Study of the Interactions between Muscle Fatty Acid Composition, Meat Quality-Related Genes and the Ileum Microbiota in Tibetan Sheep at Different Ages
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Animals and Sample Collection
2.2. Extraction and Determination of Fatty Acids
2.3. RNA Extraction and Detection
2.4. Biostatistical Analysis
2.5. Statistical Data Analysis
3. Results
3.1. Analysis of Muscle Fatty Acid Composition of Tibetan Sheep at Different Ages
3.1.1. Muscle SFA Content of Tibetan Sheep of Different Ages
3.1.2. Muscle UFAs Content in Tibetan Sheep of Different Ages
3.1.3. Total Fatty Acid Content of Muscle in Tibetan Sheep of Different Ages
3.2. Expression Characteristics of Muscle Quality Related Genes of Different Ages in Tibetan Sheep
3.3. Characteristics of Ileum Microbiota of Different Ages in Tibetan Sheep
3.3.1. The Ileum Microbiota Diversity
3.3.2. The Ileum Microbiota Species Composition
3.3.3. Analysis of Differential Microbiota of the Ileum at Different Ages
3.3.4. Prediction of the Ileum Microbiota Function
3.4. Analysis of the Correlation between Muscle Fatty Acids and Related Gene Expression in Tibetan Sheep of Different Ages
3.5. Analysis of the Ileum Microbiota-Muscle Fatty Acid-Realted Gene Associations in the Tibetan Sheep
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhou, J.W.; Guo, X.S.; Degen, A.A.; Zhang, Y.; Liu, H.; Mi, J.D.; Ding, L.M.; Wang, H.C.; Qiu, Q.; Long, R.J. Urea kinetics and nitrogen balance and requirements for maintenance in Tibetan sheep when fed oat hay. Small Rumin. Res. 2015, 129, 60–68. [Google Scholar] [CrossRef]
- Zhang, Q.Y.; Que, M.; Li, W.; Gao, S.; Tan, X.; Bu, D. Gangba sheep in the Tibetan plateau: Validating their unique meat quality and grazing factor analysis. J. Environ. Sci. 2021, 101, 117–122. [Google Scholar] [CrossRef] [PubMed]
- De Smet, S.; Vossen, E. Meat: The balance between nutrition and health. A review. Meat Sci. 2016, 120, 145–156. [Google Scholar] [CrossRef] [PubMed]
- Chishti, M.F.A.; Rahman, M.A.U.; Jatta, K.; Khan, S.; Riaz, M.; Bilal, Q.; Anwar, U.; Ahmad, S.; Bajwa, H.M.; Rasul, F. Effect of forage to concentrate ratio on growth performance and feeding behavior of Thalli lambs. Trop. Anim. Health Prod. 2022, 54, 236. [Google Scholar] [CrossRef] [PubMed]
- Kaffarnik, S.; Preuss, S.; Vetter, W. Direct determination of flavor relevant and further branched-chain fatty acids from sheep subcutaneous adipose tissue by gas chromatography with mass spectrometry. J. Chromatogr. A 2014, 1350, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Alvarenga, T.; Chen, Y.Z.; Furusho-Garcia, I.F.; Perez, J.R.O.; Hopkins, D.L. Manipulation of Omega-3 PUFAs in Lamb: Phenotypic and Genotypic Views. Compr. Rev. Food Sci. Food Saf. 2015, 14, 189–204. [Google Scholar] [CrossRef]
- LaRosa, J.C.; Hunninghake, D.; Bush, D.; Criqui, M.H.; Getz, G.S.; Gotto, A.M., Jr.; Grundy, S.M.; Rakita, L.; Robertson, R.M.; Weisfeldt, M.L. The cholesterol facts. A summary of the evidence relating dietary fats, serum cholesterol, and coronary heart disease. A joint statement by the American Heart Association and the National Heart, Lung, and Blood Institute. The Task Force on Cholesterol Issues, American Heart Association. Circulation 1990, 81, 1721–1733. [Google Scholar] [CrossRef]
- Simopoulos, A.P. The omega-6/omega-3 fatty acid ratio, genetic variation, and cardiovascular disease. Asia Pac. J. Clin. Nutr. 2008, 17 (Suppl. 1), 131–134. [Google Scholar] [CrossRef]
