Amelioration Effect of Lactobacillus kefiranofaciens ZW3 on Ovalbumin-Induced Allergic Symptoms in BALB/c Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteria Preparation
2.2. Animals
2.3. Sensitization with Ovalbumin
2.4. Bacterial Treatment
2.5. Allergy Score, Body Mass, and Spleen and Thymus Indexes
2.6. Total IgE and OVA-Specific IgE in Serum
2.7. Real-Time PCR Assay
2.8. Microbial Profile Analyzed Using 16S rRNA Sequencing
2.9. Statistical Analysis
3. Results
3.1. Increased IgE in OVA-Sensitized Mice, and ZW3-Mediated Suppression of Serum OVA-sIgE
3.2. The Allergy Symptoms, Body Mass, and Spleen and Thymus Indexes in OVA-Sensitized Mice Orally Administered ZW3
3.3. Oral ZW3 Maintains Th1/Th2 Balance in Allergic Mice
3.4. Effect of Orally Administered ZW3 on Intestinal Flora in OVA-Sensitized Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- San Miguel-Rodríguez, A.; Armentia, A.; Martín-Armentia, S.; Martín-Armentia, B.; Corell, A.; Lozano-Estevan, M.C.; Peinado, I.I. Component-resolved diagnosis in allergic disease: Utility and limitations. Clin. Chim. Acta 2019, 489, 219–224. [Google Scholar] [CrossRef] [PubMed]
- Bel Imam, M.; Stikas, C.V.; Guha, P.; Chawes, B.L.; Chu, D.; Greenhawt, M.; Khaleva, E.; Munblit, D.; Nekliudov, N.; van de Veen, W.; et al. Outcomes reported in randomized controlled trials for mixed and non-IgE-mediated food allergy: Systematic review. Clin. Exp. Allergy 2023, 53, 526–535. [Google Scholar] [CrossRef]
- Lozano-Ojalvo, D.; Berin, C.; Tordesillas, L. Immune Basis of Allergic Reactions to Food. J. Investig. Allergol. Clin. Immunol. 2019, 29, 1–14. [Google Scholar] [CrossRef]
- Berin, M.C. Pathogenesis of IgE-mediated food allergy. Clin. Exp. Allergy 2015, 45, 1483–1496. [Google Scholar] [CrossRef] [PubMed]
- Chinthrajah, R.S.; Hernandez, J.D.; Boyd, S.D.; Galli, S.J.; Nadeau, K.C. Molecular and cellular mechanisms of food allergy and food tolerance. J. Allergy Clin. Immunol. 2016, 137, 984–997. [Google Scholar] [CrossRef] [PubMed]
- Parrish, C.P.; Har, D.; Bird, J.A. Current Status of Potential Therapies for IgE-Mediated Food Allergy. Curr. Allergy Asthma Rep. 2018, 18, 18. [Google Scholar] [CrossRef]
- Robinson, M.L.; Lanser, B.J. The Role of Baked Egg and Milk in the Diets of Allergic Children. Immunol. Allergy Clin. N. Am. 2018, 38, 65. [Google Scholar] [CrossRef] [PubMed]
- Hayen, S.M.; Kostadinova, A.I.; Garssen, J.; Otten, H.G.; Willemsen, L.E.M. Novel immunotherapy approaches to food allergy. Curr. Opin. Allergy Clin. Immunol. 2014, 14, 549–556. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Kuang, H.; Li, N.; Hamdy, A.M.; Song, J.J. The modulation and mechanism of probiotic-derived polysaccharide capsules on the immune response in allergic diseases. Crit. Rev. Food Sci. Nutr. 2023, 63, 8768–8780. [Google Scholar] [CrossRef]
- Jensen, C.; Antonsen, M.F.; Lied, G.A. Gut Microbiota and Fecal Microbiota Transplantation in Patients with Food Allergies: A Systematic Review. Microorganisms 2022, 10, 1904. [Google Scholar] [CrossRef]
