for 2-phenylethanol (2-PE) is approximately 10,000 tons per year [10]. Currently, the majority of 2-PE is produced via chemical synthesis, which is often environmentally unfriendly [11]. Although extraction from plants is an alternative, this process proves excessively expensive (approximately US $1000/kg) and fails to meet commercial scale demand [12,13]. Consumers become increasingly conscious of environmental and health issues and consistently ask for affordable supplies, motivating suppliers to seek biotechnological alternatives for 2-PE production [14].
Today, with the development of synthetic biology, S. cerevisiae has used as an ideal chassis organism for producing diverse bioproducts, including terpenes, steroids, naringenin and so on [15,16,17]. S. cerevisiae can produce 2-PE naturally through both shikimate pathway and Ehrlich pathway (Figure 1). The high efficiency of the Ehrlich pathway makes it an attractive option for 2-PE biosynthesis, where L-phenylalanine (L-Phe) is converted to phenylpyruvate by transaminase and then decarboxylated to form phenylacetaldehyde, which is further converted into 2-PE [18]. As the regulatory pathways of 2-PE biosynthesis became clearer, researchers developed engineered strains to boost its synthesis efficiency [19,20]. However, the use of synthetic molecules produced by metabolic engineering strains is forbidden in food sectors. Screening wild-type strains and fermentation conditions optimization are economical strategies to enhance 2-PE production efficiency. Chreptowicz et al. isolated 28 yeast strains from plant materials and fermented food samples, among which a S. cerevisiae JM2014 strain demonstrated the highest 2-PE titer, reaching 3.28 g/L [21]. Shu et al. demonstrated that S. cerevisiae achieves high cell density growth at 25 °C with an aeration rate of 1.3 vvm, whereas 2-PE biosynthesis is favored at 35 °C and 2 vvm. Implementing a two-stage fermentation strategy (switching from 25 °C to 35 °C after 72 h) increased 2-PE yield by 19% compared to single-stage fermentation [22].
Although S. cerevisiae can naturally produce 2-PE, the commercial viability of this process has been limited by relatively low yield. To overcome this limitation, isolating and screening yeast strains with higher 2-PE production capabilities is crucial [23]. This study aims to optimize fermentation medium and parameters for high-yielding strains to maximize 2-PE productivity, while exploring the molecular mechanisms by which key nitrogen source regulate 2-PE biosynthesis. In this study, a high-yield S. cerevisiae D-22 was isolated and identified. Then single-factor experiments was conducted to examine the effects of fermentation medium composition on 2-PE production. Besides, the effect of the transcript level related to key 2-PE biosynthesis genes under different nitrogen source conditions was investigated by RT-qPCR. Further scale-up culture was conducted in a 5 L bioreactor to test effect of feeding strategies, inoculum proportion and pH on 2-PE production. Finally, in situ product recovery (ISPR) was employed to alleviate cellular inhibition of 2-PE and 2-PE production reached a high level, suggesting that the S. cerevisiae D-22 is an efficient and economical 2-PE producer.

2. Materials and Methods

2.1. Isolation of Yeast Strains

Twenty-seven strains were screened from our laboratory preserved microbial collection. To obtain single colonies, three rounds of streaking were carried out on YPD plate. Twenty-seven single colonies were cultured in YPD medium using shake flask fermentation at 30 °C for 36 h to assess 2-PE production.

2.2. Scanning Electron Microscopy

A single colony was isolated from a freshly YPD plate and was inoculated in a culture of 5 mL YPD medium for 16 h at 30 °C with 220 rpm. The culture media was centrifuged at 5000 rpm for 2 min and the supernatant was discard. The cell pellet was resuspended in 2.5% (wt/vol) glutaraldehyde immediately, and the suspension was incubated overnight at 4 °C for cell fixation. Fixed structures were washed three times with ddH2O. After centrifugation, the samples were sequentially dehydrated in a graded ethanol series (50%, 70%, 85%, and 95% (vol/vol)), and finally three times for 15 min in absolute ethanol. They were then dried in a Leica EM CPD300 (Leica, Wetzlar, German). Subsequently, the dried materials were mounted on a conductive stub using double-sided cellulose tape and sputter-coated with gold under an argon atmosphere. Samples were observed using a Hitachi SU8010 field-emission scanning electron microscope (Hitachi, Tokyo, Japan). An accelerating voltage of 3 kV was used [24].

2.3. Identification and Phylogenetic Analysis of the Isolated Yeast

To identify the isolated yeast strain, 18S rRNA sequencing analysis was carried out. Yeast genomic DNA was extracted using the TIANamp Yeast DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China). The 18S rRNA gene was amplified using the genomic DNA as a template, with primers listed in Table A1. PCR was performed under the following conditions: an initial denaturation at 98 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 1 min. A final extension step was conducted at 72 °C for 10 min. (The enzyme was purchased from Yeasen Biotechnology Co., Ltd. Shanghai, China) Purified PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). The sequencing results were aligned using nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/ 20 May 2025). Fifteen strains exhibiting high homology were selected as representative strains. Hanseniaspora uvarum NRRL Y-1614, a distantly related genus belonging to the same family, was included as an outgroup. Phylogenetic tree was constructed using MEGA (version 11.0, Pennsylvania State University, University Park, PA, USA) based on the neighbor-joining method with 1000 bootstrap replications [25].

2.4. Growth Conditions for Shake Flask Fermentation

Isolated S. cerevisiae D-22 cells were cultured on YPD plates at 30 °C for 2 days. A single colony was picked and placed in 50 mL fresh SM (seed medium, 40 g/L glucose, 2.5 g/L corn steep liquor, 20 g/L yeast extract, 10 g/L Malt extract, 6 g/L KH2PO4, 0.4 g/L MgSO4·7H2O, pH = 6.5, designed for rapid microbial propagation) and cultured overnight at 30 °C with shaking at 220 rpm to prepare the precultures. For shake flask fermentation, FM (fermentation medium, 40 g/L glucose, 1.75 g/L corn steep liquor, 2.5 g/L yeast extract, 5 g/L Malt extract, 6 g/L KH2PO4, 0.4 g/L MgSO4·7H2O, 0.2 g/L CaCl2, 8 g/L L-Phe, pH = 6.0, designed for both cell growth and 2-PE production) was modified from a previous study [26]. Precultures were inoculated at a final proportion of 10% (vol/vol) into 45 mL fermentation medium in a 500 mL shake flask and incubated at 30 °C with 220 rpm for 72 h.