- Cifuni, G.F.; Napolitano, F.; Pacelli, C.; Riviezzi, A.M.; Girolami, A. Effect of age at slaughter on carcass traits, fatty acid composition and lipid oxidation of Apulian lambs. Small Rumin. Res. 1999, 35, 65–70. [Google Scholar] [CrossRef]
- Sen, A.R.; Santra, A.; Karim, S.A. Carcass yield, composition and meat quality attributes of sheep and goat under semiarid conditions. Meat Sci. 2004, 66, 757–763. [Google Scholar] [CrossRef]
- Zervas, G.; Tsiplakou, E. The effect of feeding systems on the characteristics of products from small ruminants. Small Rumin. Res. 2011, 101, 140–149. [Google Scholar] [CrossRef]
- Tanski, Z.; Stanislaw, M.; Bozena, Z. The Quality of Modified Atmosphere Packaged Meat from Lambs Slaughtered at 50 and 100 Days of Age. Asian-Australas. J. Anim. Sci. 2012, 25, 428–434. [Google Scholar] [CrossRef]
- Bakhsh, A.; Hwang, Y.H.; Joo, S.T. Effect of Slaughter Age on Muscle Fiber Composition, Intramuscular Connective Tissue, and Tenderness of Goat Meat during Post-Mortem Time. Foods 2019, 8, 571. [Google Scholar] [CrossRef]
- Slifierz, M.J.; Friendship, R.M.; Weese, J.S. Longitudinal study of the early-life fecal and nasal microbiotasof the domestic pig. BMC Microbiol. 2015, 15, 184. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, X.F.; Wang, X.Q.; Wang, J.J.; Zhao, J.C. Life-long dynamics of the swine gut microbiome and their implications in probiotics development and food safety. Gut Microbes 2020, 11, 1824–1832. [Google Scholar] [CrossRef] [PubMed]
- Huang, A.N.; Cai, R.J.; Wang, Q.; Shi, L.; Li, C.L.; Yan, H. Dynamic Change of Gut Microbiota During Porcine Epidemic Diarrhea Virus Infection in Suckling Piglets. Front. Microbiol. 2019, 10, 322. [Google Scholar] [CrossRef] [PubMed]
- Enjalbert, F.; Combes, S.; Zened, A.; Meynadier, A. Rumen microbiota and dietary fat: A mutual shaping. J. Appl. Microbiol. 2017, 123, 782–797. [Google Scholar] [CrossRef] [PubMed]
- Ha, J.K.; Lindsay, R.C. Volatile alkylphenols and thiophenol in species-related characterizing flavors of red meats. J. Food Sci. 1991, 56, 1197–1202. [Google Scholar] [CrossRef]
- Wang, B.; Wang, Y.J.; Zuo, S.X.; Peng, S.J.; Wang, Z.J.; Zhang, Y.J.; Luo, H.L. Untargeted and Targeted Metabolomics Profiling of Muscle Reveals Enhanced Meat Quality in Artificial Pasture Grazing Tan Lambs via Rescheduling the Rumen Bacterial Community. J. Agric. Food Chem. 2021, 69, 846–858. [Google Scholar] [CrossRef]
- Meale, S.J.; Shucong, L.; Paula, A.; Hooman, D.; Plaizier, J.C.; Ehsan, K.; Steele, M.A. Development of Ruminal and Fecal Microbiomes Are Affected by Weaning But Not Weaning Strategy in Dairy Calves. Front. Microbiol. 2016, 7, 582. [Google Scholar] [CrossRef]
- Nogalski, Z.; Górak, E. Relationships between The Levels of Blood Indices in the Perinatal Period and the Body Condition and Performance Traits of Cows. Pol. J. Nat. Sci. 2007, 22, 228–238. [Google Scholar] [CrossRef]
- Boone, C.; Mourot, J.; Gregoire, F.; Remacle, C. The adipose conversion process: Regulation by extracellular and intracellular factors. Reprod. Nutr. Dev. 2000, 40, 325–358. [Google Scholar] [CrossRef] [PubMed]
- Sorisky, A. From preadipocyte to adipocyte: Differentiation-directed signals of insulin from the cell surface to the nucleus. Crit. Rev. Clin. Lab. Sci. 1999, 36, 1–34. [Google Scholar] [CrossRef] [PubMed]
