An Integrated PMA Pretreatment Instrument for Simultaneous Quantitative Detection of Vibrio parahaemolyticus and Vibrio cholerae in Aquatic Products
1
College of Food Science and Technology, Shanghai Ocean University, Shanghai 201306, China
2
International Research Center for Food and Health, Shanghai Ocean University, Shanghai 201306, China
3
Shanghai Hi-Chain Food Co., Ltd., Shanghai 201913, China
*
Authors to whom correspondence should be addressed.
Foods 2025, 14(13), 2166; https://doi.org/10.3390/foods14132166 (registering DOI)
Submission received: 10 May 2025
/
Revised: 17 June 2025
/
Accepted: 19 June 2025
/
Published: 21 June 2025
(This article belongs to the Special Issue Recent Research on Foodborne Bacteria Detection and Inactivation Technology)
Abstract
:Traditional hazard identification techniques for Vibrio parahaemolyticus often neglect the distinction between viable and nonviable bacteria in aquatic products, leading to overestimated disease risks and uncertainties in risk assessments. To address this limitation, we developed an automated PMA pretreatment instrument that integrates dark incubation and photo-crosslinking into a unified workflow, allowing customizable parameters such as incubation time, light exposure duration, and mixing speed while maintaining stable temperatures (<±1 °C fluctuation) to preserve bacterial DNA integrity. Leveraging this system, a duplex qPCR assay was optimized for simultaneous quantitative detection of V. parahaemolyticus and V. cholerae in aquatic products and environmental samples. The assay demonstrated robust performance with 90–110% amplification efficiencies across diverse matrices, achieving low limits of detection (LODs) of 101–102 CFU/mL in shrimp farming environment water and 102–103 CFU/g in shrimp (Litopenaeus vannamei) and oyster (Crassostrea gigas). Notably, it effectively discriminated viable bacteria from 106 CFU/mL(g) nonviable cells and showed strong correlation with ISO-standard methods in real-world sample validation. This integrated platform offers a rapid, automated solution for accurate viable bacterial quantification, with significant implications for food safety, pathogen surveillance, and risk management in aquatic industries.
1. Introduction
Vibrio species are the most common pathogenic bacteria found in seafood, with Vibrio parahaemolyticus being the leading seafood-borne pathogen in China. Food poisoning incidents caused by this bacterium rank first among bacterial foodborne illnesses and are considered one of the primary causes of diarrheal diseases worldwide [1,2,3,4]. Vibrio cholerae, the main causative agent of cholera, is widely distributed and classified as a severe infectious disease. It has repeatedly caused large-scale outbreaks, primarily characterized by severe vomiting, diarrhea, and dehydration, which can lead to death in severe cases [5,6,7]. Therefore, developing a rapid, accurate, and efficient method for identifying pathogenic Vibrio in seafood is crucial for enhancing seafood quality and improving public health, holding significant scientific and practical value.
Traditional methods for quantitatively detecting these two foodborne pathogens in food require approximately one week [8,9,10], including sample collection and pretreatment (Step 1), selective cultivation (Step 2), strain purification (Step 3), physiological and biochemical identification (Step 4), and molecular biological identification (Step 5). Enzyme-linked immunosorbent assay (ELISA) based on immunological techniques can specifically bind and detect the thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) produced by pathogenic V. parahaemolyticus [11]. However, it cannot directly detect viable bacteria in the samples, which limits its ability to accurately measure the contamination risk in the samples. Lateral flow assays are widely used for on-site detection [12]; however, their limitations are also evident, as they can only perform qualitative tests and cannot provide precise quantitative measurements of samples. Although DNA-based quantitative PCR (qPCR) technology is convenient and fast, it cannot distinguish between viable and nonviable bacteria in samples, leading to potential false-positive results [13,14,15]. Propidium monoazide (PMA) is a photosensitive nucleic acid dye that, when combined with qPCR technology, can selectively identify viable bacterial DNA in food, thereby achieving the goal of quantifying viable bacteria [16,17,18]. The PMA pretreatment process involves two key steps: dark treatment and photolysis. The specific operational steps are as follows: First, an appropriate concentration of PMA is added to the sample. Under dark conditions, this dye selectively enters the cells of nonviable bacteria with damaged membranes. Upon exposure to activating light (halogen lamp or LED blue light), the azide groups of PMA molecules have the capability to react with hydrocarbons of double-stranded DNA, forming stable covalent nitrogen–carbon bonds and producing stable covalent crosslinked precipitates. This process inhibits the effective amplification of nonviable bacterial DNA, eliminating the possibility of false-positive results caused by nonviable bacterial DNA, while having no effect on intact viable bacteria [17,19,20].
Traditional PMA pretreatment methods typically use a closed environment for dark treatment, followed by photolysis with a handheld sodium tungsten lamp of approximately 600 W [21,22]. While this method is effective, it is cumbersome, requires manual operation, and is time-consuming. A PMA manufacturer has developed a blue LED tube-based commercial PMA treatment device that significantly simplifies the PMA pretreatment process; however, this instrument has notable drawbacks: it separates the dark treatment and photolysis steps, necessitating cumbersome manual transfer operations during the PMA treatment process, which does not align with the modern design concept of fully automated high-tech instruments.
This study addresses this limitation by constructing a novel instrument for the rapid screening of viable bacterial DNA suitable for PMA-qPCR pretreatment. This instrument integrates the two core steps of dark treatment and photolysis into one, achieving an integrated and fully automated PMA pretreatment process, thereby simplifying the PMA-qPCR pretreatment process from the outset and enhancing PMA treatment efficiency. Based on this integrated PMA pretreatment instrument, we have developed a dual qPCR technology combining the advantages of PMA and multiplex qPCR, specifically targeting V. parahaemolyticus and V. cholerae in seafood. This technology can be used for the quantitative detection of viable pathogenic Vibrio cells in seafood and related aquatic environments, providing a new detection and analysis tool for identifying the hazards posed by V. parahaemolyticus.