- Zhao, W.; Ho, H.E.; Bunyavanich, S. The gut microbiome in food allergy. Ann. Allergy Asthma Immunol. 2019, 122, 276–282. [Google Scholar] [CrossRef]
- Fazlollahi, M.; Chun, Y.; Grishin, A.; Wood, R.A.; Burks, A.W.; Dawson, P.; Jones, S.M.; Leung, D.Y.M.; Sampson, H.A.; Sicherer, S.H.; et al. Early-life gut microbiome and egg allergy. Allergy 2018, 73, 1515–1524. [Google Scholar] [CrossRef] [PubMed]
- Moriki, D.; León, E.D.; García-Gamero, G.; Jiménez-Hernández, N.; Artacho, A.; Pons, X.; Koumpagioti, D.; Dinopoulos, A.; Papaevangelou, V.; Priftis, K.N.; et al. Specific Gut Microbiome Signatures in Children with Cow’s Milk Allergy. Nutrients 2024, 16, 2752. [Google Scholar] [CrossRef]
- Noval Rivas, M.; Burton, O.T.; Wise, P.; Zhang, Y.Q.; Hobson, S.A.; Lloret, M.G.; Chehoud, C.; Kuczynski, J.; DeSantis, T.; Warrington, J.; et al. A microbiota signature associated with experimental food allergy promotes allergic sensitization and anaphylaxis. J. Allergy Clin. Immunol. 2013, 131, 201–212. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.L.; Wang, X.Z.; Zhang, J.; Li, Q.H.; Zhang, P.P.; Wu, C.; Jia, Y.Y.; Su, H.; Sun, X. Fecal microbiota transplantation alleviates food allergy in neonatal mice via the PD-1/PD-L1 pathway and change of the microbiota composition. World Allergy Organ. J. 2024, 17, 100969. [Google Scholar] [CrossRef] [PubMed]
- Cho, I.; Blaser, M.J. The human microbiome: At the interface of health and disease. Nat. Rev. Genet. 2012, 13, 260–270. [Google Scholar] [CrossRef]
- Bozzi Cionci, N.; Baffoni, L.; Gaggìa, F.; Di Gioia, D. Therapeutic Microbiology: The Role of Bifidobacterium breve as Food Supplement for the Prevention/Treatment of Paediatric Diseases. Nutrients 2018, 10, 1723. [Google Scholar] [CrossRef] [PubMed]
- Cosenza, L.; Nocerino, R.; Di Scala, C.; di Costanzo, M.; Amoroso, A.; Leone, L.; Paparo, L.; Pezzella, C.; Aitoro, R.; Berni Canani, R. Bugs for atopy: The Lactobacillus rhamnosus GG strategy for food allergy prevention and treatment in children. Benef. Microbes 2015, 6, 225–232. [Google Scholar] [CrossRef] [PubMed]
- Berni Canani, R.; Di Costanzo, M.; Bedogni, G.; Amoroso, A.; Cosenza, L.; Di Scala, C.; Granata, V.; Nocerino, R. Extensively hydrolyzed casein formula containing Lactobacillus rhamnosus GG reduces the occurrence of other allergic manifestations in children with cow’s milk allergy: 3-year randomized controlled trial. J. Allergy Clin. Immunol. 2017, 139, 1906–1913. [Google Scholar] [CrossRef] [PubMed]
- Feehley, T.; Stefka, A.T.; Cao, S.; Nagler, C.R. Microbial regulation of allergic responses to food. Semin. Immunopathol. 2012, 34, 671–688. [Google Scholar] [CrossRef] [PubMed]
- Salminen, S.; Isolauri, E.; Salminen, E. Clinical uses of probiotics for stabilizing the gut mucosal barrier: Successful strains and future challenges. Antonie Van Leeuwenhoek 1996, 70, 347–358. [Google Scholar] [CrossRef]
- Huang, C.H.; Shen, C.C.; Liang, Y.C.; Jan, T.R. The probiotic activity of Lactobacillus murinus against food allergy. J. Funct. Foods 2016, 25, 231–241. [Google Scholar] [CrossRef]
- Hong, W.S.; Chen, Y.P.; Chen, M.J. The antiallergic effect of kefir Lactobacilli. J. Food Sci. 2010, 75, H244–H253. [Google Scholar] [CrossRef]