- Ntambi, J.M.; Buhrow, S.A.; Kaestner, K.H.; Christy, R.J.; Sibley, E.; Kelly, T.J., Jr.; Lane, M.D. Differentiation-induced gene expression in 3T3-L1 preadipocytes. Characterization of a differentially expressed gene encoding stearoyl-CoA desaturase. J. Biol. Chem. 1988, 263, 17291–17300. [Google Scholar] [CrossRef] [PubMed]
- Chawla, A.; Lazar, M.A. Peroxisome proliferator and retinoid signaling pathways co-regulate preadipocyte phenotype and survival. Proc. Natl. Acad. Sci. USA 1994, 91, 1786–1790. [Google Scholar] [CrossRef]
- Murphy, E.J.; Prows, D.R.; Jefferson, J.R.; Schroeder, F. Liver fatty acid-binding protein expression in transfected fibroblasts stimulates fatty acid uptake and metabolism. Biochim. Biophys. Acta 1996, 1301, 191–198. [Google Scholar] [CrossRef]
- Buchanan, J.W.; Reecy, J.M.; Garrick, D.J.; Duan, Q.; Beitz, D.C.; Koltes, J.E.; Saatchi, M.; Koesterke, L.; Mateescu, R.G. Deriving Gene Networks from SNP Associated with Triacylglycerol and Phospholipid Fatty Acid Fractions from Ribeyes of Angus Cattle. Front. Genet. 2016, 7, 116. [Google Scholar] [CrossRef]
- Sha, Y.Z.; He, Y.Y.; Liu, X.; Zhao, S.G.; Hu, J.; Wang, J.Q.; Li, S.B.; Li, W.H.; Shi, B.G.; Hao, Z.Y. Rumen Epithelial Development- and Metabolism-Related Genes Regulate Their Micromorphology and VFAs Mediating Plateau Adaptability at Different Ages in Tibetan Sheep. Int. J. Mol. Sci. 2022, 23, 6078. [Google Scholar] [CrossRef]
- Wu, T.; Yang, F.R.; Jiao, T.; Zhao, S.G. Effects of Dietary Oregano Essential Oil on Cecal Microorganisms and Muscle Fatty Acids of Luhua Chickens. Animals 2022, 12, 3215. [Google Scholar] [CrossRef]
- Wood, J.D.; Enser, M.; Fisher, A.V.; Nute, G.R.; Sheard, P.R.; Richardson, R.I.; Hughes, S.I.; Whittington, F.M. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci. 2008, 78, 343–358. [Google Scholar] [CrossRef]
- Wood, J.D.; Richardson, R.I.; Nute, G.R.; Fisher, A.V.; Campo, M.M.; Kasapidou, E.; Sheard, P.R.; Enser, M. Effects of fatty acids on meat quality: A review. Meat Sci. 2004, 66, 21–32. [Google Scholar] [CrossRef]
- Katan, M.B.; Zock, P.L.; Mensink, R.P. Effects of fats and fatty acids on blood lipids in humans: An overview. Am. J. Clin. Nutr. 1994, 60, 1017S–1022S. [Google Scholar] [CrossRef]
- Banskalieva, V.; Sahlu, T.; Goetsch, A.L. Fatty acid composition of goat muscles and fat depots: A review. Small Rumin. Res. J. Int. Goat Assoc. 2000, 37, 255–268. [Google Scholar] [CrossRef]
- Yaqoob, P. Monounsaturated fatty acids and immune function. Eur. J. Clin. Nutr. 2002, 56 (Suppl. 3), S9–S13. [Google Scholar] [CrossRef]
- Liu, W.J.; Ding, H.; Erdene, K.; Chen, R.W.; Mu, Q.E.; Ao, C.J. Effects of flavonoids from Allium mongolicum Regel as a dietary additive on meat quality and composition of fatty acids related to flavor in lambs. Can. J. Anim. Sci. 2019, 99, 15–23. [Google Scholar] [CrossRef]
- Caporaso, F.; Sink, J.D.; Dimick, P.S.; Mussinan, C.J.; Sanderson, A. Volatile flavor constituents of ovine adipose tissue. J. Agric. Food Chem. 1977, 25, 1230–1234. [Google Scholar] [CrossRef]
- De Smet, S.; Raes, K.; Demeyer, D. Meat fatty acid composition as affected by fatness and genetic factors: A review. Anim. Res. 2004, 53, 81–98. [Google Scholar] [CrossRef]
- Murillo-Rodríguez, E.; Veras, A.B.; Rocha, N.B.; Budde, H.; Machado, S. An Overview of the Clinical Uses, Pharmacology, and Safety of Modafinil. ACS Chem. Neurosci. 2018, 9, 151–158. [Google Scholar] [CrossRef]