2. Materials and Methods
2.1. Materials for PMA Pretreatment Instrument
The LED blue light lamps used in this study were purchased from CREE, USA, totaling 24 units, with a power range of 1–3 W, voltage parameters of 3.0–3.7 V, and a current range of 350–1000 mA. The color temperature wavelength was 410–420 nm, producing blue light with a purplish/deep blue tint. The digital timer was obtained from Wenzhou Dahua Instrument Co., Ltd., Zhejiang, China; the digital rotary regulator was sourced from JSCC, Taiwan, China; the transformer was purchased from Mingwei Co., Ltd., Taiwan, China; and the welding equipment utilized was an argon arc welder from Shenzhen Ruilong Welding Machine, Guangdong, China, model TIG 400GT. The stainless steel plates used for constructing the apparatus were acquired from Xiamen Tungsten Industry Co., Ltd., Fujian, China, measuring 1.5 mm and made of food-grade 304 stainless steel.
2.2. V. parahaemolyticus and V. cholerae Strains
The strains used in this study were V. parahaemolyticus ATCC33847 and V. cholerae GIM1.449. The GIM1.449 strain was obtained from the Guangdong Institute of Microbiology and is a low-toxicity strain that is non-O1 and non-O139, suitable for routine laboratory research. The glycerol stock of the strains was streaked onto a Chromogenic Vibrio agar plate and single colonies were picked and inoculated into 10 mL TSB (1% NaCl, pH 8.0). All experiments were conducted in a biosafety cabinet. The inoculated bacterial suspension was placed in a bacterial incubator at 37 °C with a shaking speed of 200 r/min and incubated overnight for 16–24 h, yielding a V. parahaemolyticus culture with a concentration of 109 CFU/mL and a V. cholerae culture with a concentration of 107 CFU/mL.
2.3. Design of the Integrated PMA Pretreatment Instrument
The design schematic for the integrated PMA pretreatment instrument, suitable for PMA-qPCR preprocessing, was created using drawing software, as shown in Figure 1. The instrument primarily consists of a PMA top cover, LED blue light source, digital timer, digital rotary regulator, rotary mixing device, and motor chamber. The overall shape of the instrument is rectangular, with approximate dimensions of 25 × 20 × 20 cm. All conceptual diagrams presented in this chapter were drafted using AutoCAD 2016 (Computer Aided Drafting) software, which was purchased from Autodesk, Denver, CO, USA.
2.4. PMA Pretreatment Process Based on Integrated PMA Pretreatment Instrument
To prepare a 2 mM PMA stock solution, 980 μL of double-distilled water was added to 1 mg of PMA (Biotium, Hayward, CA, USA). A total of 12.5 μL of the PMA stock solution was then added to the sample to achieve a final concentration of 50 μM PMA in the mixture [23]. The sample was placed in the integrated PMA pretreatment instrument constructed for this study, which was adjusted from our laboratory’s previous research [24,25], with a dark treatment time set to 30 min and a light treatment time also set to 30 min. The instrument was then activated. At a rotation speed of 1000 rpm, the nonviable bacterial DNA in the sample reacted fully with PMA in the instrument, forming a stable covalent crosslinked precipitate to facilitate the selection of viable bacterial DNA. The reacted sample was then centrifuged at 12,000 rpm to collect the viable bacterial cells. The viable bacterial DNA was extracted from the samples using a bacterial DNA extraction kit (Tiangen Bictech (Beijing) Co.,Ltd. Beijing, China. DNA concentration was determined using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific (Shanghai) Co., Ltd., Shanghai, China).
2.5. Primers, Probes, and PCR Reaction Conditions
The primers and probes used for the quantitative detection of V. parahaemolyticus and V. cholerae are listed in Table 1 and were custom ordered from Invitrogen, a subsidiary of Thermo Fisher Scientific.
qPCR reaction conditions: predenaturation temperature: 95 °C for 2 min; denaturation at 95 °C for 15 s; annealing temperature: 60 °C for 1 min. The denaturation and annealing processes were repeated for a total of 40 cycles; the melting curve was automatically generated by the system. Reactions were performed in triplicate and average values were taken.
The 20 μL qPCR reaction system consisted of 0.2 μL Taq DNA polymerase, 0.5 μL forward primer, 0.5 μL reverse primer, 0.2 μL TaqMan probe, 2 μL PCR reaction solution, 1.2 μL Mg2+ solution, 0.8 μL dNTPs solution, and 1 μL DNA template, with the remainder filled with ddH2O to a total volume of 20 μL. For the no template control (NTC), 1 μL of ddH2O was added in place of the DNA template. The standard strains V. parahaemolyticus ATCC33847 and V. cholerae GIM1.449 were used as amplification controls. All reagents were sourced from Invitrogen, a subsidiary of Thermo Fisher Scientific, and the PCR reactions were conducted using the 7500 Fast real-time PCR instrument (Thermo Fisher Scientific (Shanghai) Co., Ltd., Shanghai, China). The postprocessing software for qPCR reactions was 7500 Software v2.0.6, downloaded from the official website of Applied Biosystems, Inc., USA. The CT threshold was set to 10 times the baseline of the fluorescence signal.
2.6. Specificity Analysis of PMA Duplex qPCR Technology
The strains used for the specificity detection of PMA duplex qPCR are shown in Table 2, which includes 62 strains of V. parahaemolyticus, 31 strains of V. cholerae, 3 other strains of the Vibrio genus, and 7 non-Vibrio strains. DNA from different strains was extracted using a bacterial DNA extraction kit and PMA duplex qPCR detection was performed to validate the specificity and selectivity of the PMA duplex qPCR, with each experimental group repeated three times.