2.5. RT-qPCR Assays for Yeast

S. cerevisiae D-22 cells were cultured for 24 h in three different media: fermentation medium (CK), a modified medium with elevated yeast extract concentration (increased from 2.5 g/L to 10 g/L, Yeast extract +), and another modified medium with complete removal of corn steep liquor (reduced from 1.75 g/L to 0 g/L, Corn steep liquor -). Following fermentation, cells were collected for total RNA extraction and subsequent RT-qPCR analysis to determine the transcript level related to key 2-PE biosynthesis pathway. Total RNA was extracted using RNAprep Pure Cell/Bacteria Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. 1 µg RNA was treated with M5 Super qPCR RT kit with gDNA remover (Mei5 Biotechnology Co., Ltd., Beijing, China) at 42 °C for 2 min to remove DNA and at 37 °C for 15 min to reverse transcription. The cDNA was used as the template to perform qPCR with Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix (Yeasen Biotechnology Co., Ltd., Shanghai, China). The β-actin gene served as the internal control. Data were analyzed with LightCycler® 4.2 Software [27]. Primers used for RT-qPCR analysis are listed in Appendix A, Table A2.

2.6. Fermentation in 5 L Fermenter

The S. cerevisiae D-22 cells were first grown in SM, and cultivated at 30 °C with 220 rpm for 24 h, then inoculated into 2 L FM in 5 L fermenter with a 10% (vol/vol) inoculum proportion (The seed culture has an OD600 of 19.35 ± 0.78). The 5 L fermentation was conducted under the following conditions: temperature was controlled at 30 ± 0.2 °C, aeration was set at 0.8 L/min, and dissolved oxygen (DO) was maintained at 35%. The pH was regulated at 5.5 ± 0.05 by automatic addition of 5 M NaOH. A feeding strategy was employed using 400 g/L glucose at a rate of 5–20 mL/h. The fermentation last from 24 h to 36 h.

2.7. Analysis Methods

Optical density was measured by using a Metash 721 spectrophotometer (Metash, Shanghai, China) at 600 nm.
The glucose concentrations in the supernatant were analyzed via the enzymatic autoanalyzer SBA-40C (Biology Institute of Shandong Academy of Sciences, Jinan, China). 25 μL of standard solution (1 g/L glucose solution) is injected into the SBA-40C. This procedure is repeated until the instrument automatically calibrates to 100. Then, the sample to be tested is injected, and the instrument displays the measured glucose concentration.
The 2-PE and L-Phe concentrations in the supernatant were analyzed via Agilent 1200 Series HPLC System (Agilent Technologies, Inc., Santa Clara, CA, USA) with a diode array detector (DAD) with a C18 column (250 × 4.6 mm, Phenomenex, Torrance, CA, USA). The mobile phase consisted of 0.1% formic acid (solvent A) and acetonitrile (solvent B), delivered at a flow rate of 0.8 mL/min. The column temperature was maintained at 25 °C, and the injection volume was 5 µL. The gradient elution program with a binary pump is shown in Table 1.

2.8. Statistical Analysis

Results in this study were presented as mean values with corresponding standard deviations (SD) (means ± S.D) of three independent assays. Statistical analysis of significant differences was performed using GraphPad Prism 8 (version 8.3.0.538, GraphPad Software, USA).

3. Results

3.1. Isolation of the 2-PE-Producing Strains

Twenty-seven yeast strains were isolated and cultured in YPD liquid medium. After 36 h of fermentation, a faint rose fragrance could be detected from the medium, suggesting the potential production of 2-phenylethanol (2-PE). Then, the 2-PE were analyzed using high-performance liquid chromatography (HPLC). Almost all of the yeasts were capable of producing 2-PE to some extent. However, the level of 2-PE producing from one strain which was named D-22 in this study is significantly higher than other strains and it reached to 517 mg/L (Figure 2A). Thus, strain D-22 was selected for further investigation. Using scanning electron microscope to perform morphological identification of strain D-22. As evident in the SEM micrographs (Figure 2B), a population of predominantly oval to spherical cells was observed, exhibiting smooth surface morphology with diameters ranging from 2 to 10 μm. Some cells exhibited budding structures, where daughter cells emerged as surface protrusions morphologically identical to mother cells. Following bud detachment, characteristic circular scar structures (bud scars) remained on the mother cell surface, demonstrating typical features of budding yeast reproduction. 18S rRNA of strain D-22 was sequenced and aligned using NCBI blast to identify the biological classification status of strain D-22 (Figure 2C). It was found that D-22 was clustered with S. cerevisiae XP-8 (GenBank accession number: NG 063315.12), and the 18S rRNA gene sequence of D-22 had 99.73% homology with XP-8. Based on morphoagronomic characterization and phylogenetic analysis, strain D-22 was identified as S. cerevisiae and designated as S. cerevisiae D-22.

3.2. Effect of Fermentation Medium Composition on 2-PE Production

To further improve the 2-PE production, fermentation medium (40 g/L glucose, 1.25 g/L corn steep liquor, 5 g/L yeast extract, 5 g/L Malt extract, 6 g/L KH2PO4, 0.4 g/L MgSO4·7H2O, 0.2 g/L CaCl2, 8 g/L L-Phe, pH = 6.0) was employed and modified. Glucose plays a crucial role in both cell growth and product synthesis. Therefore, optimizing its initial concentration is essential for improving 2-PE production [28]. To increase 2-PE production, the optimized medium was obtained by single factor experiments. The effect of different initial glucose concentrations (20, 30, 40, 50 and 60 g/L) on 2-PE production was tested (Figure 3A). The 2-PE production was reached 4.03 g/L and 4.29 g/L with 40 g/L and 50 g/L initial glucose respectively. However, significant differences were observed in residual L-Phe concentrations (1.54 g/L and 2.80 g/L), corresponding to consumption rates of 80.80% and 65.05% respectively. The highest 2-PE production was achieved with 50 g/L initial glucose concentration, but this condition resulted in a 15.75% reduction in L-Phe consumption efficiency compared to the 40 g/L initial glucose concentration, leading to substantial substrate wastage. When the glucose concentration was higher than 50 g/L, the transformation of L-Phe decreases. Although 50 g/L glucose resulted in slightly higher 2-PE production than 40 g/L, the difference was not statistically significant (p > 0.05). Overall, a higher initial glucose concentration promoted 2-PE synthesis by enhancing L-Phe conversion, but considering both efficiency and resource utilization, 40 g/L glucose was selected for subsequent experiments.
The effect of three different nitrogen sources (corn steep liquor, yeast extract and malt extract) at different concentrations on 2-PE production was tested. The effect of corn steep liquor concentrations on 2-PE production was tested (Figure 3B). Interestingly, corn steep liquor as nitrogen source exhibited a positive effect on L-Phe transportation (Figure 3B). The absence of corn steep liquor significantly reduced the L-Phe transportation, resulting in a residual L-Phe concentration of 3.50 g/L. When 1.75 g/L of corn steep liquor was added to the medium, the residual L-Phe concentration decreases by approximately 32.57% compared to when it was not added. With the rise of yeast extract concentration, the residential L-Phe concentration increased, and the 2-PE production decreased (Figure 3C). These results indicate that yeast extract has a certain inhibitory effect on L-Phe transportation. However, the 2-PE production reached 2.76 g/L (0.023 mol/L) and with 10 g/L yeast extract when 1.69 g/L (0.010 mol/L) L-Phe was consumed. This suggests that approximately 0.013 mol/L (1.58 g/L) of 2-PE was synthesized from glucose, demonstrating that yeast extract can promote the strain’s de novo synthesis of 2-PE. The concentration of malt extract was positively correlated with L-Phe transportation and 2-PE production. As the concentration of malt extract increases, the residual L-Phe concentration gradually decreases. The 2-PE production reached 4.23 g/L with 5 g/L malt extract (Figure 3D). After optimized by single-factor experiments, the medium was adjusted to 40 g/L glucose, 1.75 g/L corn steep liquor, 2.5 g/L yeast extract, 5 g/L malt extract, 6 g/L KH2PO4, 0.4 g/L MgSO4·7H2O, 0.2 g/L CaCl2, and 8 g/L L-Phe, and the concentration of 2-PE increased from 4.03 g/L to 4.23 g/L. Additionally, the reduced yeast extract addition lowered the overall cost.