- Cameron, N.D.; Enser, M.B. Fatty acid composition of lipid in Longissimus dorsi muscle of Duroc and British Landrace pigs and its relationship with eating quality. Meat Sci. 1991, 29, 295–307. [Google Scholar] [CrossRef] [PubMed]
- Bonanome, A.; Grundy, S.M. Effect of dietary stearic acid on plasma cholesterol and lipoprotein levels. N. Engl. J. Med. 1988, 318, 1244–1248. [Google Scholar] [CrossRef] [PubMed]
- Kopecky, J.; Rossmeisl, M.; Flachs, P.; Kuda, O.; Brauner, P.; Jilkova, Z.; Stankova, B.; Tvrzicka, E.; Bryhn, M. n-3 PUFA: Bioavailability and modulation of adipose tissue function. Proc. Nutr. Soc. 2009, 68, 361–369. [Google Scholar] [CrossRef]
- Aurousseau, B.; Bauchart, D.; Faure, X.; Galot, A.L.; Prache, S.; Micol, D.; Priolo, A. Indoor fattening of lambs raised on pasture. Part 1: Influence of stall finishing duration on lipid classes and fatty acids in the longissimus thoracis muscle. Meat Sci. 2007, 76, 241–252. [Google Scholar] [CrossRef]
- Roche, H.M.; Gibney, M.J. Effect of long-chain n−3 polyunsaturated fatty acids on fasting and postprandial triacylglycerol metabolism. Am. J. Clin. Nutr. 2000, 71, 232s–237s. [Google Scholar] [CrossRef] [PubMed]
- Chikwanha, O.C.; Vahmani, P.; Muchenje, V.; Dugan, M.E.R.; Mapiye, C. Nutritional enhancement of sheep meat fatty acid profile for human health and wellbeing. Food Res. Int. 2018, 104, 25–38. [Google Scholar] [CrossRef] [PubMed]
- Marriott, B.P.; Turner, T.H.; Hibbeln, J.R.; Pregulman, M.; Newman, J.; Johnson, K.B.; Malek, A.M.; Malcolm, R.J.; Burbelo, G.A.; Wissman, J.W.; et al. Design and methods for the Ranger Resilience and Improved Performance on Phospholipid bound Omega-3’s (RRIPP-3 study). Contemp. Clin. Trials Commun. 2019, 15, 100359. [Google Scholar] [CrossRef]
- Oliveira, T.C.; Lima, S.L.; Bressan, J. Influences of different thermal processings in milk, bovine meat and frog protein structure. Nutr. Hosp. 2013, 28, 896–902. [Google Scholar] [CrossRef]
- Schneedorferová, I.; Tomcala, A.; Valterová, I. Effect of heat treatment on the n-3/n-6 ratio and content of polyunsaturated fatty acids in fish tissues. Food Chem. 2015, 176, 205–211. [Google Scholar] [CrossRef]
- Yin, F.G.; Yin, Y.L.; Zhang, Z.Z.; Xie, M.Y.; Huang, J.; Huang, R.L.; Li, T.J. Digestion rate of dietary starch affects the systemic circulation of lipid profiles and lipid metabolism-related gene expression in weaned pigs. Br. J. Nutr. 2011, 106, 369–377. [Google Scholar] [CrossRef] [PubMed]
- Ye, M.H.; Chen, J.L.; Zhao, G.P.; Zheng, M.Q.; Wen, J. Associations of A-FABP and H-FABP Markers with the Content of Intramuscular Fat in Beijing-You Chicken. Anim. Biotechnol. 2010, 21, 14–24. [Google Scholar] [CrossRef]
- Goszczynski, D.E.; Papaleo-Mazzucco, J.; Ripoli, M.V.; Villarreal, E.L.; Rogberg-Muñoz, A.; Mezzadra, C.A.; Melucci, L.M.; Giovambattista, G. Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content. Anim. Biotechnol. 2017, 28, 211–219. [Google Scholar] [CrossRef]
- Dobrzyn, A.; Dobrzyn, P. Stearoyl-CoA desaturase--a new player in skeletal muscle metabolism regulation. J. Physiol. Pharmacol. Off. J. Pol. Physiol. Soc. 2006, 57 (Suppl. 10), 31–42. [Google Scholar] [CrossRef]
- Moioli, B.; Contarini, G.; Avalli, A.; Catillo, G.; Orro, L.; De Matteis, G.; Masoero, G.; Napolitano, F. Short communication: Effect of stearoyl-coenzyme A desaturase polymorphism on fatty acid composition of milk. J. Dairy Sci. 2007, 90, 3553–3558. [Google Scholar] [CrossRef]