- Xing, Z.Q.; Tang, W.; Yang, Y.; Geng, W.T.; Rehman, R.U.; Wang, Y.P. Colonization and Gut Flora Modulation of Lactobacillus kefiranofaciens ZW3 in the Intestinal Tract of Mice. Probiotics Antimicrob. Proteins 2018, 10, 374–382. [Google Scholar] [CrossRef] [PubMed]
- Xing, Z.; Geng, W.; Li, C.; Sun, Y.; Wang, Y. Comparative genomics of Lactobacillus kefiranofaciens ZW3 and related members of Lactobacillus spp. reveal adaptations to dairy and gut environments. Sci. Rep. 2017, 7, 12827. [Google Scholar] [CrossRef]
- Lin, Y.C.; Chen, Y.T.; Hsieh, H.H.; Chen, M.J. Effect of Lactobacillus mali APS1 and L. kefiranofaciens M1 on obesity and glucose homeostasis in diet-induced obese mice. J. Funct. Foods 2016, 23, 580–589. [Google Scholar] [CrossRef]
- Chen, Y.P.; Hsiao, P.J.; Hong, W.S.; Dai, T.Y.; Chen, M.J. Lactobacillus kefiranofaciens M1 isolated from milk kefir grains ameliorates experimental colitis in vitro and in vivo. J. Dairy Sci. 2012, 95, 63–74. [Google Scholar] [CrossRef]
- Sun, Y.; Geng, W.T.; Pan, Y.J.; Wang, J.J.; Xiao, P.; Wang, Y.P. Supplementation with Lactobacillus kefiranofaciens ZW3 from Tibetan Kefir improves depression- like behavior in stressed mice by modulating the gut microbiota. Food Funct. 2019, 10, 925–937. [Google Scholar] [CrossRef]
- Geng, W.T.; Zhang, Y.; Yang, J.N.; Zhang, J.; Zhao, J.Q.; Wang, J.J.; Jia, L.G.; Wang, Y.P. Identification of a novel probiotic and its protective effects on NAFLD via modulating gut microbial community. J. Sci. Food Agric. 2022, 102, 4620–4628. [Google Scholar] [CrossRef]
- Orgel, K.; Smeekens, J.M.; Ye, P.; Fotsch, L.; Guo, R.S.; Miller, D.R.; de Villena, F.P.M.; Burks, A.W.; Ferris, M.T.; Kulis, M.D. Genetic diversity between mouse strains allows identification of the CC027/GeniUnc strain as an orally reactive model of peanut allergy. J. Allergy Clin. Immunol. 2019, 143, 1027. [Google Scholar] [CrossRef]
- Guo, Z.H.; Wang, Q.; Zhao, J.H.; Xu, Y.P.; Mu, G.Q.; Zhu, X.M. Lactic acid bacteria with probiotic characteristics in fermented dairy products reduce cow milk allergy. Food Biosci. 2023, 55, 103055. [Google Scholar] [CrossRef]
- Nawaz, M.; Ma, C.; Basra, M.A.; Wang, J.; Xu, J. Amelioration of ovalbumin induced allergic symptoms in Balb/c mice by potentially probiotic strains of lactobacilli. Benef. Microbes 2015, 6, 669–678. [Google Scholar] [CrossRef] [PubMed]
- Aitoro, R.; Simeoli, R.; Amoroso, A.; Paparo, L.; Nocerino, R.; Pirozzi, C.; di Costanzo, M.; Meli, R.; De Caro, C.; Picariello, G.; et al. Extensively hydrolyzed casein formula alone or with L. rhamnosus GG reduces β-lactoglobulin sensitization in mice. Pediatr. Allergy Immunol. 2017, 28, 230–237. [Google Scholar] [CrossRef]
- Cross, M.L.; Gill, H.S. Can immunoregulatory lactic acid bacteria be used as dietary supplements to limit allergies? Int. Arch. Allergy Immunol. 2001, 125, 112–119. [Google Scholar] [CrossRef] [PubMed]