3.3. Effect of Different Nitrogen Source Conditions on 2-Phenylethanol Biosynthesis Genes

The results above demonstrated that yeast extract facilitates the de novo synthesis of 2-PE in S. cerevisiae D-22, while corn steep liquor promotes 2-PE production via the Ehrlich pathway. To investigate the effect of yeast extract and corn steep liquor on 2-PE biosynthesis genes, S. cerevisiae D-22 was cultured for 24 h in three different media: fermentation medium (CK), a modified medium with increased yeast extract concentration from 2.5 g/L to 10 g/L (Yeast extract +), and another modified medium with decreased corn steep liquor concentration from 1.75 g/L to 0 g/L (Corn steep liquor -). Following fermentation, cells were collected for total RNA extraction and subsequent RT-qPCR analysis to determine the transcript level related to key 2-PE biosynthesis pathway, including aro3, aro4, aro7, and pha2 (shikimate pathway); aro8, aro9, aro10, and adh2 (Ehrlich pathway); tdh3 (Embedn-Meyerhof-Parnas pathway); and zwf1 (pentose phosphate pathway) (Figure 4A).
Through three independent experimental replicates, the Ct values for aro3 consistently exceeded 32, indicating that aro3 remains transcriptionally silent under these culture conditions. The supplement of corn steep liquor resulted in upregulation of key genes in both the shikimate pathway and Ehrlich pathway (pha2, encoding prephenate dehydratase; aro4, encoding DAHP synthase; aro8, encoding aromatic aminotransferase I; and aro9, encoding aromatic aminotransferase II), consequently promoting both L-Phe consumption and 2-PE production. Supplement with excessive yeast extract triggered downregulation of aro8 and aro9 in S. cerevisiae D-22, impairing the conversion of L-Phe to phenylpyruvate and thereby inhibiting the metabolic flux from L-Phe to 2-PE. However, the transcript level of tdh3 and adh2 were significantly upregulated, leading to improve in 2-PE production from de novo synthesis. Therefore, corn steep liquor activates both shikimate pathway and Ehrlich pathway, thereby significantly increasing 2-PE production. Yeast extract inhibits conversion of L-Phe to 2-PE and enhances the de novo synthesis of 2-PE in S. cerevisiae D-22.

3.4. Effect of pH and Inoculum Proportion on 2-PE Production

Fed-batch fermentation of S. cerevisiae D-22 in 5 L bioreactor was carried out to improve 2-PE production. Fermentation medium containing 40 g/L glucose, 1.75 g/L corn steep liquor, 2.5 g/L yeast extract, 5 g/L Malt extract, 6 g/L KH2PO4, 0.4 g/L MgSO4·7H2O, 0.2 g/L CaCl2, 8 g/L L-Phe. Since S. cerevisiae D-22 is a wild-type strain, its optimal growth pH remains undetermined. To evaluate the influence of pH on fermentation, experiments were conducted at constant pH values ranging from 5.0 to 7.0 with a 10% inoculum proportion. Under a pH of 5.0, the 2-PE production reached 3.89 g/L at 22 h of fermentation (Figure 5A). Under a pH of 5.5, the 2-PE production peaked at 22 h, reaching 4.44 g/L (Figure 5B). However, under a pH of 6.0 and 7.0 (Figure 5C,D), the 2-PE production significantly decreased, which highest 2-PE production reached only 2.57 g/L and 2.83 g/L, respectively. Yeast thrives in slightly acidic environment, typically with an optimal growth pH range of 5.0–6.0. As the pH exceeded 6.0, 2-PE synthesis was inhibited, indicating that fermentation pH significantly influences the production of 2-PE by S. cerevisiae D-22.
Inoculum proportion could influence the accumulation of target metabolites. Insufficient biomass at lower inoculum levels may slow down product synthesis, while excessive inoculation can lead to inefficient substrate utilization and reduced yields [29]. To increase the performance of S. cerevisiae D-22 in 2-PE production, the influence of different inoculum proportion was investigated under a pH of 5.5 (Figure 5E,F). After 16 h of fermentation, the 2-PE production with a 20% inoculum proportion reached 4.25 g/L, which is an 11% increase compared to the 10% inoculum proportion. However, after 20 h of fermentation, the 2-PE yield with a 10% inoculum proportion reached 4.74 g/L, which is a 10% increase compared to the 20% inoculum proportion.