- Wang, H.; Wang, J.; Yang, D.D.; Liu, Z.L.; Zeng, Y.Q.; Chen, W. Expression of lipid metabolism genes provides new insights into intramuscular fat deposition in Laiwu pigs. Asian-Australas. J. Anim. Sci. 2020, 33, 390–397. [Google Scholar] [CrossRef] [PubMed]
- Guevarra, R.B.; Lee, J.H.; Lee, S.H.; Seok, M.J.; Kim, D.W.; Kang, B.N.; Johnson, T.J.; Isaacson, R.E.; Kim, H.B. Piglet gut microbial shifts early in life: Causes and effects. J. Anim. Sci. Biotechnol. 2019, 10, 1. [Google Scholar] [CrossRef] [PubMed]
- Frese, S.A.; Parker, K.; Calvert, C.C.; Mills, D.A. Diet shapes the gut microbiome of pigs during nursing and weaning. Microbiome 2015, 3, 28. [Google Scholar] [CrossRef] [PubMed]
- Kaakoush, N.O. Insights into the Role of Erysipelotrichaceae in the Human Host. Front. Cell. Infect. Microbiol. 2015, 5, 84. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.M.; Fang, L.; Meng, Q.X.; Li, S.L.; Chai, S.T.; Liu, S.J.; Schonewille, J.T. Assessment of Ruminal Bacterial and Archaeal Community Structure in Yak (Bos grunniens). Front. Microbiol. 2017, 8, 179. [Google Scholar] [CrossRef]
- Niederberger, T.D.; McDonald, I.R.; Hacker, A.L.; Soo, R.M.; Barrett, J.E.; Wall, D.H.; Cary, S.C. Microbial community composition in soils of Northern Victoria Land, Antarctica. Environ. Microbiol. 2008, 10, 1713–1724. [Google Scholar] [CrossRef] [PubMed]
- Peng, B.Y.; Huang, S.C.; Liu, T.T.; Geng, A.L. Bacterial xylose isomerases from the mammal gut Bacteroidetes cluster function in Saccharomyces cerevisiae for effective xylose fermentation. Microb. Cell Factories 2015, 14, 70. [Google Scholar] [CrossRef] [PubMed]
- He, B.; Nohara, K.; Ajami, N.J.; Michalek, R.D.; Tian, X.J.; Wong, M.; Losee-Olson, S.H.; Petrosino, J.F.; Yoo, S.H.; Shimomura, K.; et al. Transmissible microbial and metabolomic remodeling by soluble dietary fiber improves metabolic homeostasis. Sci. Rep. 2015, 5. [Google Scholar] [CrossRef]
- Tajima, K.; Aminov, R.I.; Nagamine, T.; Matsui, H.; Nakamura, M.; Benno, Y. Diet-dependent shifts in the bacterial population of the rumen revealed with real-time PCR. Appl. Environ. Microbiol. 2001, 67, 2766–2774. [Google Scholar] [CrossRef] [PubMed]
- Rahman, N.A.; Parks, D.H.; Vanwonterghem, I.; Morrison, M.; Tyson, G.W.; Hugenholtz, P. A Phylogenomic Analysis of the Bacterial Phylum Fibrobacteres. Front. Microbiol. 2016, 6, 1469. [Google Scholar] [CrossRef]
- Xue, D.; Chen, H.; Chen, F.; He, Y.X.; Zhao, C.; Zhu, D.; Zeng, L.L.; Li, W. Analysis of the rumen bacteria and methanogenic archaea of yak (Bos grunniens) steers grazing on the Qinghai-Tibetan Plateau. Livest. Sci. 2016, 188, 61–71. [Google Scholar] [CrossRef]
- Mariz, L.D.S.; Amaral, P.M.; Valadares, S.C.; Santos, S.A.; Detmann, E.; Marcondes, M.I.; Pereira, J.M.V.; Silva, J.M.; Prados, L.F.; Faciola, A.P. Dietary protein reduction on microbial protein, amino acid digestibility, and body retention in beef cattle: 2. Amino acid intestinal absorption and their efficiency for whole-body deposition. J. Anim. Sci. 2018, 96, 670–683. [Google Scholar] [CrossRef] [PubMed]
- Conte, G.; Dimauro, C.; Daghio, M.; Serra, A.; Mannelli, F.; McAmmond, B.M.; Van Hamme, J.D.; Buccioni, A.; Viti, C.; Mantino, A.; et al. Exploring the relationship between bacterial genera and lipid metabolism in bovine rumen. Animal 2022, 16, 100520. [Google Scholar] [CrossRef]
- Jenkins, T.C. Lipid metabolism in the rumen. J. Dairy Sci. 1993, 76, 3851–3863. [Google Scholar] [CrossRef]