2.7. Construction of the Standard Curve for PMA Duplex qPCR Technology
The standard curve for this study was constructed based on actual samples collected from the shrimp farming environment in Fengxian District, Shanghai, where shrimp and oyster were purchased from a seafood market in Pudong New District, Shanghai. A total of 25 g of shrimp and oyster was homogenized in 225 mL of alkaline peptone water (APW) to obtain homogenates. A bacterial suspension of 109 CFU/mL of V. parahaemolyticus and 107 CFU/mL of V. cholerae was diluted using the shrimp farming environment water, homogenate of South American white shrimp, and homogenate of oyster to obtain samples containing 101 to 108 CFU/mL(g) of V. parahaemolyticus and 101 to 106 CFU/mL(g) of V. cholerae, with each experimental group repeated three times.
PMA pretreatment, DNA extraction, and PMA duplex qPCR quantitative detection were performed, using the results from colony counts and the CT values from duplex qPCR to construct the standard curve for the reaction, thereby determining the limit of detection (LOD) for the PMA duplex qPCR. The limit of quantification (LOQ) was set to 3 times the LOD. All the measurements were conducted in triplicate. The CT values were expressed as the mean ± standard deviation (SD). The amplification efficiency of the PMA duplex qPCR reaction was calculated using the slope (k) of the standard curve with Formula (1)
E = 10−1/k − 1,
2.8. Preparation of Inactivated Pathogenic Vibrio
A total of 10 mL of 107 CFU/mL suspensions of V. parahaemolyticus and V. cholerae were subjected to high-temperature and high-pressure sterilization at 121 °C for 20 min to obtain inactivated bacterial cells. The vitality of the bacteria was confirmed using a colorimetric culture method for Vibrio and further validated using tryptic soy broth (TSB) and tryptic soy agar (TSA) through secondary confirmation, incubated at 37 °C for 18–24 h, with no bacterial growth indicating complete bacterial death.
2.9. Application of PMA Duplex qPCR in Artificially Inoculated Samples
Fresh shrimp and oyster used for artificial inoculation [26,27] were purchased from a seafood market in Pudong New District, Shanghai, while the shrimp farming environment water was collected from Jixian Shrimp Farming in Fengxian District, Shanghai. A total of 27 groups of artificially inoculated seafood samples were selected, including 9 groups of water environment samples, 9 groups of shrimp, and 9 groups of oysters. These samples were placed in sterile homogenization bags, inoculated with varying proportions of viable and nonviable bacteria, and then thoroughly mixed. Next, we waited 30 min to allow the bacterial solution to evenly adhere to the surface of the sample. A concentration of 106 CFU/mL(g) of nonviable bacteria was added to assess the ability of the PMA duplex qPCR method to distinguish between viable and nonviable bacteria using traditional plate counting methods and standard qPCR methods as controls.
2.10. Application of PMA Duplex qPCR in Actual Aquatic Samples
Sampling was conducted at the Dongfang International Aquatic Center in Shanghai, where a total of 108 aquatic product samples were collected, including 48 shrimp samples, 23 shellfish samples, 18 freshwater fish samples, and 19 algae samples. The PMA duplex qPCR technology was employed for a comprehensive survey, validated using ISO standard methods (2007) [26].
2.11. Statistical Analysis
All the measurements in this study were conducted in triplicate. The values in this study were expressed as the mean ± standard deviation (SD). The data were analyzed with SPSS statistic 27 software (IBM Co., Chicago, IL, USA). The differences among the mean values were determined by one-way ANOVA. Differences were considered significant at p < 0.05. Diagrams were performed by GraphPad Prism 10 (GraphPad Software, San Diego, CA, USA).
3. Results and Discussion
3.1. Construction of Integrated PMA Pretreatment Instrument
The prototype of the integrated PMA pretreatment instrument constructed in this study is shown in Figure 2. Through practical application, this instrument can autonomously set the dark treatment time, light treatment time, and mixing speed according to the experimental requirements, making it applicable for various PMA pretreatment conditions. Actual measurements using a temperature detector indicated that the cavity temperature did not show significant changes during the continuous use of the instrument for 6 h (Figure 3). All the measurements were conducted in triplicate.
Traditional PMA pretreatment steps typically rely on high-wattage halogen lamps (600 W–1000 W) for photo-linking (Figure 4a). While this method of photo-linking is highly reliable, halogen lamps release a substantial amount of heat during irradiation [22]. This not only risks damaging the DNA of viable bacteria in the samples, leading to false-negative results, but excessive heat can also pose laboratory safety hazards. In contrast, LED blue light serves as an energy-efficient and environmentally friendly cold light source, maintaining low thermal output even during prolonged operation [28,29]. Furthermore, the wavelength of LED blue light, ranging from 410–420 nm, aligns with the excitation wavelength of PMA, allowing for effective crosslinking of PMA with nonviable bacterial DNA without damaging the DNA of viable bacteria [28,29].
Compared to the open LED blue light crosslinking instrument developed by Biotium Company (Figure 4b), the integrated PMA pretreatment instrument constructed in this study integrates the two core steps of dark treatment and photo-linking into one, achieving an integrated and fully automated PMA pretreatment process. This simplification at the source enhances the efficiency of PMA processing and provides reliable tool support for the quantification of viable bacteria.
3.2. Specificity Analysis of PMA Duplex qPCR
This study utilized 103 strains of different bacterial species (Table 2) to validate the specificity of the method, with results presented in Table 3: 62 strains of V. parahaemolyticus showed positive FAM fluorescence signals in qPCR detection, while 31 strains of V. cholerae exhibited positive Cy3 fluorescence signals, demonstrating that the constructed PMA duplex qPCR technology possesses high specificity. The remaining three strains of other Vibrio species and seven strains of non-Vibrio species yielded negative results in PMA-qPCR detection, indicating the method’s exceptional specificity. The detection rate was 100%.