- Shao, H.M.; Min, F.F.; Huang, M.J.; Wang, Z.L.; Bai, T.L.; Lin, M.; Li, X.; Chen, H.B. Novel perspective on the regulation of food allergy by probiotic: The potential of its structural components. Crit. Rev. Food Sci. Nutr. 2024, 64, 172–186. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Ma, J.Y.; Li, Q.H.; Su, H.; Sun, X. Exploration of the effect of mixed probiotics on microbiota of allergic asthma mice. Cell. Immunol. 2021, 367, 104399. [Google Scholar] [CrossRef] [PubMed]
- Vacca, M.; Celano, G.; Calabrese, F.M.; Portincasa, P.; Gobbetti, M.; De Angelis, M. The Controversial Role of Human Gut Lachnospiraceae. Microorganisms 2020, 8, 573. [Google Scholar] [CrossRef]
- Zhang, M.; Cui, Y.; Liu, P.; Mo, R.; Wang, H.; Li, Y.; Wu, Y. Oat beta-(1→3, 1→4)-d-glucan alleviates food allergy-induced colonic injury in mice by increasing Lachnospiraceae abundance and butyrate production. Carbohydr. Polym. 2024, 344, 122535. [Google Scholar] [CrossRef]
- Luu, M.; Monning, H.; Visekruna, A. Exploring the Molecular Mechanisms Underlying the Protective Effects of Microbial SCFAs on Intestinal Tolerance and Food Allergy. Front. Immunol. 2020, 11, 1225. [Google Scholar] [CrossRef] [PubMed]
- Canani, R.B.; Sangwan, N.; Stefka, A.T.; Nocerino, R.; Paparo, L.; Aitoro, R.; Calignano, A.; Khan, A.A.; Gilbert, J.A.; Nagler, C.R. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants. ISME J. 2016, 10, 742–750. [Google Scholar] [CrossRef]
- Gu, S.M.; Xie, Q.; Chen, C.; Liu, C.L.; Xue, W.T. Gut Microbial Signatures Associated with Peanut Allergy in a BALB/c Mouse Model. Foods 2022, 11, 1395. [Google Scholar] [CrossRef] [PubMed]
- Burks, A.W.; Tang, M.; Sicherer, S.; Muraro, A.; Eigenmann, P.A.; Ebisawa, M.; Fiocchi, A.; Chiang, W.; Beyer, K.; Wood, R.; et al. ICON: Food allergy. J. Allergy Clin. Immunol. 2012, 129, 906–920. [Google Scholar] [CrossRef] [PubMed]
- Sampath, V.; Nadeau, K.C. Newly identified T cell subsets in mechanistic studies of food immunotherapy. J. Clin. Investig. 2019, 129, 1431–1440. [Google Scholar] [CrossRef]
- Hougee, S.; Vriesema, A.J.; Wijering, S.C.; Knippels, L.M.; Folkerts, G.; Nijkamp, F.P.; Knol, J.; Garssen, J. Oral treatment with probiotics reduces allergic symptoms in ovalbumin-sensitized mice: A bacterial strain comparative study. Int. Arch. Allergy Immunol. 2010, 151, 107–117. [Google Scholar] [CrossRef]
- Li, L.Z.; Fang, Z.F.; Liu, X.Y.; Hu, W.B.; Lu, W.W.; Lee, Y.K.; Zhao, J.X.; Zhang, H.; Chen, W. Lactobacillus reuteri attenuated allergic inflammation induced by HDM in the mouse and modulated gut microbes. PLoS ONE 2020, 15, e0231865. [Google Scholar] [CrossRef] [PubMed]
- Miranda, V.C.; Souza, R.O.; Gallotti, B.; de Oliveira, M.F.A.; Faria, A.M.C.; Nicoli, J.R.; Ferreira, E.; Machado, D.C.C.; Martins, F.S. A Mixture of Four Probiotic Strains (Probiatop®) Mitigates Food Allergy to Ovalbumin in Mice. Probiotics Antimicrob. Proteins 2024, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.Y.; Ye, Y.L.; Ji, J.; Sun, J.D.; Wang, J.S.; Sun, X.L. Untargeted Metabolomic Profiling Reveals Changes in Gut Microbiota and Mechanisms of Its Regulation of Allergy in OVA-Sensitive BALB/c Mice. J. Agric. Food Chem. 2022, 70, 3344–3356. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.F.; Chen, Y.Q.; Li, Q.; Ye, X.Y.; Guo, X.Y.; Sun, L.; Zou, J.C.; Shen, Y.Q.; Mao, Y.H.; Li, C.W.; et al. Tetrahydrocurcumin alleviates allergic airway inflammation in asthmatic mice by modulating the gut microbiota. Food Funct. 2021, 12, 6830–6840. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Liu, H.P.; Chen, F.; Liu, H.; Cao, A.T.; Yao, S.; Sun, M.; Evans-Marin, H.L.; Zhao, Y.; Zhao, Q.; et al. Commensal A4 bacteria inhibit intestinal Th2-cell responses through induction of dendritic cell TGF-β production. Eur. J. Immunol. 2016, 46, 1162–1167. [Google Scholar] [CrossRef] [PubMed]
- Georgalaki, M.; Zoumpopoulou, G.; Anastasiou, R.; Kazou, M.; Tsakalidou, E. Lactobacillus kefiranofaciens: From Isolation and Taxonomy to Probiotic Properties and Applications. Microorganisms 2021, 9, 2158. [Google Scholar] [CrossRef]
- Vinderola, G.; Perdigón, G.; Duarte, J.; Farnworth, E.; Matar, C. Effects of the oral administration of the exopolysaccharide produced by Lactobacillus kefiranofaciens on the gut mucosal immunity. Cytokine 2006, 36, 254–260. [Google Scholar] [CrossRef] [PubMed]
- Jeong, D.; Kim, D.H.; Kang, I.B.; Kim, H.; Song, K.Y.; Kim, H.S.; Seo, K.H. Characterization and antibacterial activity of a novel exopolysaccharide produced by Lactobacillus kefiranofaciens DN1 isolated from kefir. Food Control 2017, 78, 436–442. [Google Scholar] [CrossRef]
- Jeong, D.; Kim, D.H.; Kang, I.B.; Kim, H.; Song, K.Y.; Kim, H.S.; Seo, K.H. Lactobacillus kefiranofaciens ZW18 from Kefir enhances the anti-tumor effect of anti-programmed cell death 1 (PD-1) immunotherapy by modulating the gut microbiota. Food Funct. 2022, 13, 10023–10033. [Google Scholar]
Target Gene | Primer Sequence (5′-3′) | Tm (°C) |
---|---|---|
IL-2 | F: TCCACTTCAAGCTCTACAG R: GAGTCAAAGTCCAGAACATGCC | 60 |
IFN-γ | F: CTGGCAGGATGATTCTGCTGG R: GCATACGACAGGGTTCAAGTTAT | 60 |
IL-4 | F: ACAGGAGAAGGGACGCCAT R: GAAGCCCTACAGACGAGCTCA | 60 |
IL-5 | F: AAGGATGCTTCTGCACTTGA R: TTACTCTGCTACTCCGAAGG | 60 |
IL-10 | F: AGGGCACCCAGTCTGAGAACA R: CGGCCTTGCTCTTGTTTTCAC | 60 |
IL-13 | F: AGCATGGTATGGAGTGTGGA R: TGGTTGTAGAGGTTAACGTT | 60 |
GAPDH | F: ATGGTGAAGGTCGGTGTGAACG R: CGCTCCTGGAAGATGGTGATGG | 60 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, H.; Duan, X.; Wang, Y.; Geng, W. Amelioration Effect of Lactobacillus kefiranofaciens ZW3 on Ovalbumin-Induced Allergic Symptoms in BALB/c Mice. Foods 2025, 14, 16. https://doi.org/10.3390/foods14010016
Xu H, Duan X, Wang Y, Geng W. Amelioration Effect of Lactobacillus kefiranofaciens ZW3 on Ovalbumin-Induced Allergic Symptoms in BALB/c Mice. Foods. 2025; 14(1):16. https://doi.org/10.3390/foods14010016
Chicago/Turabian StyleXu, Hanxue, Xiaowei Duan, Yanping Wang, and Weitao Geng. 2025. "Amelioration Effect of Lactobacillus kefiranofaciens ZW3 on Ovalbumin-Induced Allergic Symptoms in BALB/c Mice" Foods 14, no. 1: 16. https://doi.org/10.3390/foods14010016
APA StyleXu, H., Duan, X., Wang, Y., & Geng, W. (2025). Amelioration Effect of Lactobacillus kefiranofaciens ZW3 on Ovalbumin-Induced Allergic Symptoms in BALB/c Mice. Foods, 14(1), 16. https://doi.org/10.3390/foods14010016