- Leclercq, S.; Le Roy, T.; Furgiuele, S.; Coste, V.; Bindels, L.B.; Leyrolle, Q.; Neyrinck, A.M.; Quoilin, C.; Amadieu, C.; Petit, G.; et al. Gut Microbiota-Induced Changes in β-Hydroxybutyrate Metabolism Are Linked to Altered Sociability and Depression in Alcohol Use Disorder. Cell Rep. 2020, 33, 108238. [Google Scholar] [CrossRef]
- Mao, G.Z.; Li, S.; Orfila, C.; Shen, X.M.; Zhou, S.Y.; Linhardt, R.J.; Ye, X.Q.; Chen, S.G. Depolymerized RG-I-enriched pectin from citrus segment membranes modulates gut microbiota, increases SCFA production, and promotes the growth of Bifidobacterium spp., Lactobacillus spp. and Faecalibaculum spp. Food Funct. 2019, 10, 7828–7843. [Google Scholar] [CrossRef]
- Mangifesta, M.; Mancabelli, L.; Milani, C.; Gaiani, F.; de’Angelis, N.; de’Angelis, G.L.; van Sinderen, D.; Ventura, M.; Turroni, F. Mucosal microbiota of intestinal polyps reveals putative biomarkers of colorectal cancer. Sci. Rep. 2018, 8, 13974. [Google Scholar] [CrossRef]
- Waters, J.L.; Ley, R.E. The human gut bacteria Christensenellaceae are widespread, heritable, and associated with health. BMC Biology 2019, 17, 83. [Google Scholar] [CrossRef]
- Evans, N.J.; Brown, J.M.; Murray, R.D.; Getty, B.; Birtles, R.J.; Hart, C.A.; Carter, S.D. Characterization of Novel Bovine Gastrointestinal Tract Treponema Isolates and Comparison with Bovine Digital Dermatitis Treponemes. Appl. Environ. Microbiol. 2011, 77, 138–147. [Google Scholar] [CrossRef] [PubMed]
- Baltazar-Díaz, T.A.; González-Hernández, L.A.; Aldana-Ledesma, J.M.; Peña-Rodríguez, M.; Vega-Magaña, A.N.; Zepeda-Morales, A.S.M.; López-Roa, R.I.; del Toro-Arreola, S.; Martínez-López, E.; Salazar-Montes, A.M.; et al. Escherichia/Shigella, SCFAs, and Metabolic Pathways-The Triad That Orchestrates Intestinal Dysbiosis in Patients with Decompensated Alcoholic Cirrhosis from Western Mexico. Microorganisms 2022, 10, 1231. [Google Scholar] [CrossRef] [PubMed]
- Yonekura, S.; Hirota, S.; Miyazaki, H.; Tokutake, Y. Subcellular Localization and Polymorphism of Bovine FABP4 in Bovine Intramuscular Adipocytes. Anim. Biotechnol. 2016, 27, 96–103. [Google Scholar] [CrossRef] [PubMed]
Nutrients (DM Basis) | Dominant Forage Species | |
---|---|---|
CP (%) | 10.06 | Poa pratensis L. |
CP (%) | 3.77 | |
Ash (%) | 4.55 | Elymus nutans Griseb |
NDF (%) | 70.11 | |
NDF (%) | 36.17 | Agropyron cristatum (L.) Gaertn |
HCEL (%) | 33.94 | |
Ca (%) | 11.50 | Stipa aliena Keng |
P (%) | 0.65 | |
Aboveground biomass (g/m2) | 343.52 | Potentilla bifurca Linn. |
Grass height (cm) | 16.12 |
Items | (5′–3′) | Tm/°C | Length/bp | Gene Sequence No. |
---|---|---|---|---|
β-actin | F: AGCCTTCCTTCCTGGGCATGGA R: GGACAGCACCGTGTTGGCGTAGA | 60 | 113 | NM_001009784.3 |
LPL | F: CCTGGAGTGACGGAATCTGTG R: CCACGATGACGTTGGAGTCT | 60 | 160 | NM_001009394.1 |
SCD | F: TCACATTGATCCCCACCTGC R: CCGAGCTTTGTAGGTTCGGT | 60 | 125 | NM_001009254.1 |
FASN | F: CTTAACAGCACGTCCCCCAT R: TCCTCGGGCTTGTCTTGTTC | 60 | 149 | XM_027974304.2 |
PPARγ | F: CTTGCTGTGGGGATGTCTCA R: TTCAGTTGGTCGATGTCGCT | 60 | 104 | NM_001100921.1 |
FABP4 | F: AGAAGTGGGTGTGGGCTTTG R: CTGGCCCAATTTGAAGGACATC | 60 | 142 | NM_001114667.1 |
SFA | Tissue | 4M | 1.5Y | 3.5Y | 6Y |
---|---|---|---|---|---|
Butyric acid C4:0 | Ldm | 0.43 ± 0.326 ab | 0.57 ± 0.259 ab | 0.45 ± 0.106 b | 0.84 ± 0.247 a |
Fm | 0.64 ± 0.117 a | 0.41 ± 0.095 b | 0.78 ± 0.023 a | 0.21 ± 0.020 c | |