3.3. Amplification Efficiency of PMA Duplex qPCR
Standard curves were constructed using actual samples to determine the amplification efficiency and quantification limits of the PMA duplex qPCR developed in this study, as shown in Figure 5. Over 40 cycles, none of the negative controls detected a fluorescence signal. In the shrimp farming environment water, shrimp (Litopenaeus vannamei), and oyster (Crassostrea gigas), the R2 values for the standard curve of V. parahaemolyticus were 0.988, 0.980, and 0.999, respectively, demonstrating a good linear relationship between colony counts and CT values, with slopes of −3.49, −3.16, and −3.47, and amplification efficiencies of 93.43%, 107.23%, and 94.17%. The R2 values for the standard curve of V. cholerae were 0.994, 0.985, and 0.975, with slopes of −3.49, −3.16, and −3.47, and amplification efficiencies of 90.94%, 94.92%, and 93.07%. The amplification efficiency remained between 90 and 110%, indicating that the PMA duplex qPCR exhibits good amplification efficiency. This study selected complex samples such as water from shrimp farming environments, shrimps, and oysters to construct the standard curve for the PMA duplex qPCR technology, demonstrating that the method maintains high amplification efficiency, showcasing its potential for application in real samples.
3.4. Minimum Quantification Limit of PMA Duplex qPCR
Based on the analysis of the minimum quantification limit from the standard curve, the PMA duplex qPCR technology developed in this study achieved a minimum quantification limit of 101–102 CFU/mL in the water of shrimp farming environments, and 102–103 CFU/g in shrimp and oyster. In comparison to traditional PMA pretreatment qPCR quantification techniques, such as the PMA-qPCR method developed by Liu et al. [30], which can detect viable Escherichia coli with a detection limit of 103 CFU/mL in pure culture and 105 CFU/g in beef, and the PMA-qPCR system for quantifying viable Photobacterium developed by Macé and Mamlouk [31], which has a detection limit of 103 CFU/g in fresh salmon, the aforementioned methods can only detect one type of bacteria. In contrast, the method designed in this study can simultaneously quantify the two most common and harmful pathogenic Vibrio in seafood, exhibiting high sensitivity.
3.5. Study on the Differentiation of Viable and Nonviable Bacteria in Artificially Inoculated Samples Using PMA Dual qPCR
In this study, 27 groups of samples were selected, including 9 groups of shrimp farming environment water samples, 9 groups of shrimps, and 9 groups of oysters, inoculated with varying ratios of viable and nonviable bacteria to evaluate the capability of the PMA dual qPCR method in distinguishing between viable and nonviable bacteria in aquatic products. As shown in Table 4, Table 5 and Table 6, in the presence of 106 CFU/mL(g) nonviable bacterial DNA, traditional qPCR technology struggled to differentiate between viable and nonviable bacteria in aquatic products and their associated shrimp farming environment water samples. The quantitative results were significantly higher than those obtained using the PMA dual qPCR technique, which was severely interfered with nonviable bacterial DNA, leading to erroneous estimations of pathogenic bacteria risk in aquatic products [10,11,14,15]. In contrast, the PMA dual qPCR technology developed in this study maintained extremely accurate quantitative results even in complex samples containing both viable and nonviable pathogenic Vibrio species: it was able to accurately quantify the viable cells of V. parahaemolyticus and V. cholerae in the presence of 106 CFU/mL(g) nonviable bacteria. This indicates that the method effectively avoids the amplification of nonviable bacterial DNA from V. parahaemolyticus and V. cholerae in artificially inoculated aquatic products, achieving the goal of quantifying viable bacteria. It is a potential quantitative assessment method for viable bacteria that can be used to accurately assess the true risk of pathogenic Vibrio in aquatic products.
Table 4.
The ability of PMA-qPCR to distinguish the nonviable and viable Vibrio cells in shrimp farming environment water.
Table 4.
The ability of PMA-qPCR to distinguish the nonviable and viable Vibrio cells in shrimp farming environment water.
| Number of Infections | PMA | qPCR Quantification Results |
|---|---|---|
| 106 VP nonviable + 104 VP viable | − | 5.96 ± 0.83 CFU/mL (VP) |
| + | 4.23 ± 0.25 CFU/mL (VP) * | |
| 106 VP nonviable + 103 VP viable | − | 6.13 ± 0.03 CFU/mL (VP) |
| + | 2.98 ± 0.15 CFU/mL (VP) * | |
| 106 VP nonviable + 102 VP viable | − | 6.47 ± 0.19 CFU/mL (VP) |
| + | 2.17 ± 0.37 CFU/mL (VC) * | |
| 106 VC nonviable + 104 VC viable | − | 6.28 ± 0.53 CFU/mL (VC) |
| + | 4.16 ± 0.61 CFU/mL (VC) * | |
| 106 VC nonviable + 103 VC viable | − | 5.79 ± 0.38 CFU/mL (VC) |
| + | 3.18 ± 0.95 CFU/mL (VC) * | |
| 106 VC nonviable + 102 VC viable | − | 6.12 ± 0.36 CFU/mL (VC) |
| + | 1.98 ± 0.62 CFU/mL (VC) * | |
| 106 VP nonviable + 104 VP viable + 106 VC nonviable + 104 VC viable | − | 6.35 ± 0.75 CFU/mL (VP) |
| 6.51 ± 0.31 CFU/mL (VC) | ||
| + | 3.61 ± 0.16 CFU/mL (VP) * | |
| 3.72 ± 0.86 CFU/mL (VC) * | ||
| 106 VP nonviable + 103 VP viable + 106 VC nonviable + 103 VC viable | − | 6.45 ± 0.88 CFU/mL (VP) |
| 5.88 ± 0.37 CFU/mL (VC) | ||
| + | 2.89 ± 0.63 CFU/mL (VP) * | |
| 3.38 ± 0.95 CFU/mL (VC) * | ||
| 106 VP nonviable + 102 VP viable + 106 VC nonviable + 102 VC viable | − | 5.81 ± 0.68 CFU/mL (VP) |
| 6.71 ± 0.27 CFU/mL (VC) | ||
| + | 2.28 ± 0.76 CFU/mL (VP) * | |
| 2.42 ± 0.69 CFU/mL (VC) * |
Note: VP: V. parahaemolyticus; VC: V. cholerae; *: p < 0.05.