3.5. Using ISPR Technology to Alleviate Inhibitory Effects and Enhance 2-PE Production

In the later stages of fermentation, consumption of L-Phe decreased, possibly due to accumulation of product (2-PE), leading to chemical equilibrium and reduced conversion of L-Phe to 2-PE. To drive the metabolic flux toward 2-PE synthesis, an additional 2 g/L of L-Phe was added at 12 h. As a result, 2-PE production increased to 4.81 g/L at 21 h, with a productivity of 0.229 g/L/h (Figure 6A). This enhancement may attribute to the availability of more substrate to conversion. However, the maximum biomass decreased to 22.4 (OD600), which could be due to the inhibitory effect of elevated 2-PE concentrations on cell growth [10]. Therefore, the growth curve of S. cerevisiae D-22 was monitored in YPD medium containing different concentrations of 2-PE to assess its tolerance to 2-PE (Figure A1). The OD600 of the strain rapidly increased during 0–24 h (log phase), and gradually plateaued between 24–36 h (stationary phase) under 0 and 2 g/L of 2-PE concentration, indicating healthy growth of strain. However, the OD600 remained consistently low all the time when 2-PE concentration exceeded 4 g/L, indicating a significant cell damage.
Due to the toxicity of 2-PE, which inhibits cell growth, in situ product recovery (ISPR) technology was employed to recover 2-PE onto the extractant, alleviating the inhibitory effects of 2-PE and promoting chemical equilibrium towards 2-PE synthesis to enhance its production (Figure 6B). At 10 h of fermentation, 1 L of oleic acid was added to the medium, and the 2-PE production in the aqueous phase rapidly decreased from 2.18 g/L at 9 h to 0.396 g/L at 12 h. At 24 h, the 2-PE production in the oil phase reached 12.04 g/L, while in the aqueous phase it was 0.94 g/L, resulting in a total 2-PE production of 6.41 g/L. This represents a 33% increase compared to the fermenter supplemented with L-Phe, with a productivity of 0.267 g/L/h.
2-Phenylethanol (2-PE) is widely used in daily life. Beyond its extensive applications in food industry, perfumes and cosmetics, its antimicrobial activity also provides a foundation for developing novel green food preservatives. Many yeasts can naturally produce 2-phenylethonal (2-PE), but low production has limited the commercial application. In our work, a wild-type strain S. cerevisiae D-22 that highly efficient produced of 2-PE was screened. We obtained fermentation medium suitable for production of 2-PE by optimized fermentation medium composition. Besides, we observed that 2-PE production increases while L-Phe conversion decreases with high glucose. Yeast can produce 2-PE through both shikimate pathway (using glucose as the substrate) and Ehrlich pathway (using L-Phe as the substrate). Once Ehrlich pathway was shut down by low L-Phe conversion, shikimate pathway can be used as alternative pathway to synthesis 2-PE. It is not contradiction that 2-PE production increase when L-Phe conversion decreases as Figure 4 and had demonstrated that yeast extract facilitates the de novo synthesis of 2-PE. We presume that high glucose also can simulated de novo synthesis the 2-PE production. To investigate the effect of yeast extract and corn steep liquor on 2-PE production, we detected the transcript level of 2-PE biosynthesis-related genes in different medium using RT-qPCR. aro3 remains transcriptionally silent under these culture conditions, which may be attributed to feedback inhibition of the DAHP synthase (ARO3) by L-Phe [30]. The presence of excessive L-Phe in the medium inhibits DAHP synthase enzymatic activity and aro3 gene expression. DAHP synthase is one of key enzymes in the shikimate pathway, catalyzing the condensation of erythrose-4-phosphate (E4P) and phosphoenolpyruvate (PEP) to form 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP). DAHP synthase has two isoenzymes: ARO3 and ARO4, which are feedback-inhibited by L-Phe and L-Tyr, respectively. Overexpressing feedback inhibition-resistant mutants via site-directed mutagenesis is an effective strategy to alleviate amino acid-mediated suppression of DAHP synthase. This approach can enhance carbon flux toward the shikimate pathway, thereby further increasing 2-PE production [31]. Since ARO7 (chorismate mutase) and PHA2 (prephenate dehydratase) exhibit limited native expression, overexpression of aro7 and pha2 may increase phenylpyruvate (precursor of 2-PE) supply, potentially elevating 2-PE production. ARO8 (aromatic aminotransferase I) and ARO9 (aromatic aminotransferase II) catalyze the conversion of L-Phe to phenylpyruvate. Excessive yeast extract supplementation and removal of corn steep liquor downregulated the expression of aro8 and aro9, resulting in decreased 2-PE production, consistent with previous reports [32]. In addition to insufficient precursor supply, the efficiency of biocatalysis is also constrained by inadequate cofactor supply and regeneration. The transcript level of tdh3 (encoding glyceraldehyde-3-phosphate dehydrogenase) and adh2 (encoding alcohol dehydrogenase 2) were significantly upregulated. Glyceraldehyde-3-phosphate dehydrogenase (TDH3) catalyzes the conversion of glyceraldehyde-3-phosphate (G3P) to 1,3-bisphosphoglycerate, subsequently generating phosphoenolpyruvate (PEP, one of a key precursor of shikimate pathway) while concomitantly reducing NAD+ to NADH. Subsequently, alcohol dehydrogenase 2 (ADH2) then utilizes NADH to reduce phenylacetaldehyde (PAC) to 2-PE, simultaneously regenerating NAD+. Therefore, the upregulation of tdh3 enhanced PEP and NADH production, supplying both the PEP (precursor of 2-PE) and NADH (reducing equivalents) required for 2-PE synthesis. Besides, the upregulation of adh2 channeled metabolic flux toward 2-PE biosynthesis and sustaining NAD+/NADH homeostasis through its redox activity. This coordinated regulation created a recyclable and efficient metabolic network that enhanced the de novo synthesis of 2-PE (Figure 7). Wang et al. established a cofactor self-sufficient system in Escherichia coli by coupling glutamate dehydrogenase with transaminase and alcohol dehydrogenase. This design enabled simultaneous regeneration of the cosubstrate (2-oxoglutarate) and redox cofactor (NAD(P)H), thereby enhancing 2-PE production [33]. Therefore, cofactor/redox imbalance strategy is feasible for enhanced production of diverse chemicals.
To further improve 2-PE production, fed-batch fermentation was performed in a 5 L bioreactor. The highest 2-PE production was reached at a pH of 5.5, and 2-PE production significantly decreased as the pH exceeded 6.0. It showed that pH has a significant impact on the 2-PE production. The highest biomass (OD600) reached 26.18, 26.30, 23.12 and 24.20 under a pH of 5.0, 5.5, 6.0 and 7.0. Therefore, pH influences cellular growth and thus affects the accumulation of production. Yeast prefers slightly acidic conditions, while its growth is inhibited under neutral conditions, thereby limiting product synthesis. Besides, the pH of the medium has a significant effect on the ionic state of the substrate and affect the adsorption capacity of 2-PE on the adsorbent [12]. The isoelectric point (pI) of L-Phe is 5.48. Maintaining the fermentation pH close the value of pI may enhance its uptake and subsequent conversion to 2-PE by yeast cells, potentially improving 2-PE production. In summary, controlling the pH within an optimal range in the fermentation process can enhance cell growth and 2-PE production. A higher 2-PE production was observed with a 10% inoculum proportion than a 20% inoculum proportion. This could be due to the morphological alterations in cells induced by high cell density, which in turn restrict the biosynthesis of aromatic alcohols [34]. Concurrently, a higher inoculum proportion could introduce substantial metabolic byproducts, inhibiting both cell growth and fermentation. Furthermore, accelerated nutrient depletion during early growth phase leads to insufficient nutrient for the later stages of fermentation.
In the later stages of fermentation, consumption of L-Phe decreased, possibly due to accumulation of product (2-PE), leading to chemical equilibrium and reduced conversion of L-Phe to 2-PE. To shift the equilibrium toward 2-PE synthesis, additional substrate (L-Phe) was supplemented during fermentation, resulting in a maximum 2-PE yield of 4.81 g/L. However, the more decline in L-Phe was not accompanied with more 2-PE production, and the maximum biomass only reached 22.4 (OD600). Tolerance test of S. cerevisiae D-22 to 2-PE revealed severe inhibition at a concentration of 4 g/L. Thus, the limited biomass and production bottleneck may be attributed to the toxicity of high 2-PE concentrations. To alleviate the inhibitory effect of 2-PE on the cell, in situ product recovery (ISPR) techniques was implemented to maintain low 2-PE concentration in the medium. 2-PE exhibits antimicrobial activity, and it primarily breaks the cell membrane [35]. As a monounsaturated fatty acid, oleic acid can modulate membrane fluidity and maintain its structural integrity, thereby stabilizing cellular homeostasis. Therefore, oleic acid was selected as the ISPR extractant for dual purposes: alleviating 2-PE cytotoxicity by reducing its concentration in the medium, and driving the equilibrium toward enhanced 2-PE synthesis. Preliminary experiments indicated that 2-PE was primarily produced during the logarithmic phase, and its excessive accumulation causes the strain to enter the stationary phase more rapidly. Therefore, oleic acid was introduced as an extractant before 2-PE concentration reached inhibitory level to remove 2-PE from the medium. The 2-PE concentration in the medium rapidly decreased and remained low level after oleic acid was added. Additionally, no L-Phe was detected in the medium after 21 h, and the 2-PE content in the oleic acid phase peaked at 24 h. This suggests that reducing 2-PE concentration alleviated cellular inhibition and enhanced the conversion of L-Phe to 2-PE. Thus, significantly enhanced both the strain’s viability and 2-PE productivity.