Hm | 0.26 ± 0.039 c | 0.73 ± 0.051 a | 0.36 ± 0.033 b | 0.32 ± 0.008 b | |
Tridecanoic acid C13:0 | Ldm | 0.85 ± 0.291 a | 1.28 ± 0.229 a | 0.63 ± 0.025 a | 0.86 ± 0.089 a |
Fm | 0.94 ± 0.004 b | 0.91 ± 0.108 b | 1.30 ± 0.065 a | 0.56 ± 0.023 b | |
Hm | 0.71 ± 0.101 c | 1.40 ± 0.160 a | 0.94 ± 0.245 b | 0.73 ± 0.078 c | |
Myristic acid C14:0 | Ldm | 4.83 ± 0.854 a | 1.80 ± 0.237 b | 2.14 ± 0.040 a | 1.78 ± 0.012 b |
Fm | 2.47 ± 0.180 a | 2.14 ± 0.111 a | 1.68 ± 0.203 b | 2.02 ± 0.004 a | |
Hm | 4.89 ± 0.552 a | 1.94 ± 0.240 a | 1.97 ± 0.345 a | 2.00 ± 0.069 a | |
Pentadecanoic acid C15:0 | Ldm | 0.51 ± 0.132 a | 0.68 ± 0.132 a | 0.25 ± 0.049 a | 0.52 ± 0.090 a |
Fm | 0.38 ± 0.036 b | 0.39 ± 0.107 b | 0.66 ± 0.007 a | 0.42 ± 0.002 b | |
Hm | 0.59 ± 0.023 a | 0.40 ± 0.016 a | 0.36 ± 0.095 a | 0.47 ± 0.034 a | |
Daturic acid C17:0 | Ldm | 0.84 ± 0.013 b | 1.10 ± 0.167 a | 1.19 ± 0.090 a | 0.86 ± 0.127 b |
Fm | 1.02 ± 0.514 a | 1.23 ± 0.035 a | 0.94 ± 0.134 b | 1.11 ± 0.012 a | |
Hm | 0.76 ± 0.126 c | 0.93 ± 0.010 b | 0.98 ± 0.083 b | 1.11 ± 0.016 a | |
Stearic acid C18:0 | Ldm | 15.89 ± 0.065 c | 20.68 ± 1.924 b | 24.35 ± 0.902 a | 17.06 ± 0.199 c |
Fm | 18.99 ± 0.277 c | 21.73 ± 0.871 b | 19.32 ± 0.811 c | 23.23 ± 0.380 a | |
Hm | 17.59 ± 0.539 b | 17.19 ± 0.673 b | 21.59 ± 0.555 a | 21.02 ± 0.096 a | |
Docosa-octadecanoic acid C22:0 | Ldm | 0.43 ± 0.083 ab | 0.63 ± 0.261 a | 0.34 ± 0.029 a | 0.52 ± 0.045 a |
Fm | 0.75 ± 0.123 b | 0.66 ± 0.039 b | 0.88 ± 0.004 a | 0.41 ± 0.035 c | |
Hm | 0.35 ± 0.036 c | 0.81 ± 0.209 a | 0.59 ± 0.006 b | 0.47 ± 0.095 b |
UFA | Tissue | 4M | 1.5Y | 3.5Y | 6Y |
---|---|---|---|---|---|
Myristoleic acid C14:1 | Ldm | 0.66 ± 0.177 a | 0.87 ± 0.305 a | 0.58 ± 0.022 a | 0.67 ± 0.029 a |
Fm | 0.66 ± 0.178 a | 0.78 ± 0.210 b | 1.19 ± 0.056 a | 0.39 ± 0.027 c | |
Hm | 0.43 ± 0.011 b | 1.04 ± 0.222 a | 0.62 ± 0.070 b | 0.64 ± 0.074 b | |
Palmitoleic acid C16:1 | Ldm | 0.98 ± 0.315 b | 1.19 ± 0.019 b | 1.08 ± 0.058 c | 1.50 ± 0.050 a |
Fm | 1.31 ± 0.107 a | 1.13 ± 0.035 a | 1.26 ± 0.156 ab | 1.06 ± 0.047 b | |
Hm | 1.34 ± 0.023 a | 1.24 ± 0.057 a | 1.31 ± 0.216 a | 1.25 ± 0.029 a | |
Cis-10-heptadecenoic acid C17:1 | Ldm | 0.37 ± 0.011 d | 0.67 ± 0.004 a | 0.50 ± 0.012 c | 0.61 ± 0.012 b |
Fm | 0.49 ± 0.040 b | 0.60 ± 0.070 a | 0.51 ± 0.023 a | 0.58 ± 0.030 a | |
Hm | 0.41 ± 0.021 b | 0.63 ± 0.040 a | 0.58 ± 0.011 a | 0.59 ± 0.037 a | |
Elaidic acid C18:1n9t | Ldm | 3.23 ± 0.139 b | 2.54 ± 0.291 b | 4.83 ± 0.165 a | 2.58 ± 0.339 b |
Fm | 3.74 ± 1.042 ab | 3.31 ± 0.476 b | 2.65 ± 0.953 b | 4.80 ± 0.015 a | |
Hm | 2.39 ± 0.148 b | 2.86 ± 0.617 b | 3.24 ± 0.985 ab | 4.50 ± 0.405 a | |
Oleic acid C18:1n9c | Ldm | 30.57 ± 1.638 c | 34.59 ± 1.257 ab | 32.70 ± 1.434 b | 36.62 ± 1.026 a |
Fm | 30.00 ± 0.110 c | 34.86 ± 0.989 a | 31.37 ± 0.844 a | 32.45 ± 0.380 a | |
Hm | 28.43 ± 0.626 b | 30.59 ± 1.993 a | 32.50 ± 1.197 a | 32.65 ± 0.833 a | |
Linoleic acid C18:2n6c | Ldm | 5.49 ± 1.944 a | 6.46 ± 0.972 a | 4.53 ± 0.315 a | 4.89 ± 0.483 a |
Fm | 6.11 ± 0.069 b | 4.81 ± 1.261 b | 8.33 ± 0.292 a | 4.39 ± 0.033 b | |
Hm | 5.80 ± 0.690 b | 8.77 ± 1.093 a | 6.86 ± 0.367 b | 5.88 ± 0.345 b | |
Alpha linoleic acid C18:3n3 | Ldm | 0.87 ± 0.157 ab | 0.61 ± 0.011 a | 0.80 ± 0.095 a | 1.18 ± 0.493 a |
Fm | 0.59 ± 0.189 b | 0.69 ± 0.073 b | 0.59 ± 0.191 b | 1.56 ± 0.093 a | |
Hm | 2.17 ± 0.071 b | 3.29 ± 0.612 a | 2.12 ± 0.082 b | 1.66 ± 0.731 b | |