Table 5.
The ability of PMA-qPCR to distinguish the nonviable and viable Vibrio cells in shrimps.
| Number of Infections | PMA | qPCR Quantification Results |
|---|---|---|
| 106 VP nonviable + 104 VP viable | − | 6.34 ± 0.45 CFU/g (VP) |
| + | 4.23 ± 0.36 CFU/g (VP) * | |
| 106 VP nonviable + 103 VP viable | − | 5.82 ± 0.61 CFU/g (VP) |
| + | 3.19 ± 0.44 CFU/g (VP) * | |
| 106 VP nonviable + 102 VP viable | − | 6.17 ± 0.59 CFU/g (VP) |
| + | 2.37 ± 0.37 CFU/g (VP) * | |
| 106 VC nonviable + 104 VC viable | − | 6.27 ± 0.23 CFU/g (VC) |
| + | 4.63 ± 0.34 CFU/g (VC) * | |
| 106 VC nonviable + 103 VC viable | − | 5.98 ± 0.68 CFU/g (VC) |
| + | 3.45 ± 0.46 CFU/g (VC) * | |
| 106 VC nonviable + 102 VC viable | − | 6.72 ± 0.13 CFU/g (VC) |
| + | 2.15 ± 0.81 CFU/g (VC) * | |
| 106 VP nonviable + 104 VP viable + 106 VC nonviable + 104 VC viable | − | 6.43 ± 0.83 CFU/g (VP) |
| 6.15 ± 0.38 CFU/g (VC) | ||
| + | 3.89 ± 0.22 CFU/g (VP) * | |
| 4.28 ± 0.19 CFU/g (VC) * | ||
| 106 VP nonviable + 103 VP viable + 106 VC nonviable + 103 VC viable | − | 6.18 ± 0.76 CFU/g (VP) |
| 5.82 ± 0.51 CFU/g (VC) | ||
| + | 3.49 ± 0.29 CFU/g (VP) * | |
| 3.38 ± 0.41 CFU/g (VC) * | ||
| 106 VP nonviable + 102 VP viable + 106 VC nonviable + 102 VC viable | − | 6.61 ± 0.17 CFU/g (VP) |
| 6.45 ± 0.32 CFU/g (VC) | ||
| + | 2.52 ± 0.75 CFU/g (VP) * | |
| 2.44 ± 0.64 CFU/g (VC) * |
Note: VP: V. parahaemolyticus; VC: V. cholerae; *: p < 0.05.
Table 6.
The ability of PMA-qPCR to distinguish the nonviable and viable Vibrio cells in oysters.
| Number of Infections | PMA | qPCR Quantification Results |
|---|---|---|
| 106 VP nonviable + 104 VP viable | − | 5.84 ± 0.68 CFU/g (VP) |
| + | 3.89 ± 0.47 CFU/g (VP) * | |
| 106 VP nonviable + 103 VP viable | − | 6.13 ± 0.03 CFU/g (VP) |
| + | 2.98 ± 0.15 CFU/g (VP) * | |
| 106 VP nonviable + 102 VP viable | − | 6.34 ± 0.23 CFU/g (VP) |
| + | 2.08 ± 0.38 CFU/g (VP) * | |
| 106 VC nonviable + 104 VC viable | − | 6.25 ± 0.49 CFU/g (VC) |
| + | 4.27 ± 0.89 CFU/g (VC) * | |
| 106 VC nonviable + 103 VC viable | − | 5.79 ± 0.38 CFU/g (VC) |
| + | 3.18 ± 0.95 CFU/g (VC) * | |
| 106 VC nonviable + 102 VC viable | − | 6.16 ± 0.83 CFU/g (VC) |
| + | 2.27 ± 0.05 CFU/g (VC) * | |
| 106 VP nonviable + 104 VP viable + 106 VC nonviable + 104 VC viable | − | 6.48 ± 0.66 CFU/g (VP) |
| 6.19 ± 0.24 CFU/g (VC) | ||
| + | 3.51 ± 0.67 CFU/g (VP) * | |
| 3.83 ± 0.46 CFU/g (VC) * | ||
| 106 VP nonviable + 103 VP viable + 106 VC nonviable + 103 VC viable | − | 6.45 ± 0.88 CFU/g (VP) |
| 5.88 ± 0.37 CFU/g (VC) | ||
| + | 2.79 ± 0.23 CFU/g (VP) * | |
| 3.58 ± 0.95 CFU/g (VC) * | ||
| 106 VP nonviable + 102 VP viable + 106 VC nonviable + 102 VC viable | − | 5.86 ± 0.42 CFU/g (VP) |
| 6.34 ± 0.28 CFU/g (VC) | ||
| + | 2.36 ± 0.19 CFU/g (VP) * | |
| 2.27 ± 0.83 CFU/g (VC) * |
Note: VP: V. parahaemolyticus; VC: V. cholerae; *: p < 0.05.
3.6. Application of PMA Dual qPCR in Actual Aquatic Samples
The application of the PMA dual qPCR developed in this study was conducted in August 2017 during a sampling survey at the Shanghai Oriental International Aquatic Center. A total of 108 aquatic product samples were collected, including 48 shrimp samples, 23 shellfish samples, 18 fish samples, and 19 algae samples. The PMA dual qPCR technique was employed to survey the actual aquatic samples, with results presented in Table 7: 96 out of 108 samples tested positive for V. parahaemolyticus, and 24 samples tested positive for V. cholerae. The detection rate of V. parahaemolyticus was 100% in shrimp, shellfish, and fish, while it was 36.84% in algae. The detection rates of V. parahaemolyticus in shrimp, shellfish, fish, and algae were 14.58%, 56.52%, 16.67%, and 14.29%, respectively. The detection results of the ISO (2007) standard method were highly consistent with the PCR detection results (Table 7). The detection rate was 100%, further demonstrating the high precision of this method.
Although traditional methods (ISO standard methods) are considered the gold standard for detecting pathogenic Vibrio in aquatic products, they require multiple complex steps, including enrichment, selective isolation, and physiological-biochemical identification, taking up to one week to complete the entire detection process [32]. In contrast, the PMA dual qPCR technology developed in this study not only features rapid, accurate, and efficient characteristics, with the entire process from the selection of viable bacterial DNA from samples to the final PCR result output taking less than three hours (30 min of manual inoculation, 30 min of dark treatment, 30 min of light treatment, and 1 h of qPCR process), but it also selectively detects viable pathogenic Vibrio cells in aquatic samples, providing new technical support for the identification of V. parahaemolyticus hazards. In terms of monetary costs, the PMA-qPCR method has an approximate detection cost of USD 15 per sample, which is higher than the USD 5 cost per sample associated with traditional methods. Regarding labor costs, traditional culture identification methods are extremely labor-intensive, requiring specialized personnel to observe colonies for extended periods and conduct physiological and biochemical identifications, which can lead to human error. In contrast, PMA-qPCR is simple and convenient to operate, with a high degree of automation that reduces the technical requirements for personnel, thereby decreasing labor input and the risk of errors.
Table 7.
The application of PMA-qPCR in practical seafood samples.
| Sample Type | Number of Samples | Number of VP Positive Samples | Number of VC Positive Samples | ||
|---|---|---|---|---|---|
| PMA-qPCR | ISO | PMA-qPCR | ISO | ||
| Shrimp | 48 | 48 | 48 | 7 | 7 |
| Shellfish | 23 | 23 | 23 | 13 | 13 |
| Fish | 18 | 18 | 18 | 3 | 3 |
| Algae | 19 | 7 | 7 | 1 | 1 |
| Total | 108 | 96 | 96 | 24 | 24 |
Note: VP: V. parahaemolyticus; VC: V. cholerae.
4. Conclusions
This study developed a novel integrated PMA pretreatment instrument, integrating the two core steps of dark treatment and light crosslinking into a single process. This innovation achieves the integration and full automation of the PMA pretreatment process, thereby simplifying the handling of PMA at its source and enhancing its processing efficiency. Based on this rapid screening instrument for viable bacterial DNA, we established a quantitative detection technique for viable V. parahaemolyticus and V. cholerae in aquatic products and their associated farming environments, leveraging the advantages of multiplex qPCR. This technique demonstrates excellent amplification efficiency, low detection limits, and a strong capability to differentiate between viable and nonviable bacteria. This research provides a novel technology for accurately identifying the real hazards posed by pathogenic Vibrio, offering a powerful tool for the risk monitoring and assessment of pathogenic Vibrio in aquatic products.
Author Contributions
Y.Q.: conceptualization, data curation, formal analysis, methodology, investigation, writing—original draft, visualization. R.X.: conceptualization, data curation, formal analysis, methodology, investigation, writing—original draft, visualization. Y.Z.: methodology, supervision, writing—review and editing. Z.Z.: conceptualization, methodology, resources, validation, supervision, writing—review and editing. Y.Y.: conceptualization, methodology, resources, validation, supervision, writing—review and editing. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by Shanghai Agricultural Science and Technology Innovation Program (T2024326), National Natural Science Foundation of China (32372292) and Project of Shanghai Chongming District Science and Technology Commission (YSZJGZZ2023-01).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding authors.
Acknowledgments
This work was supported by the International Research Center for Food and Health of Shanghai Ocean University.
Conflicts of Interest
Author Yachang Yin was employed by the company Shanghai Hi-chain Food Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Abbreviations
The following abbreviations are used in this manuscript:
| PMA | Propidium monoazide |
| APW | Alkaline peptone water |
| LOD | limit of detection |
| TSB | Tryptic soy broth |
| TSA | Tryptic soy agar |
| ELISA | Enzyme-linked immunosorbent assay |
| TDH | Thermostable direct hemolysin |
| TRH | TDH-related hemolysin |
References
- Su, Y.C.; Liu, C. Vibrio parahaemolyticus: A concern of seafood safety. Food Microbiol. 2007, 24, 549–558. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Urtaza, J.; Baker-Austin, C. Vibrio parahaemolyticus. Trends Microbiol. 2020, 28, 867–868. [Google Scholar] [CrossRef]
- Liston, J. Microbial hazards of seafood consumption. Food Technol. 1990, 44, 58–62. [Google Scholar]
- Centers for Disease Control and Prevention (CDC). Vibrio illnesses after Hurricane Katrina—Multiple states, August–September 2005. MMWR Morb. Mortal. Wkly. Rep. 2005, 54, 928–931. [Google Scholar]
- Dziejman, M.; Balon, E.; Boyd, D.; Fraser, C.M.; Heidelberg, J.F.; Mekalanos, J.J. Comparative genomic analysis of Vibrio cholerae: Genes that correlate with cholera endemic and pandemic disease. Proc. Natl. Acad. Sci. USA 2002, 99, 1556–1561. [Google Scholar] [CrossRef]
- Ramamurthy, T.; Mutreja, A.; Weill, F.-X.; Das, B.; Ghosh, A.; Nair, G.B. Revisiting the Global Epidemiology of Cholera in Conjunction with the Genomics of Vibrio cholerae. Front. Public Health 2019, 7, 203. [Google Scholar]
- Rabbani, G.H.; Greenough, W.B., 3rd. Food as a vehicle of transmission of cholera. J. Diarrhoeal Dis. Res. 1999, 17, 1–9. [Google Scholar] [PubMed]
- Kim, H.-J.; Lee, H.-J.; Lee, K.-H.; Cho, J.-C. Simultaneous detection of Pathogenic Vibrio species using multiplex real-time PCR. Food Control 2012, 23, 491–498. [Google Scholar] [CrossRef]
- Garrido, A.; Chapela, M.-J.; Román, B.; Fajardo, P.; Lago, J.; Vieites, J.M.; Cabado, A.G. A new multiplex real-time PCR developed method for Salmonella spp. and Listeria monocytogenes detection in food and environmental samples. Food Control 2013, 30, 76–85. [Google Scholar] [CrossRef]
- Guan, H.; Xue, P.; Zhou, H.; Sha, D.; Wang, D.; Gao, H.; Li, J.; Diao, B.; Zhao, H.; Kan, B.; et al. A multiplex PCR assay for the detection of five human pathogenic Vibrio species and Plesiomonas. Mol. Cell. Probes 2021, 55, 101689. [Google Scholar] [CrossRef]
- Kumar, B.K.; Raghunath, P.; Devegowda, D.; Deekshit, V.K.; Venugopal, M.N.; Karunasagar, I.; Karunasagar, I. Development of monoclonal antibody based sandwich ELISA for the rapid detection of pathogenic Vibrio parahaemolyticus in seafood. Int. J. Food Microbiol. 2011, 145, 244–249. [Google Scholar] [CrossRef] [PubMed]
- Zeng, D.; Chen, S.; Jiang, L.; Ren, J.; Ling, N.; Su, J.; Zhao, Y.; Jiang, Y.; Xue, F.; Tang, F.; et al. A polymerase chain reaction based lateral flow test strip with propidium monoazide for detection of viable Vibrio parahaemolyticus in codfish. Microchem. J. 2020, 159, 105418. [Google Scholar] [CrossRef]
- Zhao, L.; Lv, X.; Cao, X.; Zhang, J.; Gu, X.; Zeng, H.; Wang, L. Improved quantitative detection of VBNC Vibrio parahaemolyticus using immunomagnetic separation and PMAxx-qPCR. Food Control 2020, 110, 106962. [Google Scholar] [CrossRef]
- Zi, C.; Zeng, D.; Ling, N.; Dai, J.; Xue, F.; Jiang, Y.; Li, B. An improved assay for rapid detection of viable Staphylococcus aureus cells by incorporating surfactant and PMA treatments in qPCR. BMC Microbiol. 2018, 18, 132. [Google Scholar] [CrossRef]
- Campbell, G.R.; Prosser, J.; Glover, A.; Killham, K. Detection of Escherichia coli O157:H7 in soil and water using multiplex PCR. J. Appl. Microbiol. 2001, 91, 1004–1010. [Google Scholar] [CrossRef] [PubMed]
- Nocker, A.; Camper, A.K. Selective removal of DNA from dead cells of mixed bacterial communities by use of ethidium monoazide. Appl. Environ. Microbiol. 2006, 72, 1997–2004. [Google Scholar] [CrossRef] [PubMed]
- Soejima, T.; Iida, K.; Qin, T.; Taniai, H.; Seki, M.; Yoshida, S. Method To Detect Only Live Bacteria during PCR Amplification. J. Clin. Microbiol. 2008, 46, 2305–2313. [Google Scholar] [CrossRef]
- Ling, N.; Shen, J.; Guo, J.; Zeng, D.; Ren, J.; Sun, L.; Jiang, Y.; Xue, F.; Dai, J.; Li, B. Rapid and accurate detection of viable Vibrio parahaemolyticus by sodium deoxycholate-propidium monoazide-qPCR in shrimp. Food Control 2020, 109, 106883. [Google Scholar] [CrossRef]
- Cao, X.; Zhao, L.; Zhang, J.; Chen, X.; Shi, L.; Fang, X.; Xie, H.; Chang, Y.; Wang, L. Detection of viable but nonculturable Vibrio parahaemolyticus in shrimp samples using improved real-time PCR and real-time LAMP methods. Food Control 2019, 103, 145–152. [Google Scholar] [CrossRef]
- Nocker, A.; Camper, A.K. Novel approaches toward preferential detection of viable cells using nucleic acid amplification techniques. FEMS Microbiol. Lett. 2009, 291, 137–142. [Google Scholar] [CrossRef]
- Liu, Y.; Zhong, Q.; Wang, J.; Lei, S. Enumeration of Vibrio parahaemolyticus in VBNC state by PMA-combined real-time quantitative PCR coupled with confirmation of respiratory activity. Food Control 2018, 91, 85–91. [Google Scholar] [CrossRef]
- Cawthorn, D.-M.; Witthuhn, R.C. Selective PCR detection of viable Enterobacter sakazakii cells utilizing propidium monoazide or ethidium bromide monoazide. J. Appl. Microbiol. 2008, 105, 1178–1185. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Liu, H.; Zhang, Z.; Xiao, L.; Sun, X.; Xie, J.; Pan, Y.; Zhao, Y. Reducing bias in complex microbial community analysis in shrimp based on propidium monoazide combined with PCR-DGGE. Food Control 2016, 68, 139–144. [Google Scholar] [CrossRef]
- Wu, Q.; Liu, J.; Malakar, P.K.; Pan, Y.; Zhao, Y.; Zhang, Z. Modeling naturally-occurring Vibrio parahaemolyticus in post-harvest raw shrimps. Food Res. Int. 2023, 173, 113462. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Liu, H.; Lou, Y.; Xiao, L.; Liao, C.; Malakar, P.K.; Pan, Y.; Zhao, Y. Quantifying viable Vibrio parahaemolyticus and Listeria monocytogenes simultaneously in raw shrimp. Appl. Microbiol. Biotechnol. 2015, 99, 6451–6462. [Google Scholar] [CrossRef]
- ISO 6579; In Microbiology of Food and Animal Feeding Stuffs-Horizontal Method for the Detection of Salmonella spp. ISO: Geneva, Switzerland, 2002.
- ISO 21872-1:2017; In MMicrobiology of the Food Chain—Horizontal Method for the Determination of Vibrio spp. Part 1: Detection of Potentially Enteropathogenic Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. ISO: Geneva, Switzerland, 2007.
- Kong, Y.; Zheng, Y. Diverse Flowering Response to Blue Light Manipulation: Application of Electric Lighting in Controlled-Environment Plant Production. Horticulturae 2024, 10, 578. [Google Scholar] [CrossRef]
- Schneider, L.F.; Consani, S.; Correr-Sobrinho, L.; Correr, A.B.; Sinhoreti, M.A. Halogen and LED light curing of composite: Temperature increase and Knoop hardness. Clin. Oral. Investig. 2006, 10, 66–71. [Google Scholar] [CrossRef]
- Liu, Y.; Mustapha, A. Detection of viable Escherichia coli O157:H7 in ground beef by propidium monoazide real-time PCR. Int. J. Food Microbiol. 2014, 170, 48–54. [Google Scholar] [CrossRef]
- Macé, S.; Mamlouk, K.; Chipchakova, S.; Prévost, H.; Joffraud, J.J.; Dalgaard, P.; Pilet, M.F.; Dousset, X. Development of a rapid real-time PCR method as a tool to quantify viable Photobacterium phosphoreum bacteria in salmon (Salmo salar) steaks. Appl. Environ. Microbiol. 2013, 79, 2612–2619. [Google Scholar] [CrossRef]
- Microbiology of Food and Animal Feeding Stuffs. Horizontal method for the detection of potentially enteropathogenic Vibrio spp. Pt. 1: Detection of Vibrio parahaemolyticus and Vibrio cholerae—Pt. 2: Detection of species other than Vibrio parahaemolyticus and Vibrio cholerae; ISO Technical Specification: Geneva, Switzerland, 2007. [Google Scholar]
Figure 1.
The design drawing of integrated PMA pretreatment instrument.
Figure 2.
The model machine of integrated PMA pretreatment instrument.
Figure 3.
The temperature of integrated PMA pretreatment instrument as a function of time.
Figure 4.
Conventional PMA treatment. (a) Halogen lamp; (b) Commercial PMA treatment device.
Figure 5.
The standard curve of PMA-qPCR.
Table 1.
The primers and probes of PMA-qPCR.
| Bacterium | Primers and Probes | Fluorophores | Quencher | Target Gene |
|---|---|---|---|---|
| VP | Forward primers: ACTCAACACAAGAAGAGATCGACAA | FAM | BHQ1 | tlh (208 bp) |
| Reverse primer: GATGAGCGGTTGATGTCCAA | ||||
| Probes: FAM-CGCTCGCGTTCACGAAACCGT-BHQ1 | ||||
| VC | Forward primers: CCGTTGAGGCGAGTTTGGTGAGA | Cy3 | BHQ1 | lolB (137 bp) |
| Reverse primer: GTGCGCGGGTCGAAACTTATGAT | ||||
| Probes: Cy3-ATGGGTTGCTTGGGTCGGCAAGCCT-BHQ1 |
Note: VP: V. parahaemolyticus; VC: V. cholerae.
Table 2.
The bacterial strains used for specificity analysis.
| Strain Species | Strain No. | Number of Strains |
|---|---|---|
| Vibrio spp. | ||
| V. parahaemolyticus | ATCC 33847 | 1 |
| ATCC 17802 | 1 | |
| VPD1-VPD20 (from seafood samples) | 20 | |
| VPC1-VPC40 (from clinical samples) | 40 | |
| V. cholerae | GIM1.449 | 1 |
| VCW1-VCW30 (from clinical samples) | 30 | |
| V. anguillarum | CICC 10475 | 1 |
| V. fluvialis | CGMCC 1.1611 | 1 |
| V. vulnificus | MCCC 1H0006 | 1 |
| Other spp. | ||
| Listeria monocytogenes | ATCC 19112 | 1 |
| Listeria innocua | ATCC 33090 | 1 |
| Listeria welshimeri | ATCC 43548 | 1 |
| Salmonella Enteritidis | CMCC 50041 | 1 |
| Salmonella Typhimurium | CICC 21484 | 1 |
| Escherichia coli O157:H7 | ATCC 43889 | 1 |
| Staphylococcus aureus | CCTCC AB 91093 | 1 |
Table 3.
Results of PMA duplex qPCR specificity
| Strain Species | Number of Strains | FAM (tlh) | Cy3 (lolB) |
|---|---|---|---|
| V. parahaemolyticus | 62 | + | − |
| V. cholerae | 31 | − | + |
| Other Vibrio | 3 | − | − |
| Other genera | 7 | − | − |
Note: +: Positive; −: Negative
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Qin, Y.; Xiong, R.; Zhao, Y.; Zhang, Z.; Yin, Y. An Integrated PMA Pretreatment Instrument for Simultaneous Quantitative Detection of Vibrio parahaemolyticus and Vibrio cholerae in Aquatic Products. Foods 2025, 14, 2166. https://doi.org/10.3390/foods14132166
AMA Style
Qin Y, Xiong R, Zhao Y, Zhang Z, Yin Y. An Integrated PMA Pretreatment Instrument for Simultaneous Quantitative Detection of Vibrio parahaemolyticus and Vibrio cholerae in Aquatic Products. Foods. 2025; 14(13):2166. https://doi.org/10.3390/foods14132166
Chicago/Turabian StyleQin, Yulong, Rongrong Xiong, Yong Zhao, Zhaohuan Zhang, and Yachang Yin. 2025. "An Integrated PMA Pretreatment Instrument for Simultaneous Quantitative Detection of Vibrio parahaemolyticus and Vibrio cholerae in Aquatic Products" Foods 14, no. 13: 2166. https://doi.org/10.3390/foods14132166
APA StyleQin, Y., Xiong, R., Zhao, Y., Zhang, Z., & Yin, Y. (2025). An Integrated PMA Pretreatment Instrument for Simultaneous Quantitative Detection of Vibrio parahaemolyticus and Vibrio cholerae in Aquatic Products. Foods, 14(13), 2166. https://doi.org/10.3390/foods14132166
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