4. Conclusions

In this study, a wild-type strain of S. cerevisiae D-22 that naturally produces high levels of 2-phenylethonal (2-PE) has been identified. The fermentation conditions were optimized by adjusting the initial glucose and nitrogen concentrations in the fermentation medium. Analysis of transcript level of 2-PE biosynthesis related genes under different nitrogen source conditions revealed that yeast extract enhanced de novo synthesis of 2-PE, and corn steep liquor enhanced both shikimate pathway and Ehrlich pathway and promoted 2-PE production in S. cerevisiae D-22. Furthermore, controlling pH, and inoculum proportion were optimized to enhance 2-PE production in 5 L bioreactor. Under a pH of 5.5 and 10% inoculum proportion, in situ product recovery (ISPR) techniques was employed to recover 2-PE, alleviating the inhibitory effects of 2-PE. As a result, a 2-PE production of 6.41 g/L with a productivity of 0.267 g/L/h was achieved in a 5 L bioreactor. The results indicated that S. cerevisiae D-22 was a competitive strain for 2-PE production.

Author Contributions

C.Z., formal analysis, investigation, data curation, writing—original draft, conceptualization; T.F., investigation, data curation, conceptualization; Z.W., investigation, data curation, conceptualization; J.Y., investigation, data curation; X.G., investigation, data curation; W.J., writing—review and editing, supervision; L.M., writing—review and editing, conceptualization, supervision; H.Y., writing—review and editing, supervision, funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (Grant No. 2021YFA1301002), Instrument Developing Project of 411 Chinese Academy of Science (YJKYYQ20210032) and Beijing Municipal Science & 412 Technology Project, China (Z241100007724009).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
2-PE2-Phenylethonal
AKGα-Ketoglutaric acid
CHOChorismate
DAHP3-Deoxy-D-arabino-heptulosonic acid 7-phosphate
E4PErythrose-4-phosphate
EMPEmbden–Meyerhof–Parnas pathway
FDAFood and drug administration
GLUGlutamate
GRASGenerally recognized as safe
ISPRIn situ product recovery
PhePhenylalanine
PAAPhenylacetate
PABAPara-Aminobenzoic acid
PACPhenylacetaldehyde
PEPPhosphoenolpyruvate
PPPPentose phosphate pathway
PPYPhenylpyruvate
PREPPrephenate
S3PShikimate-3-phosphate
SHIKShikimate
TYRTyrosine

Appendix A

Figure A1. The effect of different 2-PE concentrations on cell growth of S. cerevisiae D-22.
Figure A1. The effect of different 2-PE concentrations on cell growth of S. cerevisiae D-22.
Foods 14 02444 g0a1
Table A1. List of primers used in this study.
Table A1. List of primers used in this study.
PrimersSequence (5′–3′)Description
NS1GTAGTCATATGCTTGTCTCAmplification of 18S rRNA fragment for sequencing
NS8TCCGCAGGTTCACCTACGGA
qP-actin-FGCCCCAGAAGCTTTGTTCCAAmplification of β-actin for RT-qPCR
qP-actin-RGATGGAGCCAAAGCGGTGAT
qP-aro3-FTTGTTTCTCCTTGGGTGCCAAmplification of aro3 for RT-qPCR
qP-aro3-RTTCAGTGCCCACGATAGCAG
qP-aro3-F2ACTGTTGGCTGGAAAGGGTTAmplification of aro3 for RT-qPCR
qP-aro3-R2TGGCACCCAAGGGAAACAA
qP-aro4-FCGTCGGCTGGAAAGGTCTAAAmplification of aro4 for RT-qPCR
qP-aro4-RGAGATTCGGTGGTTCTGGCA
qP-aro7-FACTTCGGTTCTGTTGCCACTAmplification of aro7 for RT-qPCR
qP-aro7-RCTCGTTGGTAGGGTCCACAC
qP-pha2-FGCCAGCAAGACTTTGAGGGTAmplification of pha2 for RT-qPCR
qP-pha2-RGCTGCTGGGAGGTACTCAAC
qP-aro8-FTCACCCAAGCCTCCTTTTCCAmplification of aro8 for RT-qPCR
qP-aro8-RTGGCTAAAACGTCCCAGTCC
qP-aro9-FATGTCATCCTTTCTGGCGGGAmplification of aro9 for RT-qPCR
qP-aro9-RTGGGACTCTCTGTCGAAGGT
qP-aro10-FGATTTCGCGTTTCCTTCGCAAmplification of aro10 for RT-qPCR
qP-aro10-RCTGCACCGTCACCTTCAAAC
qP-adh2-FCGCAGTCGTTAAGGCTACCAAmplification of adh2 for RT-qPCR
qP-adh2-RCCCACGTAAGAGCCGACAAT
qP-zwf1-FTCCCGCCTTATTTGGGCTTTAmplification of zwf1 for RT-qPCR
qP-zwf1-RCGACGTTGGCACTTTTCTCG
qP-tdh3-FACTGTCCACTCTTTGACTGCTAmplification of tdh3 for RT-qPCR
qP-tdh3-RCGACGGTTGGGACTCTGAAA
Table A2. Ct values of RT-qPCR.
Table A2. Ct values of RT-qPCR.
β-actinpha2aro4aro7aro8aro9aro10adh2tdh3zwf1aro3
CK21.41 26.54 21.99 26.15 23.28 21.76 20.40 23.52 19.58 ND31.35 
21.71 26.45 22.02 26.21 23.28 21.82 20.74 23.57 18.18 20.89 32.20 
21.22 26.21 21.81 25.67 23.24 21.65 20.67 23.32 18.06 20.96 32.29 
Yeast extract +21.53 26.41 22.66 25.95 23.98 22.12 20.91 21.37 17.32 21.38 33.42 
20.98 26.34 22.53 25.84 23.55 22.00 20.49 21.14 17.28 20.44 ND
21.15 26.26 22.52 25.56 23.79 21.96 20.46 21.36 17.09 21.45 33.42 
Corn steep liquor -20.76 27.07 23.81 25.57 24.66 22.36 20.98 22.53 17.86 20.69 ND
21.91 28.14 24.59 26.40 25.68 23.25 21.92 23.06 18.96 21.87 ND
21.02 27.33 24.04 26.19 24.79 22.59 21.20 23.83 18.09 20.96 ND
ND: Not detected.