Arachidonic acid C20:4n6 | Ldm | 2.32 ± 0.904 a | 2.77 ± 0.452 a | 1.58 ± 0.248 a | 2.15 ± 0.062 a |
Fm | 3.85 ± 0.498 a | 1.88 ± 0.466 b | 3.59 ± 0.200 a | 1.59 ± 0.094 b | |
Hm | 3.33 ± 0.530 ab | 4.17 ± 0.013 a | 2.53 ± 0.730 b | 1.97 ± 0.116 b | |
Cis-5,8,11,14,17-eicosapentaen-oic acid C20:5n3 | Ldm | 0.55 ± 0.180 b | 1.49 ± 0.253 a | 0.56 ± 0.138 b | 1.38 ± 0.185 a |
Fm | 1.91 ± 0.255 a | 0.90 ± 0.169 b | 1.55 ± 0.335 a | 0.77 ± 0.047 b | |
Hm | 2.09 ± 0.073 a | 2.09 ± 0.073 a | 1.10 ± 0.209 b | 0.98 ± 0.149 b | |
Docosahexaenoic acid C22:6n3 | Ldm | 0.86 ± 0.296 a | 1.38 ± 0.221 a | 0.73 ± 0.117 a | 1.23 ± 0.126 a |
Fm | 0.47 ± 0.246 a | 0.47 ± 0.246 a | 0.33 ± 0.005 a | 0.21 ± 0.008 a | |
Hm | 0.19 ± 0.054 b | 0.33 ± 0.029 a | 0.24 ± 0.010 b | 0.22 ± 0.019 b |
Fatty Acid | Tissue | 4M | 1.5Y | 3.5Y | 6Y |
---|---|---|---|---|---|
UFA/% | Ldm | 47.58 ± 2.322 b | 52.56 ± 1.669 b | 47.87 ± 0.573 b | 52.80 ± 1.604 a |
Fm | 49.31 ± 0.385 b | 49.42 ± 2.001 b | 51.38 ± 0.672 a | 47.80 ± 0.401 b | |
Hm | 47.24 ± 0.728 c | 55.00 ± 0.034 a | 51.08 ± 1.777 b | 50.32 ± 0.784 b | |
SFA/% | Ldm | 23.78 ± 0.074 c | 26.75 ± 1.657 b | 29.37 ± 0.916 a | 22.46 ± 0.282 c |
Fm | 25.20 ± 0.692 b | 27.49 ± 0.509 a | 25.58 ± 0.827 b | 27.97 ± 0.465 a | |
Hm | 25.16 ± 0.014 c | 23.41 ± 0.747 b | 26.80 ± 0.451 a | 26.12 ± 0.451 a | |
MUFA/% | Ldm | 35.80 ± 1.649 c | 39.85 ± 1.228 b | 39.68 ± 1.294 b | 41.98 ± 0.970 a |
Fm | 36.31 ± 0.673 b | 40.67 ± 0.861 a | 36.97 ± 0.032 b | 39.28 ± 0.409 a | |
Hm | 33.00 ± 0.444 c | 36.36 ± 1.582 b | 38.24 ± 1.061 a | 39.62 ± 0.727 a | |
PUFA/% | Ldm | 11.78 ± 3.970 a | 12.71 ± 1.893 a | 8.19 ± 0.721 a | 10.82 ± 1.181 a |
Fm | 13.00 ± 0.288 b | 8.75 ± 1.722 b | 14.41 ± 0.654 a | 8.52 ± 0.009 b | |
Hm | 14.25 ± 0.284 b | 18.64 ± 1.615 a | 12.84 ± 1.214 b | 10.71 ± 0.401 b | |
P/S | Ldm | 0.50 ± 0.169 a | 0.41 ± 0.161 ab | 0.28 ± 0.015 b | 0.50 ± 0.069 a |
Fm | 0.52 ± 0.026 b | 0.32 ± 0.067 b | 0.59 ± 0.007 a | 0.31 ± 0.006 b | |
Hm | 0.57 ± 0.011 b | 0.80 ± 0.095 a | 0.48 ± 0.038 b | 0.48 ± 0.039 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, F.; Sha, Y.; Liu, X.; He, Y.; Hu, J.; Wang, J.; Li, S.; Shao, P.; Chen, X.; Yang, W.; et al. Study of the Interactions between Muscle Fatty Acid Composition, Meat Quality-Related Genes and the Ileum Microbiota in Tibetan Sheep at Different Ages. Foods 2024, 13, 679. https://doi.org/10.3390/foods13050679
Wang F, Sha Y, Liu X, He Y, Hu J, Wang J, Li S, Shao P, Chen X, Yang W, et al. Study of the Interactions between Muscle Fatty Acid Composition, Meat Quality-Related Genes and the Ileum Microbiota in Tibetan Sheep at Different Ages. Foods. 2024; 13(5):679. https://doi.org/10.3390/foods13050679
Chicago/Turabian StyleWang, Fanxiong, Yuzhu Sha, Xiu Liu, Yanyu He, Jiang Hu, Jiqing Wang, Shaobin Li, Pengyang Shao, Xiaowei Chen, Wenxin Yang, and et al. 2024. "Study of the Interactions between Muscle Fatty Acid Composition, Meat Quality-Related Genes and the Ileum Microbiota in Tibetan Sheep at Different Ages" Foods 13, no. 5: 679. https://doi.org/10.3390/foods13050679
APA StyleWang, F., Sha, Y., Liu, X., He, Y., Hu, J., Wang, J., Li, S., Shao, P., Chen, X., Yang, W., Chen, Q., Gao, M., & Huang, W. (2024). Study of the Interactions between Muscle Fatty Acid Composition, Meat Quality-Related Genes and the Ileum Microbiota in Tibetan Sheep at Different Ages. Foods, 13(5), 679. https://doi.org/10.3390/foods13050679