References

  1. Zhan, Y.; Shi, J.; Xiao, Y.; Zhou, F.; Wang, H.; Xu, H.; Li, Z.; Yang, S.; Cai, D.; Chen, S. Multilevel Metabolic Engineering of Bacillus Licheniformis for De Novo Biosynthesis of 2-Phenylethanol. Metab. Eng. 2022, 70, 43–54. [Google Scholar] [CrossRef] [PubMed]
  2. Martínez, O.; Sánchez, A.; Font, X.; Barrena, R. Bioproduction of 2-Phenylethanol and 2-Phenethyl Acetate by Kluyveromyces Marxianus through the Solid-State Fermentation of Sugarcane Bagasse. Appl. Microbiol. Biotechnol. 2018, 102, 4703–4716. [Google Scholar] [CrossRef]
  3. Hua, D.; Xu, P. Recent Advances in Biotechnological Production of 2-Phenylethanol. Biotechnol. Adv. 2011, 29, 654–660. [Google Scholar] [CrossRef] [PubMed]
  4. Liu, P.; Wang, Y.; Ye, D.; Duan, L.; Duan, C.; Yan, G. Effect of the Addition of Branched-Chain Amino Acids to Non-Limited Nitrogen Synthetic Grape Must on Volatile Compounds and Global Gene Expression during Alcoholic Fermentation. Aust. J. Grape Wine Res. 2018, 24, 197–205. [Google Scholar] [CrossRef]
  5. Chantasuban, T.; Santomauro, F.; Gore-Lloyd, D.; Parsons, S.; Henk, D.; Scott, R.J.; Chuck, C. Elevated Production of the Aromatic Fragrance Molecule, 2-Phenylethanol, Metschnikowia Pulcherrima through Both De Novo and Ex Novo Conversion in Batch and Continuous Modes. J. Chem. Technol. Biotechnol. 2018, 93, 2118–2130. [Google Scholar] [CrossRef]
  6. Zhu, Y.-J.; Zhou, H.-T.; Hu, Y.-H.; Tang, J.-Y.; Su, M.-X.; Guo, Y.-J.; Chen, Q.-X.; Liu, B. Antityrosinase and Antimicrobial Activities of 2-Phenylethanol, 2-Phenylacetaldehyde and 2-Phenylacetic Acid. Food Chem. 2011, 124, 298–302. [Google Scholar] [CrossRef]
  7. Hayward, A.C. Biology and Epidemiology of Bacterial Wilt Caused by Pseudomonas Solanacearum. Annu. Rev. Phytopathol. 1991, 29, 65–87. [Google Scholar] [CrossRef]
  8. Zou, X.; Wei, Y.; Jiang, S.; Xu, F.; Wang, H.; Zhan, P.; Shao, X. ROS Stress and Cell Membrane Disruption Are the Main Antifungal Mechanisms of 2-Phenylethanol against Botrytis Cinerea. J. Agric. Food Chem. 2022, 70, 14468–14479. [Google Scholar] [CrossRef]
  9. Sun, S.; Tang, N.; Han, K.; Wang, Q.; Xu, Q. Effects of 2-Phenylethanol on Controlling the Development of Fusarium Graminearum in Wheat. Microorganisms 2023, 11, 2954. [Google Scholar] [CrossRef]
  10. Mitri, S.; Koubaa, M.; Maroun, R.G.; Rossignol, T.; Nicaud, J.-M.; Louka, N. Bioproduction of 2-Phenylethanol through Yeast Fermentation on Synthetic Media and on Agro-Industrial Waste and by-Products: A Review. Foods 2022, 11, 109. [Google Scholar] [CrossRef]
  11. Bernardino, A.R.S.; Torres, C.A.V.; Crespo, J.G.; Reis, M.A.M. Biotechnological 2-Phenylethanol Production: Recent Developments. Molecules 2024, 29, 5761. [Google Scholar] [CrossRef] [PubMed]
  12. Mei, J.; Min, H.; Lü, Z. Enhanced Biotransformation of L-Phenylalanine to 2-Phenylethanol Using an In Situ Product Adsorption Technique. Process Biochem. 2009, 44, 886–890. [Google Scholar] [CrossRef]
  13. Oliveira, S.M.M.; Gomes, S.D.; Sene, L.; Christ, D.; Piechontcoski, J. Production of Natural Aroma by Yeast in Wastewater of Cassava Starch Industry. Eng. Agric. 2015, 35, 721–732. [Google Scholar] [CrossRef][Green Version]
  14. Schrader, J.; Etschmann, M.; Sell, D.; Hilmer, J.-M.; Rabenhorst, J. Applied Biocatalysis for the Synthesis of Natural Flavour Compounds-Current Industrial Processes and Future Prospects. Biotechnol. Lett. 2004, 26, 463–472. [Google Scholar] [CrossRef] [PubMed]
  15. Gu, Y.; Jiao, X.; Ye, L.; Yu, H. Metabolic Engineering Strategies for De Novo Biosynthesis of Sterols and Steroids in Yeast. Bioresour. Bioprocess. 2021, 8, 110. [Google Scholar] [CrossRef]
  16. Liang, Z.; Zhi, H.; Fang, Z.; Zhang, P. Genetic Engineering of Yeast, Filamentous Fungi and Bacteria for Terpene Production and Applications in Food Industry. Food Res. Int. 2021, 147, 110487. [Google Scholar] [CrossRef]
  17. Li, H.; Ma, W.; Wang, W.; Gao, S.; Shan, X.; Zhou, J. Synergetic Engineering of Multiple Pathways for De Novo (2S)-Naringenin Biosynthesis in Saccharomyces Cerevisiae. ACS Sustain. Chem. Eng. 2024, 12, 59–71. [Google Scholar] [CrossRef]
  18. Wang, Z.; Bai, X.; Guo, X.; He, X. Regulation of Crucial Enzymes and Transcription Factors on 2-Phenylethanol Biosynthesis via Ehrlich Pathway in Saccharomyces Cerevisiae. J. Ind. Microbiol. Biotechnol. 2017, 44, 129–139. [Google Scholar] [CrossRef] [PubMed]
  19. Zhu, L.; Xu, S.; Li, Y.; Shi, G. Improvement of 2-Phenylethanol Production in Saccharomyces Cerevisiae by Evolutionary and Rational Metabolic Engineering. PLoS ONE 2021, 16, e0258180. [Google Scholar] [CrossRef]
  20. Zhu, L.; Wang, J.; Xu, S.; Shi, G. Improved Aromatic Alcohol Production by Strengthening the Shikimate Pathway in Saccharomyces Cerevisiae. Process Biochem. 2021, 103, 18–30. [Google Scholar] [CrossRef]
  21. Chreptowicz, K.; Sternicka, M.K.; Kowalska, P.D.; Mierzejewska, J. Screening of Yeasts for the Production of 2-phenylethanol (Rose Aroma) in Organic Waste-based Media. Lett. Appl. Microbiol. 2018, 66, 153–160. [Google Scholar] [CrossRef] [PubMed]
  22. Shu, C.-H.; Jhou, S.-S.; Nirwana, W.O. Temperature Control and In Situ Product Recovery Strategies to Enhance the Bioconversion of L-Phenylalanine into 2-Phenylethanol. J. Chem. Technol. Biotechnol. 2021, 96, 899–908. [Google Scholar] [CrossRef]
  23. Tian, S.; Liang, X.; Chen, J.; Zeng, W.; Zhou, J.; Du, G. Enhancement of 2-Phenylethanol Production by a Wild-Type Wickerhamomyces Anomalus Strain Isolated from Rice Wine. Bioresour. Technol. 2020, 318, 124257. [Google Scholar] [CrossRef] [PubMed]
  24. Pringle, A.T.; Forsdyke, J.; Rose, A.H. Scanning Electron Microscope Study of Saccharomyces Cerevisiae Spheroplast Formation. J. Bacteriol. 1979, 140, 289–293. [Google Scholar] [CrossRef]
  25. Long, J.; Cai, J.; Gao, X.; Wang, Y.-C.; Huang, X.-M.; Zhu, L. Investigation on Screening, Identification, and Fermentation Characteristics of Yunnan Olive in the Fermented Liquid Utilizing Five Strains of Saccharomyces Cerevisiae. Arch. Microbiol. 2024, 206, 164. [Google Scholar] [CrossRef]
  26. Zhao, Y.; Li, S.; Shu, Q.; Yang, X.; Deng, Y. Highly Efficient Production of 2-Phenylethanol by Wild-Type Saccharomyces Bayanus Strain. Bioresour. Technol. 2024, 403, 130867. [Google Scholar] [CrossRef]
  27. Muyanlı, E.B.; Yılmaz, R. RT-qPCR Based Quantitative Analysis of ARO and ADH Genes in Saccharomyces Cerevisiae and Metschnikowia Pulcherrima Strains Growth White Grape Juice. Mol. Biol. Rep. 2024, 51, 547. [Google Scholar] [CrossRef]
  28. Cheirsilp, B.; Torpee, S. Enhanced Growth and Lipid Production of Microalgae under Mixotrophic Culture Condition: Effect of Light Intensity, Glucose Concentration and Fed-Batch Cultivation. Bioresour. Technol. 2012, 110, 510–516. [Google Scholar] [CrossRef] [PubMed]
  29. Slaughter, J.C.; McKernan, G. The Influence of Pantothenate Concentration and Inoculum Size on the Fermentation of a Defined Medium by Saccharomyces Cerevisiae. J. Inst. Brew. 1988, 94, 14–18. [Google Scholar] [CrossRef]
  30. Helmstaedt, K.; Strittmatter, A.; Lipscomb, W.N.; Braus, G.H. Evolution of 3-Deoxy-D-Arabino-Heptulosonate-7-Phosphate Synthase-Encoding Genes in the Yeast Saccharomyces Cerevisiae. Proc. Natl. Acad. Sci. USA 2005, 102, 9784–9789. [Google Scholar] [CrossRef]
  31. Liu, H.; Xiao, Q.; Wu, X.; Ma, H.; Li, J.; Guo, X.; Liu, Z.; Zhang, Y.; Luo, Y. Mechanistic Investigation of a D to N Mutation in DAHP Synthase That Dictates Carbon Flux into the Shikimate Pathway in Yeast. Comm. Chem. 2023, 6, 152. [Google Scholar] [CrossRef] [PubMed]
  32. Zhang, D.; Wang, F.; Yu, Y.; Ding, S.; Chen, T.; Sun, W.; Liang, C.; Yu, B.; Ying, H.; Liu, D.; et al. Effect of Quorum-Sensing Molecule 2-Phenylethanol and ARO Genes on Saccharomyces Cerevisiae Biofilm. Appl. Microbiol. Biotechnol. 2021, 105, 3635–3648. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, P.; Yang, X.; Lin, B.; Huang, J.; Tao, Y. Cofactor Self-Sufficient Whole-Cell Biocatalysts for the Production of 2-Phenylethanol. Metab. Eng. 2017, 44, 143–149. [Google Scholar] [CrossRef] [PubMed]
  34. Chen, H.; Fink, G.R. Feedback Control of Morphogenesis in Fungi by Aromatic Alcohols. Genes Dev. 2006, 20, 1150–1161. [Google Scholar] [CrossRef]
  35. Corre, J.; Lucchini, J.J.; Mercier, G.M.; Cremieux, A. Antibacterial Activity of Phenethyl Alcohol and Resulting Membrane Alterations. Res. Microbiol. 1990, 141, 483–497. [Google Scholar] [CrossRef]
Figure 1. Metvbabolic pathway of 2-phenylethanol in microorganisms. GLC glucose, G6P glucose-6-phosphate, E4P erythose-4-phosphate, PEP phosphoenolpyruvate, DAHP 3-deoxy-D-arabino-heptulosonic acid 7-phosphate, SHIK shikimate, CHO chorismate, PREP prephenate, PPY phenylpyruvate, PHE phenylalanine, PAC phenylacetaldehyde, 2PE 2-phenylethonal.
Figure 1. Metvbabolic pathway of 2-phenylethanol in microorganisms. GLC glucose, G6P glucose-6-phosphate, E4P erythose-4-phosphate, PEP phosphoenolpyruvate, DAHP 3-deoxy-D-arabino-heptulosonic acid 7-phosphate, SHIK shikimate, CHO chorismate, PREP prephenate, PPY phenylpyruvate, PHE phenylalanine, PAC phenylacetaldehyde, 2PE 2-phenylethonal.
Foods 14 02444 g001
Figure 2. Isolation of the 2-PE-producing strains. (A) Comparison of 2-PE production of different strains in YPD medium; (B) Scanning electron microscope images of S. cerevisiae D-22; (C) Neighbor-joining phylogenetic tree based on 18S rRNA gene sequences of S. cerevisiae D-22.
Figure 2. Isolation of the 2-PE-producing strains. (A) Comparison of 2-PE production of different strains in YPD medium; (B) Scanning electron microscope images of S. cerevisiae D-22; (C) Neighbor-joining phylogenetic tree based on 18S rRNA gene sequences of S. cerevisiae D-22.
Foods 14 02444 g002
Figure 3. Influence of initial glucose and nitrogen sources concentration on 2-PE production. S. cerevisiae D-22 was cultured in FM medium with different concentrations of (A) initial glucose, (B) corn steep liquor, (C) yeast extract and (D) Malt extract for 72 h. The concentrations of both L-Phe and 2-PE were analyzed using HPLC. Error bars represent the standard deviation of three independent assays. Different letters indicated the significant difference based on one-way analysis of variance (ANOVA) (p < 0.05).
Figure 3. Influence of initial glucose and nitrogen sources concentration on 2-PE production. S. cerevisiae D-22 was cultured in FM medium with different concentrations of (A) initial glucose, (B) corn steep liquor, (C) yeast extract and (D) Malt extract for 72 h. The concentrations of both L-Phe and 2-PE were analyzed using HPLC. Error bars represent the standard deviation of three independent assays. Different letters indicated the significant difference based on one-way analysis of variance (ANOVA) (p < 0.05).
Foods 14 02444 g003
Figure 4. Influence of different nitrogen source conditions on 2-PE biosynthesis genes. (A) RT-qPCR assay to confirm the effect of the transcript level related to key 2-PE biosynthesis genes under different nitrogen source conditions. The transcript level of pha2 in the control group (CK) was set to 1 for normalization. Error bars represent the standard deviation of three independent assays. Asterisks indicated the significant difference based on unpaired Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.001); (B) GLC glucose, G6P glucose-6-phosphate, E4P erythose-4-phosphate, PEP phosphoenolpyruvate, DAHP 3-deoxy-D-arabino-heptulosonic acid 7-phosphate, SHIK shikimate, CHO chorismate, PREP prephenate, TYR L-tyrosine, PPY phenylpyruvate, PHE L-phenylalanine, PAC phenylacetaldehyde, PAA phenylacetate, 2PE 2-phenylethonal.
Figure 4. Influence of different nitrogen source conditions on 2-PE biosynthesis genes. (A) RT-qPCR assay to confirm the effect of the transcript level related to key 2-PE biosynthesis genes under different nitrogen source conditions. The transcript level of pha2 in the control group (CK) was set to 1 for normalization. Error bars represent the standard deviation of three independent assays. Asterisks indicated the significant difference based on unpaired Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.001); (B) GLC glucose, G6P glucose-6-phosphate, E4P erythose-4-phosphate, PEP phosphoenolpyruvate, DAHP 3-deoxy-D-arabino-heptulosonic acid 7-phosphate, SHIK shikimate, CHO chorismate, PREP prephenate, TYR L-tyrosine, PPY phenylpyruvate, PHE L-phenylalanine, PAC phenylacetaldehyde, PAA phenylacetate, 2PE 2-phenylethonal.
Foods 14 02444 g004
Figure 5. Influence of pH and inoculum proportion on 2-PE production. Cell growth, glucose and L-Phe consumption, and 2-PE production with (A) pH = 5; (B) pH = 5.5; (C) pH = 6; (D) pH = 7; (E) 20% inoculum proportion; (F) 10% inoculum proportion.
Figure 5. Influence of pH and inoculum proportion on 2-PE production. Cell growth, glucose and L-Phe consumption, and 2-PE production with (A) pH = 5; (B) pH = 5.5; (C) pH = 6; (D) pH = 7; (E) 20% inoculum proportion; (F) 10% inoculum proportion.
Foods 14 02444 g005
Figure 6. Fed-batch fermentation of S. cerevisiae D-22 in a 5 L bioreactor. Cell growth, glucose and L-Phe consumption, and 2-PE production. (A) following the addition of 2 g/L L-Phe at 12 h; (B) following the addition of 1 L oleci acid at 10 h. Discussion.
Figure 6. Fed-batch fermentation of S. cerevisiae D-22 in a 5 L bioreactor. Cell growth, glucose and L-Phe consumption, and 2-PE production. (A) following the addition of 2 g/L L-Phe at 12 h; (B) following the addition of 1 L oleci acid at 10 h. Discussion.
Foods 14 02444 g006
Figure 7. The upregulation of adh2 and tdh3 sustains NAD+/NADH homeostasis and enhances the de novo synthesis of 2-PE. GLC glucose, PEP phosphoenolpyruvate, PAC phenylacetaldehyde, 2PE 2-phenylethonal, TDH3 glyceraldehyde-3-phosphate dehydrogenase, ADH2 alcohol dehydrogenase 2.
Figure 7. The upregulation of adh2 and tdh3 sustains NAD+/NADH homeostasis and enhances the de novo synthesis of 2-PE. GLC glucose, PEP phosphoenolpyruvate, PAC phenylacetaldehyde, 2PE 2-phenylethonal, TDH3 glyceraldehyde-3-phosphate dehydrogenase, ADH2 alcohol dehydrogenase 2.
Foods 14 02444 g007
Table 1. Gradient elution procedure of mobile phase.
Table 1. Gradient elution procedure of mobile phase.
Time (min)Mobile Phases A (%)Mobile Phases B (%)
0991
7991
157030
300100
350100
35.1991
42991
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, C.; Fan, T.; Wang, Z.; Yu, J.; Guo, X.; Jiang, W.; Miao, L.; Yang, H. Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters. Foods 2025, 14, 2444. https://doi.org/10.3390/foods14142444

AMA Style

Zhang C, Fan T, Wang Z, Yu J, Guo X, Jiang W, Miao L, Yang H. Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters. Foods. 2025; 14(14):2444. https://doi.org/10.3390/foods14142444

Chicago/Turabian Style

Zhang, Chenshuo, Tingwen Fan, Zhichun Wang, Jiamu Yu, Xiaoming Guo, Wei Jiang, Lili Miao, and Huaiyi Yang. 2025. "Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters" Foods 14, no. 14: 2444. https://doi.org/10.3390/foods14142444

APA Style

Zhang, C., Fan, T., Wang, Z., Yu, J., Guo, X., Jiang, W., Miao, L., & Yang, H. (2025). Screening of High-Yield 2-Phenylethanol Producing Strain from Wild-Type Saccharomyces cerevisiae and Optimization of Fermentation Parameters. Foods, 14(14), 2444. https://doi.org/10.3390/foods14142444

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop