Solubilized β-Glucan Supplementation in C57BL/6J Mice Dams Augments Neurodevelopment and Cognition in the Offspring Driven by Gut Microbiome Remodeling
Abstract
1. Introduction
2. Materials and Methods
2.1. Production of Purified β-Glucans from Oat Products
Extraction, Solubilization, and Purification of β-Glucans
2.2. Quantification of β-Glucan
2.2.1. Macromolecular Characteristics of Solubilized Oat β-Glucan
2.2.2. Monosaccharide Analysis
2.2.3. Molecular Weight Analysis
2.3. Animal Experiment
2.3.1. Animal Diet
2.3.2. Soluble Fiber Supplementation in Dams
2.3.3. Collection of Samples from Dams and Perinatal Pups
2.3.4. Long-Term Supplementation of Offspring
2.4. Cognitive and Behavioral Tests
2.4.1. Y-Maze Test
2.4.2. Passive Avoidance Test
2.4.3. Morris Water Maze Test
2.5. Cecal SCFA Quantitative Analysis
2.6. 16s RNA Microbiome Profiling
2.6.1. Cecal Sample 16s rRNA Sequencing
2.6.2. Pre-Processing of Raw 16s rRNA Amplicon Sequencing Data
2.6.3. Community Profiling
2.7. RNA Sequencing
2.7.1. RNA Extraction, Purification, and Integrity Testing Using Cortex Samples from 4-Week-Old Pups
2.7.2. Bioinformatic Analysis of RNA-Seq Data
2.8. RNA Isolation from Samples of 1-Week-Old Pup Brains and 4-Week-Old Pup Intestines, and Quantitative Real-Time PCR
2.9. Western Blotting
2.10. BDNF Assay
2.11. Cytokine Array on Serum
2.12. Fluorescence Immunohistochemistry
2.13. Statistical Analysis
3. Results
3.1. Optimization of Extraction and Solubilization Process
3.2. Yield of Solubilized β-Glucans
3.3. Molecular Weight of Solubilized β-Glucans
3.4. β-Glucan Influences Weight Gain and Intestinal Barrier Function during Gestation
3.5. Cecal SCFA Analysis
3.6. Gut Microbiome Profile of Dams and 4-Week-Old Pups
3.7. Serum Cytokine Profile in Weaning Pups
3.8. Comparison of Differentially Enriched Pathways in the Cerebral Cortex of 4-Week-Old Pups from the ObG and CMC Groups
3.9. Perinatal Changes in mRNA Markers of Neurodevelopment and Memory
3.10. Perinatal Alterations in Protein Markers of Neurodevelopment and Memory
3.11. Solubilized Oat β-Glucan Increases the Expression of Neurodevelopmental and Synaptic Strength Markers in the Hippocampus
3.12. Solubilized Oat β-Glucan Improves Learning, Long-Term Memory, and Cognition
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Barker, D.J. The origins of the developmental origins theory. J. Intern. Med. 2007, 261, 412–417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolton, J.L.; Bilbo, S.D. Developmental programming of brain and behavior by perinatal diet: Focus on inflammatory mechanisms. Dialogues Clin. Neurosci. 2014, 16, 307–320. [Google Scholar] [CrossRef] [Scilit]
- Rinninella, E.; Raoul, P.; Cintoni, M.; Franceschi, F.; Miggiano, G.A.D.; Gasbarrini, A.; Mele, M.C. What is the healthy gut microbiota composition? A changing ecosystem across age, environment, diet, and diseases. Microorganisms 2019, 7, 14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gohir, W.; Whelan, F.J.; Surette, M.G.; Moore, C.; Schertzer, J.D.; Sloboda, D.M. Pregnancy-related changes in the maternal gut microbiota are dependent upon the mother’s periconceptional diet. Gut Microbes 2015, 6, 310–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cordner, Z.A.; Khambadkone, S.G.; Boersma, G.J.; Song, L.; Summers, T.N.; Moran, T.H.; Tamashiro, K.L. Maternal high-fat diet results in cognitive impairment and hippocampal gene expression changes in rat offspring. Exp. Neurol. 2019, 318, 92–100. [Google Scholar] [CrossRef] [Scilit]
- Collado, M.C.; Isolauri, E.; Laitinen, K.; Salminen, S. Distinct composition of gut microbiota during pregnancy in overweight and normal-weight women1. Am. J. Clin. Nutr. 2008, 88, 894–899. [Google Scholar] [CrossRef] [Scilit]
- Bordeleau, M.; Fernández de Cossío, L.; Chakravarty, M.M.; Tremblay, M.-È. From Maternal Diet to Neurodevelopmental Disorders: A Story of Neuroinflammation. Front. Cell. Neurosci. 2021, 14, 612705. [Google Scholar] [CrossRef] [Scilit]
- Makki, K.; Deehan, E.C.; Walter, J.; Bäckhed, F. The impact of dietary fiber on gut microbiota in host health and disease. Cell Host Microbe 2018, 23, 705–715. [Google Scholar] [CrossRef] [Scilit]
- Falony, G.; Joossens, M.; Vieira-Silva, S.; Wang, J.; Darzi, Y.; Faust, K.; Kurilshikov, A.; Bonder, M.J.; Valles-Colomer, M.; Vandeputte, D.; et al. Population-level analysis of gut microbiome variation. Science 2016, 352, 560–564. [Google Scholar] [CrossRef] [Scilit]
- Kaoutari, A.E.; Armougom, F.; Gordon, J.I.; Raoult, D.; Henrissat, B. The abundance and variety of carbohydrate-active enzymes in the human gut microbiota. Nat. Rev. Microbiol. 2013, 11, 497–504. [Google Scholar] [CrossRef] [Scilit]
- Singh, R.P. Glycan utilisation system in Bacteroides and Bifidobacteria and their roles in gut stability and health. Appl. Microbiol. Biotechnol. 2019, 103, 7287–7315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ze, X.; Duncan, S.H.; Louis, P.; Flint, H.J. Ruminococcus bromii is a keystone species for the degradation of resistant starch in the human colon. ISME J. 2012, 6, 1535–1543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Grady, J.; O’Connor, E.M.; Shanahan, F. Dietary fibre in the era of microbiome science. Aliment. Pharmacol. Ther. 2019, 49, 506–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koh, A.; De Vadder, F.; Kovatcheva-Datchary, P.; Bäckhed, F. From dietary fiber to host physiology: Short-chain fatty acids as key bacterial metabolites. Cell 2016, 165, 1332–1345. [Google Scholar] [CrossRef] [Scilit]
- Kourtis, A.P.; Read, J.S.; Jamieson, D.J. Pregnancy and infection. N. Engl. J. Med. 2014, 370, 2211–2218. [Google Scholar] [CrossRef] [Scilit]
- Le Bourgot, C.; Ferret-Bernard, S.; Le Normand, L.; Savary, G.; Menendez-Aparicio, E.; Blat, S.; Appert-Bossard, E.; Respondek, F.; Le Huërou-Luron, I. Maternal short-chain fructooligosaccharide supplementation influences intestinal immune system maturation in piglets. PLoS ONE 2014, 9, e107508. [Google Scholar] [CrossRef] [Scilit]
- Megli, C.J.; Coyne, C.B. Infections at the maternal–fetal interface: An overview of pathogenesis and defence. Nat. Rev. Microbiol. 2022, 20, 67–82. [Google Scholar] [CrossRef] [Scilit]
- Aghaeepour, N.; Ganio, E.A.; McIlwain, D.; Tsai, A.S.; Tingle, M.; Van Gassen, S.; Gaudilliere, D.K.; Baca, Q.; McNeil, L.; Okada, R.; et al. An immune clock of human pregnancy. Sci. Immunol. 2017, 2, eaan2946. [Google Scholar] [CrossRef] [Scilit]
- Al Nabhani, Z.; Eberl, G. Imprinting of the immune system by the microbiota early in life. Mucosal Immunol. 2020, 13, 183–189. [Google Scholar] [CrossRef] [Scilit]
- Kimura, I.; Miyamoto, J.; Ohue-Kitano, R.; Watanabe, K.; Yamada, T.; Onuki, M.; Aoki, R.; Isobe, Y.; Kashihara, D.; Inoue, D.; et al. Maternal gut microbiota in pregnancy influences offspring metabolic phenotype in mice. Science 2020, 367, eaaw8429. [Google Scholar] [CrossRef] [Scilit]
- Ramanan, D.; Sefik, E.; Galván-Peña, S.; Wu, M.; Yang, L.; Yang, Z.; Kostic, A.; Golovkina, T.V.; Kasper, D.L.; Mathis, D. An immunologic mode of multigenerational transmission governs a gut Treg setpoint. Cell 2020, 181, 1276–1290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thorburn, A.N.; McKenzie, C.I.; Shen, S.; Stanley, D.; Macia, L.; Mason, L.J.; Roberts, L.K.; Wong, C.H.; Shim, R.; Robert, R. Evidence that asthma is a developmental origin disease influenced by maternal diet and bacterial metabolites. Nat. Commun. 2015, 6, 7320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- White, C.L.; Pistell, P.J.; Purpera, M.N.; Gupta, S.; Fernandez-Kim, S.-O.; Hise, T.L.; Keller, J.N.; Ingram, D.K.; Morrison, C.D.; Bruce-Keller, A.J. Effects of high fat diet on Morris maze performance, oxidative stress, and inflammation in rats: Contributions of maternal diet. Neurobiol. Dis. 2009, 35, 3–13. [Google Scholar] [CrossRef] [Scilit]
- van der Burg, J.W.; Sen, S.; Chomitz, V.R.; Seidell, J.C.; Leviton, A.; Dammann, O. The role of systemic inflammation linking maternal BMI to neurodevelopment in children. Pediatr. Res. 2016, 79, 3–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaur, R.; Sharma, M.; Ji, D.; Xu, M.; Agyei, D. Structural Features, Modification, and Functionalities of Beta-Glucan. Fibers 2020, 8, 1. [Google Scholar] [CrossRef] [Scilit]
- Nakashima, A.; Yamada, K.; Iwata, O.; Sugimoto, R.; Atsuji, K.; Ogawa, T.; Ishibashi-Ohgo, N.; Suzuki, K. β-Glucan in Foods and Its Physiological Functions. J. Nutr. Sci. Vitaminol. 2018, 64, 8–17. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, A.; Anjum, F.M.; Zahoor, T.; Nawaz, H.; Dilshad, S.M.R. Beta Glucan: A Valuable Functional Ingredient in Foods. Crit. Rev. Food Sci. Nutr. 2012, 52, 201–212. [Google Scholar] [CrossRef] [Scilit]
- Du, B.; Bian, Z.; Xu, B. Skin Health Promotion Effects of Natural Beta-Glucan Derived from Cereals and Microorganisms: A Review. Phytother. Res. 2014, 28, 159–166. [Google Scholar] [CrossRef] [Scilit]
- Izydorczyk, M.S.; Dexter, J.E. Barley β-glucans and arabinoxylans: Molecular structure, physicochemical properties, and uses in food products–a Review. Food Res. Int. 2008, 41, 850–868. [Google Scholar] [CrossRef] [Scilit]
- Wood, P.J. REVIEW: Oat and Rye β-Glucan: Properties and Function. Cereal Chem. 2010, 87, 315–330. [Google Scholar] [CrossRef] [Scilit]
- Prentice, N.; Babler, S.; Faber, S. Enzymic analysis of beta-D-glucans in cereal grains. Cereal Chem. 1981, 57, 198–202. [Google Scholar]
- Wood, P.J.; Weisz, J.; Blackwell, B.A. Structural studies of (1→3),(1→4)-β-D-glucans by 13C-nuclear magnetic resonance spectroscopy and by rapid analysis of cellulose-like regions using high-performance anion-exchange chromatography of oligosaccharides released by lichenase. Cereal Chem. 1994, 71, 301–307. [Google Scholar]
- Henry, R.J. A comparison of the non-starch carbohydrates in cereal grains. J. Sci. Food Agric. 1985, 36, 1243–1253. [Google Scholar] [CrossRef] [Scilit]
- Henry, R. Pentosan and (1→3),(1→4)-β-glucan concentrations in endosperm and wholegrain of wheat, barley, oats and rye. J. Cereal Sci. 1987, 6, 253–258. [Google Scholar] [CrossRef] [Scilit]
- Buckeridge, M.S.; Rayon, C.; Urbanowicz, B.; Tiné, M.A.S.; Carpita, N.C. Mixed Linkage (1→3),(1→4)-β-d-Glucans of Grasses. Cereal Chem. 2004, 81, 115–127. [Google Scholar] [CrossRef] [Scilit]
- Sikora, P.; Tosh, S.M.; Brummer, Y.; Olsson, O. Identification of high β-glucan oat lines and localization and chemical characterization of their seed kernel β-glucans. Food Chem. 2013, 137, 83–91. [Google Scholar] [CrossRef] [Scilit]
- Cui, Z.; Gong, Y.; Luo, X.; Zheng, N.; Tan, S.; Liu, S.; Li, Y.; Wang, Q.; Sun, F.; Hu, M. β-Glucan alleviates goal-directed behavioral deficits in mice infected with Toxoplasma gondii. Parasites Vectors 2023, 16, 65. [Google Scholar] [CrossRef] [Scilit]
- Hu, M.; Zhang, P.; Wang, R.; Zhou, M.; Pang, N.; Cui, X.; Ge, X.; Liu, X.; Huang, X.-F.; Yu, Y. Three Different Types of β-Glucans Enhance Cognition: The Role of the Gut-Brain Axis. Front. Nutr. 2022, 9, 848930. [Google Scholar] [CrossRef] [Scilit]
- Chen, B.; Zhao, C.; Zhu, H.; Lu, X.; Liu, H.; Lu, Q.; Zhu, T.; Huang, C. β-glucan, a specific immuno-stimulant, produces rapid antidepressant effects by stimulating ERK1/2-dependent synthesis of BDNF in the hippocampus. Eur. J. Pharmacol. 2023, 961, 176161. [Google Scholar] [CrossRef] [Scilit]
- Shi, H.; Yu, Y.; Lin, D.; Zheng, P.; Zhang, P.; Hu, M.; Wang, Q.; Pan, W.; Yang, X.; Hu, T.; et al. β-glucan attenuates cognitive impairment via the gut-brain axis in diet-induced obese mice. Microbiome 2020, 8, 143. [Google Scholar] [CrossRef] [Scilit]
- Pan, W.; Jiang, P.; Zhao, J.; Shi, H.; Zhang, P.; Yang, X.; Biazik, J.; Hu, M.; Hua, H.; Ge, X.; et al. β-Glucan from Lentinula edodes prevents cognitive impairments in high-fat diet-induced obese mice: Involvement of colon-brain axis. J. Transl. Med. 2021, 19, 54. [Google Scholar] [CrossRef] [Scilit]
- Weng, M.; Walker, W. The role of gut microbiota in programming the immune phenotype. J. Dev. Orig. Health Dis. 2013, 4, 203–214. [Google Scholar] [CrossRef] [Scilit]
- Canfora, E.E.; Jocken, J.W.; Blaak, E.E. Short-chain fatty acids in control of body weight and insulin sensitivity. Nat. Rev. Endocrinol. 2015, 11, 577–591. [Google Scholar] [CrossRef] [Scilit]
- Smith, P.M.; Howitt, M.R.; Panikov, N.; Michaud, M.; Gallini, C.A.; Bohlooly-Y, M.; Glickman, J.N.; Garrett, W.S. The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic Treg Cell Homeostasis. Science 2013, 341, 569–573. [Google Scholar] [CrossRef] [Scilit]
- Antonson, A.M.; Evans, M.V.; Galley, J.D.; Chen, H.J.; Rajasekera, T.A.; Lammers, S.M.; Hale, V.L.; Bailey, M.T.; Gur, T.L. Unique maternal immune and functional microbial profiles during prenatal stress. Sci. Rep. 2020, 10, 20288. [Google Scholar] [CrossRef] [Scilit]
- Collins, S.M.; Kassam, Z.; Bercik, P. The adoptive transfer of behavioral phenotype via the intestinal microbiota: Experimental evidence and clinical implications. Curr. Opin. Microbiol. 2013, 16, 240–245. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez, A.; Stombaugh, J.; Lozupone, C.; Turnbaugh, P.J.; Gordon, J.I.; Knight, R. The mind-body-microbial continuum. Dialogues Clin. Neurosci. 2011, 13, 55–62. [Google Scholar] [CrossRef] [Scilit]
- Bajaj, J.S.; Ridlon, J.M.; Hylemon, P.B.; Thacker, L.R.; Heuman, D.M.; Smith, S.; Sikaroodi, M.; Gillevet, P.M. Linkage of gut microbiome with cognition in hepatic encephalopathy. Am. J. Physiol.-Gastrointest. Liver Physiol. 2012, 302, G168–G175. [Google Scholar] [CrossRef] [Scilit]
- Lyte, M. Microbial endocrinology in the microbiome-gut-brain axis: How bacterial production and utilization of neurochemicals influence behavior. PLoS Pathog. 2013, 9, e1003726. [Google Scholar] [CrossRef] [Scilit]
- Bruce-Keller, A.J.; Salbaum, J.M.; Luo, M.; Blanchard IV, E.; Taylor, C.M.; Welsh, D.A.; Berthoud, H.-R. Obese-type gut microbiota induce neurobehavioral changes in the absence of obesity. Biol. Psychiatry 2015, 77, 607–615. [Google Scholar] [CrossRef] [Scilit]
- Heijtz, R.D.; Wang, S.; Anuar, F.; Qian, Y.; Björkholm, B.; Samuelsson, A.; Hibberd, M.L.; Forssberg, H.; Pettersson, S. Normal gut microbiota modulates brain development and behavior. Proc. Natl. Acad. Sci. USA 2011, 108, 3047–3052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yura, S.; Itoh, H.; Sagawa, N.; Yamamoto, H.; Masuzaki, H.; Nakao, K.; Kawamura, M.; Takemura, M.; Kakui, K.; Ogawa, Y.; et al. Role of premature leptin surge in obesity resulting from intrauterine undernutrition. Cell Metab. 2005, 1, 371–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stellwagen, D.; Malenka, R.C. Synaptic scaling mediated by glial TNF-α. Nature 2006, 440, 1054–1059. [Google Scholar] [CrossRef] [Scilit]
- Balschun, D.; Wetzel, W.; Del Rey, A.; Pitossi, F.; Schneider, H.; Zuschratter, W.; Besedovsky, H.O. Interleukin-6: A cytokine to forget. FASEB J. 2004, 18, 1788–1790. [Google Scholar] [CrossRef] [Scilit]
- Babu, L.R.; Joy, D. Green extraction techniques, structural analysis and antioxidant activites of β-glucan present in oats. Intl. J. Latest Trends Eng. Technol 2015, 5, 125–135. [Google Scholar]
- Wood, P.; Siddiqui, I.; Paton, D. Extraction of high-viscosity gums from oats. Cereal Chem. 1978, 55, 1038–1049. [Google Scholar]
- Irakli, M.; Biliaderis, C.G.; Izydorczyk, M.S.; Papadoyannis, I.N. Isolation, structural features and rheological properties of water-extractable β-glucans from different Greek barley cultivars. J. Sci. Food Agric. 2004, 84, 1170–1178. [Google Scholar] [CrossRef] [Scilit]
- Skendi, A.; Biliaderis, C.; Lazaridou, A.; Izydorczyk, M. Structure and rheological properties of water soluble β-glucans from oat cultivars of Avena sativa and Avena bysantina. J. Cereal Sci. 2003, 38, 15–31. [Google Scholar] [CrossRef] [Scilit]
- McClear, B.V.; Glennie-Holmes, M. Enzymic quantification of (1→3)(1→4)-β-d-glucan in barley and malt. J. Inst. Brew. 1985, 91, 285–295. [Google Scholar] [CrossRef] [Scilit]
- Motilva, M.-J.; Serra, A.; Borrás, X.; Romero, M.-P.; Domínguez, A.; Labrador, A.; Peiró, L. Adaptation of the standard enzymatic protocol (Megazyme method) to microplaque format for β-(1,3)(1,4)-d-glucan determination in cereal based samples with a wide range of β-glucan content. J. Cereal Sci. 2014, 59, 224–227. [Google Scholar] [CrossRef] [Scilit]
- Olawuyi, I.F.; Lee, W.Y. Structural characterization, functional properties and antioxidant activities of polysaccharide extract obtained from okra leaves (Abelmoschus esculentus). Food Chem. 2021, 354, 129437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kraeuter, A.-K.; Guest, P.C.; Sarnyai, Z. The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. In Pre-Clinical Models: Techniques and Protocols; Guest, P.C., Ed.; Springer: New York, NY, USA, 2019; pp. 105–111. [Google Scholar]
- Reddy, D.; Kulkarni, S. The effects of neurosteroids on acquisition and retention of a modified passive-avoidance learning task in mice. Brain Res. 1998, 791, 108–116. [Google Scholar] [CrossRef] [Scilit]
- Vorhees, C.V.; Williams, M.T. Morris water maze: Procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 2006, 1, 848–858. [Google Scholar] [CrossRef] [Scilit]
- Callahan, B.; McMurdie, P.; Rosen, M.; Han, A.; Johnson, A.J.; Holmes, S. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pruesse, E.; Quast, C.; Knittel, K.; Fuchs, B.M.; Ludwig, W.; Peplies, J.; Glöckner, F.O. SILVA: A comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 2007, 35, 7188–7196. [Google Scholar] [CrossRef] [Scilit]
- Yarza, P.; Yilmaz, P.; Pruesse, E.; Glöckner, F.O.; Ludwig, W.; Schleifer, K.-H.; Whitman, W.B.; Euzéby, J.; Amann, R.; Rosselló-Móra, R. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences. Nat. Rev. Microbiol. 2014, 12, 635–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, D590–D596. [Google Scholar] [CrossRef] [Scilit]
- Glöckner, F.O.; Yilmaz, P.; Quast, C.; Gerken, J.; Beccati, A.; Ciuprina, A.; Bruns, G.; Yarza, P.; Peplies, J.; Westram, R.; et al. 25 years of serving the community with ribosomal RNA gene reference databases and tools. J. Biotechnol. 2017, 261, 169–176. [Google Scholar] [CrossRef] [Scilit]
- McMurdie, P.J.; Holmes, S. phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data. PLoS ONE 2013, 8, e61217. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef] [Scilit]
- Davarinejad, H. Quantifications of western blots with ImageJ; University of York: York, UK, 2015. [Google Scholar]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Majumdar, A.; Gil-González, A.B.; Barjuan Grau, A.; Sardari, R.R.R.; Larsson, O.; Thyagarajan, A.; Hansson, A.; Hernández-Hernández, O.; Olsson, O.; Zambrano, J.A. Macromolecular characterization of high β-glucan oat lines. Heliyon 2024, 10, e24552. [Google Scholar] [CrossRef] [Scilit]
- Marconi, O.; Tomasi, I.; Dionisio, L.; Perretti, G.; Fantozzi, P. Effects of malting on molecular weight distribution and content of water-extractable β-glucans in barley. Food Res. Int. 2014, 64, 677–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Z.; Zhang, L.; Duan, X.; Liao, Z.; Ding, H.; Cheung, P.C. Novel highly branched water-soluble heteropolysaccharides as immunopotentiators to inhibit S-180 tumor cell growth in BALB/c mice. Carbohydr. Polym. 2012, 87, 427–434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Q.; Cai, X.; Zhu, Y.; Hu, Z.; Wei, Y.; Dang, Q.; Zhang, Y.; Zhao, X.; Jiang, X.; Yu, H. Oat β-glucan supplementation pre-and during pregnancy alleviates fetal intestinal immunity development damaged by gestational diabetes in rats. Food Funct. 2023, 14, 8453–8466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, L.; Liu, L.; Zhou, W.; Yang, C.; Mai, G.; Li, H.; Chen, Y. Gut microbiota-derived butyrate regulates gut mucus barrier repair by activating the macrophage/WNT/ERK signaling pathway. Clin. Sci. 2022, 136, 291–307. [Google Scholar] [CrossRef] [Scilit]
- O’Shea, C.; Sweeney, T.; Lynch, M.; Gahan, D.; Flynn, B.; O’Doherty, J. The effect of introducing purified β-glucans to a wheat-based diet on total tract digestibility and gaseous manure emissions from pigs as compared with consumption of a β-glucan-rich, barley-based diet. Anim. Feed Sci. Technol. 2011, 165, 95–104. [Google Scholar] [CrossRef] [Scilit]
- David, L.A.; Maurice, C.F.; Carmody, R.N.; Gootenberg, D.B.; Button, J.E.; Wolfe, B.E.; Ling, A.V.; Devlin, A.S.; Varma, Y.; Fischbach, M.A. Diet rapidly and reproducibly alters the human gut microbiome. Nature 2014, 505, 559–563. [Google Scholar] [CrossRef] [Scilit]
- Keesing, F.; Belden, L.K.; Daszak, P.; Dobson, A.; Harvell, C.D.; Holt, R.D.; Hudson, P.; Jolles, A.; Jones, K.E.; Mitchell, C.E. Impacts of biodiversity on the emergence and transmission of infectious diseases. Nature 2010, 468, 647–652. [Google Scholar] [CrossRef] [Scilit]
- Beta-diversity distance matrices for microbiome sample size and power calculations—How to obtain good estimates. Comput. Struct. Biotechnol. J. 2022, 20, 2259–2267. [CrossRef] [Scilit]
- Xiao, X.; Hu, X.; Yao, J.; Cao, W.; Zou, Z.; Wang, L.; Qin, H.; Zhong, D.; Li, Y.; Xue, P.; et al. The role of short-chain fatty acids in inflammatory skin diseases. Front. Microbiol. 2023, 13, 1083432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vacca, M.; Celano, G.; Calabrese, F.M.; Portincasa, P.; Gobbetti, M.; De Angelis, M. The Controversial Role of Human Gut Lachnospiraceae. Microorganisms 2020, 8, 573. [Google Scholar] [CrossRef] [Scilit]
- Oren, A.; Garrity, G.M. Valid publication of the names of forty-two phyla of prokaryotes. Int. J. Syst. Evol. Microbiol. 2021, 71, 005056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rizzatti, G.; Lopetuso, L.R.; Gibiino, G.; Binda, C.; Gasbarrini, A. Proteobacteria: A Common Factor in Human Diseases. BioMed Res. Int. 2017, 2017, 9351507. [Google Scholar] [CrossRef] [Scilit]
- Bian, X.; Wu, W.; Yang, L.; Lv, L.; Wang, Q.; Li, Y.; Ye, J.; Fang, D.; Wu, J.; Jiang, X.; et al. Administration of Akkermansia muciniphila Ameliorates Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice. Front. Microbiol. 2019, 10, 2259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ottman, N.; Reunanen, J.; Meijerink, M.; Pietilä, T.E.; Kainulainen, V.; Klievink, J.; Huuskonen, L.; Aalvink, S.; Skurnik, M.; Boeren, S.; et al. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function. PLoS ONE 2017, 12, e0173004. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Chen, B.; Zhang, X.; Akbar, M.T.; Wu, T.; Zhang, Y.; Zhi, L.; Shen, Q. Exploration of the Muribaculaceae Family in the Gut Microbiota: Diversity, Metabolism, and Function. Nutrients 2024, 16, 2660. [Google Scholar] [CrossRef] [Scilit]
- He, K.; Nie, L.; Ali, T.; Liu, Z.; Li, W.; Gao, R.; Zhang, Z.; Liu, J.; Dai, Z.; Xie, Y.; et al. Adiponectin deficiency accelerates brain aging via mitochondria-associated neuroinflammation. Immun. Ageing 2023, 20, 15. [Google Scholar] [CrossRef] [Scilit]
- Valleau, J.C.; Sullivan, E.L. The impact of leptin on perinatal development and psychopathology. J. Chem. Neuroanat. 2014, 61–62, 221–232. [Google Scholar] [CrossRef] [Scilit]
- Majerczyk, D.; Ayad, E.G.; Brewton, K.L.; Saing, P.; Hart, P.C. Systemic maternal inflammation promotes ASD via IL-6 and IFN-γ. Biosci. Rep. 2022, 42, BSR20220713. [Google Scholar] [CrossRef] [Scilit]
- Pang, R.; Mujuni, B.M.; Martinello, K.A.; Webb, E.L.; Nalwoga, A.; Ssekyewa, J.; Musoke, M.; Kurinczuk, J.J.; Sewegaba, M.; Cowan, F.M.; et al. Elevated serum IL-10 is associated with severity of neonatal encephalopathy and adverse early childhood outcomes. Pediatr. Res. 2022, 92, 180–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sweetman, D.U.; Strickland, T.; Melo, A.M.; Kelly, L.A.; Onwuneme, C.; Watson, W.R.; Murphy, J.F.A.; Slevin, M.; Donoghue, V.; O’Neill, A.; et al. Neonatal Encephalopathy Is Associated With Altered IL-8 and GM-CSF Which Correlates with Outcomes. Front. Pediatr. 2021, 8, 556216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saito, M.; Kiyokawa, N.; Taguchi, T.; Suzuki, K.; Sekino, T.; Mimori, K.; Suzuki, T.; Nakajima, H.; Katagiri, Y.U.; Fujimura, J.; et al. Granulocyte colony-stimulating factor directly affects human monocytes and modulates cytokine secretion. Exp. Hematol. 2002, 30, 1115–1123. [Google Scholar] [CrossRef] [Scilit]
- Smith, T.; Sloboda, D.M.; Saffery, R.; Joo, E.; Vickers, M.H. Maternal nutritional history modulates the hepatic IGF–IGFBP axis in adult male rat offspring. Endocrine 2014, 46, 70–82. [Google Scholar] [CrossRef] [Scilit]
- Ambrose, N.; Rodriguez, M.; Waters, K.A.; Machaalani, R. Microglia in the human infant brain and factors that affect expression. Brain Behav. Immun.-Health 2020, 7, 100117. [Google Scholar] [CrossRef] [Scilit]
- Keever-Keigher, M.R.; Zhang, P.; Bolt, C.R.; Rymut, H.E.; Antonson, A.M.; Caputo, M.P.; Houser, A.K.; Hernandez, A.G.; Southey, B.R.; Rund, L.A.; et al. Interacting impact of maternal inflammatory response and stress on the amygdala transcriptome of pigs. G3 Genes|Genomes|Genet. 2021, 11, jkab113. [Google Scholar] [CrossRef] [Scilit]
- Andersson, E.; Tryggvason, U.; Deng, Q.; Friling, S.; Alekseenko, Z.; Robert, B.; Perlmann, T.; Ericson, J. Identification of intrinsic determinants of midbrain dopamine neurons. Cell 2006, 124, 393–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoekstra, E.J.; von Oerthel, L.; van der Linden, A.J.; Schellevis, R.D.; Scheppink, G.; Holstege, F.C.; Groot-Koerkamp, M.J.; van der Heide, L.P.; Smidt, M.P. Lmx1a is an activator of Rgs4 and Grb10 and is responsible for the correct specification of rostral and medial md DA neurons. Eur. J. Neurosci. 2013, 37, 23–32. [Google Scholar] [CrossRef] [Scilit]
- Ko, W.K.D.; Martin-Negrier, M.-L.; Bezard, E.; Crossman, A.R.; Ravenscroft, P. RGS4 is involved in the generation of abnormal involuntary movements in the unilateral 6-OHDA-lesioned rat model of Parkinson’s disease. Neurobiol. Dis. 2014, 70, 138–148. [Google Scholar] [CrossRef] [Scilit]
- Sugiyama, S.; Di Nardo, A.A.; Aizawa, S.; Matsuo, I.; Volovitch, M.; Prochiantz, A.; Hensch, T.K. Experience-dependent transfer of Otx2 homeoprotein into the visual cortex activates postnatal plasticity. Cell 2008, 134, 508–520. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.H.C.; Bernard, C.; Ye, Z.; Acampora, D.; Simeone, A.; Prochiantz, A.; Di Nardo, A.A.; Hensch, T.K. Genetic Otx2 mis-localization delays critical period plasticity across brain regions. Mol. Psychiatry 2017, 22, 680–688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vincent, C.; Gilabert-Juan, J.; Gibel-Russo, R.; Alvarez-Fischer, D.; Krebs, M.-O.; Le Pen, G.; Prochiantz, A.; Di Nardo, A.A. Non-cell-autonomous OTX2 transcription factor regulates anxiety-related behavior in the mouse. Mol. Psychiatry 2021, 26, 6469–6480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.Y.; Ho, H.; Kim, N.; Liu, J.; Tu, C.-L.; Yenari, M.A.; Chang, W. Calcium-sensing receptor (CaSR) as a novel target for ischemic neuroprotection. Ann. Clin. Transl. Neurol. 2014, 1, 851–866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bittencourt, J.C.; Presse, F.; Arias, C.; Peto, C.; Vaughan, J.; Nahon, J.L.; Vale, W.; Sawchenko, P. The melanin-concentrating hormone system of the rat brain: An immuno-and hybridization histochemical characterization. J. Comp. Neurol. 1992, 319, 218–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nair, S.G.; Adams-Deutsch, T.; Pickens, C.L.; Smith, D.G.; Shaham, Y. Effects of the MCH1 receptor antagonist SNAP 94847 on high-fat food-reinforced operant responding and reinstatement of food seeking in rats. Psychopharmacology 2009, 205, 129–140. [Google Scholar] [CrossRef] [Scilit]
- Mul, J.D.; Yi, C.-X.; van den Berg, S.A.A.; Ruiter, M.; Toonen, P.W.; van der Elst, M.C.J.; Voshol, P.J.; Ellenbroek, B.A.; Kalsbeek, A.; la Fleur, S.E.; et al. Pmch expression during early development is critical for normal energy homeostasis. Am. J. Physiol.-Endocrinol. Metab. 2009, 298, E477–E488. [Google Scholar] [CrossRef] [Scilit]
- Noble, E.E.; Billington, C.J.; Kotz, C.M.; Wang, C. The lighter side of BDNF. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2011, 300, R1053–R1069. [Google Scholar] [CrossRef] [Scilit]
- Lu, B.; Nagappan, G.; Lu, Y. BDNF and synaptic plasticity, cognitive function, and dysfunction. In Neurotrophic Factors; Springer: Berlin/Heidelberg, Germany, 2014; pp. 223–250. [Google Scholar]
- Lu, H.; Park, H.; Poo, M.-M. Spike-timing-dependent BDNF secretion and synaptic plasticity. Philos. Trans. R. Soc. B Biol. Sci. 2014, 369, 20130132. [Google Scholar] [CrossRef] [Scilit]
- Olugbemide, A.S.; Ben-Azu, B.; Bakre, A.G.; Ajayi, A.M.; Femi-Akinlosotu, O.; Umukoro, S. Naringenin improves depressive- and anxiety-like behaviors in mice exposed to repeated hypoxic stress through modulation of oxido-inflammatory mediators and NF-kB/BDNF expressions. Brain Res. Bull. 2021, 169, 214–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fadó, R.; Molins, A.; Rojas, R.; Casals, N. Feeding the Brain: Effect of Nutrients on Cognition, Synaptic Function, and AMPA Receptors. Nutrients 2022, 14, 4137. [Google Scholar] [CrossRef] [Scilit]
- Baj, A.; Moro, E.; Bistoletti, M.; Orlandi, V.; Crema, F.; Giaroni, C. Glutamatergic Signaling along The Microbiota-Gut-Brain Axis. Int. J. Mol. Sci. 2019, 20, 1482. [Google Scholar] [CrossRef] [Scilit]
- Ramsey, A.M.; Tang, A.-H.; LeGates, T.A.; Gou, X.-Z.; Carbone, B.E.; Thompson, S.M.; Biederer, T.; Blanpied, T.A. Subsynaptic positioning of AMPARs by LRRTM2 controls synaptic strength. Sci. Adv. 2021, 7, eabf3126. [Google Scholar] [CrossRef] [Scilit]
- Terashima, A.; Cotton, L.; Dev, K.K.; Meyer, G.; Zaman, S.; Duprat, F.; Henley, J.M.; Collingridge, G.L.; Isaac, J.T.R. Regulation of Synaptic Strength and AMPA Receptor Subunit Composition by PICK1. J. Neurosci. 2004, 24, 5381–5390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Derkach, V.A.; Oh, M.C.; Guire, E.S.; Soderling, T.R. Regulatory mechanisms of AMPA receptors in synaptic plasticity. Nat. Rev. Neurosci. 2007, 8, 101–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tao, X.; Finkbeiner, S.; Arnold, D.B.; Shaywitz, A.J.; Greenberg, M.E. Ca2+ influx regulates BDNF transcription by a CREB family transcription factor-dependent mechanism. Neuron 1998, 20, 709–726. [Google Scholar] [CrossRef] [Scilit]
- Marini, A.M.; Jiang, X.; Wu, X.; Tian, F.; Zhu, D.; Okagaki, P.; Lipsky, R.H. Role of brain-derived neurotrophic factor and NF-κB in neuronal plasticity and survival: From genes to phenotype. Restor. Neurol. Neurosci. 2004, 22, 121–130. [Google Scholar] [PubMed]
- Esvald, E.-E.; Tuvikene, J.; Moistus, A.; Rannaste, K.; Kõomägi, S.; Timmusk, T. Differential Regulation of the BDNF Gene in Cortical and Hippocampal Neurons. J. Neurosci. 2022, 42, 9110. [Google Scholar] [CrossRef] [Scilit]
- Miranda, M.; Morici, J.F.; Zanoni, M.B.; Bekinschtein, P. Brain-Derived Neurotrophic Factor: A Key Molecule for Memory in the Healthy and the Pathological Brain. Front. Cell. Neurosci. 2019, 13, 363. [Google Scholar] [CrossRef] [Scilit]
- Peng, X.; Li, C.; Yu, W.; Liu, S.; Cong, Y.; Fan, G.; Qi, S. Propofol attenuates hypoxia-induced inflammation in BV2 microglia by inhibiting oxidative stress and NF-κB/Hif-1α signaling. BioMed Res. Int. 2020, 2020, 8978704. [Google Scholar] [CrossRef] [Scilit]
- Oladapo, O.M.; Ben-Azu, B.; Ajayi, A.M.; Emokpae, O.; Eneni, A.-E.O.; Omogbiya, I.A.; Iwalewa, E.O. Naringin confers protection against psychosocial defeat stress-induced neurobehavioral deficits in mice: Involvement of glutamic acid decarboxylase isoform-67, oxido-nitrergic stress, and neuroinflammatory mechanisms. J. Mol. Neurosci. 2021, 71, 431–445. [Google Scholar] [CrossRef] [Scilit]
- Taft, C.E.; Turrigiano, G.G. PSD-95 promotes the stabilization of young synaptic contacts. Philos. Trans. R. Soc. B Biol. Sci. 2014, 369, 20130134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tierney, A.L.; Nelson III, C.A. Brain development and the role of experience in the early years. Zero Three 2009, 30, 9. [Google Scholar] [PubMed]
- Takouda, J.; Katada, S.; Nakashima, K. Emerging mechanisms underlying astrogenesis in the developing mammalian brain. Proc. Jpn. Acad. Ser. B 2017, 93, 386–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Markey, K.M.; Saunders, J.C.; Smuts, J.; von Reyn, C.R.; Garcia, A.D.R. Astrocyte development—More questions than answers. Front. Cell Dev. Biol. 2023, 11, 1063843. [Google Scholar] [CrossRef] [Scilit]
- Chalmers, N.; Masouti, E.; Beckervordersandforth, R. Astrocytes in the adult dentate gyrus—Balance between adult and developmental tasks. Mol. Psychiatry 2024, 29, 982–991. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Wang, Z. The Impact of Microglia on Neurodevelopment and Brain Function in Autism. Biomedicines 2024, 12, 210. [Google Scholar] [CrossRef] [Scilit]
- Marsden, W. Synaptic plasticity in depression: Molecular, cellular and functional correlates. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2013, 43, 168–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skendi, A.; Papageorgiou, M. Introduction in wheat and breadmaking. In Trends in Wheat and Bread Making; Academic Press: Cambridge, MA, USA, 2021; pp. 1–27. [Google Scholar]
- Barker, D.J.P. The developmental origins of adult disease. J. Am. Coll. Nutr. 2004, 23, 588S–595S. [Google Scholar] [CrossRef] [Scilit]
- Nilsen, M.; Madelen Saunders, C.; Leena Angell, I.; Arntzen, M.Ø.; Lødrup Carlsen, K.C.; Carlsen, K.-H.; Haugen, G.; Heldal Hagen, L.; Carlsen, M.H.; Hedlin, G. Butyrate levels in the transition from an infant-to an adult-like gut microbiota correlate with bacterial networks associated with Eubacterium rectale and Ruminococcus gnavus. Genes 2020, 11, 1245. [Google Scholar] [CrossRef] [Scilit]
- Gao, Z.; Yin, J.; Zhang, J.; Ward, R.E.; Martin, R.J.; Lefevre, M.; Cefalu, W.T.; Ye, J. Butyrate improves insulin sensitivity and increases energy expenditure in mice. Diabetes 2009, 58, 1509–1517. [Google Scholar] [CrossRef] [Scilit]
- Koren, O.; Goodrich, J.K.; Cullender, T.C.; Spor, A.; Laitinen, K.; Bäckhed, H.K.; Gonzalez, A.; Werner, J.J.; Angenent, L.T.; Knight, R.; et al. Host Remodeling of the Gut Microbiome and Metabolic Changes during Pregnancy. Cell 2012, 150, 470–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanna, S.; van Zuydam, N.R.; Mahajan, A.; Kurilshikov, A.; Vich Vila, A.; Võsa, U.; Mujagic, Z.; Masclee, A.A.M.; Jonkers, D.M.A.E.; Oosting, M.; et al. Causal relationships among the gut microbiome, short-chain fatty acids and metabolic diseases. Nat. Genet. 2019, 51, 600–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pingitore, A.; Chambers, E.S.; Hill, T.; Maldonado, I.R.; Liu, B.; Bewick, G.; Morrison, D.J.; Preston, T.; Wallis, G.A.; Tedford, C. The diet-derived short chain fatty acid propionate improves beta-cell function in humans and stimulates insulin secretion from human islets in vitro. Diabetes Obes. Metab. 2017, 19, 257–265. [Google Scholar] [CrossRef] [Scilit]
- Behall, K.M.; Scholfield, D.J.; Hallfrisch, J.G.; Liljeberg-Elmstahl, H.G.M. Consumption of Both Resistant Starch and β-Glucan Improves Postprandial Plasma Glucose and Insulin in Women. Diabetes Care 2006, 29, 976–981. [Google Scholar] [CrossRef]
- Matamoros, S.; Gras-Leguen, C.; Le Vacon, F.; Potel, G.; de La Cochetiere, M.-F. Development of intestinal microbiota in infants and its impact on health. Trends Microbiol. 2013, 21, 167–173. [Google Scholar] [CrossRef] [Scilit]
- Rehbinder, E.M.; Carlsen, K.C.L.; Staff, A.C.; Angell, I.L.; Landrø, L.; Hilde, K.; Gaustad, P.; Rudi, K. Is amniotic fluid of women with uncomplicated term pregnancies free of bacteria? Am. J. Obstet. Gynecol. 2018, 219, 289.e1–289.e12. [Google Scholar] [CrossRef] [Scilit]
- Ng, S.; Hart, A.; Kamm, M.; Stagg, A.; Knight, S.C. Mechanisms of action of probiotics: Recent advances. Inflamm. Bowel Dis. 2009, 15, 300–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mu, Q.; Kirby, J.; Reilly, C.M.; Luo, X.M. Leaky gut as a danger signal for autoimmune diseases. Front. Immunol. 2017, 8, 598. [Google Scholar] [CrossRef] [Scilit]
- Vélez, M.P.; De Keersmaecker, S.C.; Vanderleyden, J. Adherence factors of Lactobacillus in the human gastrointestinal tract. FEMS Microbiol. Lett. 2007, 276, 140–148. [Google Scholar] [CrossRef] [Scilit]
- Desai, M.S.; Seekatz, A.M.; Koropatkin, N.M.; Kamada, N.; Hickey, C.A.; Wolter, M.; Pudlo, N.A.; Kitamoto, S.; Terrapon, N.; Muller, A.; et al. A Dietary Fiber-Deprived Gut Microbiota Degrades the Colonic Mucus Barrier and Enhances Pathogen Susceptibility. Cell 2016, 167, 1339–1353. [Google Scholar] [CrossRef] [Scilit]
- Derrien, M.; Van Baarlen, P.; Hooiveld, G.; Norin, E.; Müller, M.; de Vos, W.M. Modulation of mucosal immune response, tolerance, and proliferation in mice colonized by the mucin-degrader Akkermansia muciniphila. Front. Microbiol. 2011, 2, 166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Derrien, M.; Vaughan, E.E.; Plugge, C.M.; de Vos, W.M. Akkermansia muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. Int. J. Syst. Evol. Microbiol. 2004, 54, 1469–1476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pereira, F.C.; Wasmund, K.; Cobankovic, I.; Jehmlich, N.; Herbold, C.W.; Lee, K.S.; Sziranyi, B.; Vesely, C.; Decker, T.; Stocker, R. Rational design of a microbial consortium of mucosal sugar utilizers reduces Clostridiodes difficile colonization. Nat. Commun. 2020, 11, 5104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, M.; Yang, Z.; Wu, G.; Xu, F.; Zhang, J.; Luo, X.; Ma, Y.; Pang, H.; Duan, Y.; Chen, J. Effects of Probiotic-Fermented Feed on the Growth Profile, Immune Functions, and Intestinal Microbiota of Bamei Piglets. Animals 2024, 14, 647. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Zhang, S.; Wang, Y.; Bian, H.; Yu, S.; Huang, L.; Ma, W. Complex probiotics alleviate ampicillin-induced antibiotic-associated diarrhea in mice. Front. Microbiol. 2023, 14, 1156058. [Google Scholar] [CrossRef] [Scilit]
- Gao, Y.; Liu, Y.; Ma, F.; Sun, M.; Song, Y.; Xu, D.; Mu, G.; Tuo, Y. Lactobacillus plantarum Y44 alleviates oxidative stress by regulating gut microbiota and colonic barrier function in Balb/C mice with subcutaneous d-galactose injection. Food Funct. 2021, 12, 373–386. [Google Scholar] [CrossRef] [Scilit]
- Mariat, D.; Firmesse, O.; Levenez, F.; Guimarăes, V.; Sokol, H.; Doré, J.; Corthier, G.; Furet, J. The Firmicutes/Bacteroidetes ratio of the human microbiota changes with age. BMC Microbiol. 2009, 9, 123. [Google Scholar] [CrossRef] [Scilit]
- Xavier, S.; Soch, A.; Younesi, S.; Malik, S.; Spencer, S.J.; Sominsky, L. Maternal diet before and during pregnancy modulates microglial activation and neurogenesis in the postpartum rat brain. Brain Behav. Immun. 2021, 98, 185–197. [Google Scholar] [CrossRef] [Scilit]
- Altınöz, S.; Micili, S.C.; Soy, S.; Engür, D.; Baysal, B.; Kumral, A. Impact of Maternal Ketogenic Diet on NLRP3 Inflammasome Response in the Offspring Brain. Nutrients 2023, 15, 1994. [Google Scholar] [CrossRef] [Scilit]
- Aziz, T.; Hussain, N.; Hameed, Z.; Lin, L. Elucidating the role of diet in maintaining gut health to reduce the risk of obesity, cardiovascular and other age-related inflammatory diseases: Recent challenges and future recommendations. Gut Microbes 2024, 16, 2297864. [Google Scholar] [CrossRef] [Scilit]
- Nakajima, A.; Kaga, N.; Nakanishi, Y.; Ohno, H.; Miyamoto, J.; Kimura, I.; Hori, S.; Sasaki, T.; Hiramatsu, K.; Okumura, K.; et al. Maternal High Fiber Diet during Pregnancy and Lactation Influences Regulatory T Cell Differentiation in Offspring in Mice. J. Immunol. 2017, 199, 3516–3524. [Google Scholar] [CrossRef] [Scilit] [PubMed]












| Gene | Forward (5′-3′) | Revere (5′-3′) | Tm Forward (°C) | Tm Reverse (°C) |
|---|---|---|---|---|
| GluA-1 | AAGAGAAACAGAGAACCT | GATGTACGGCATATTCCTT | 50.9 | 51.2 |
| GluA-2 | TTTGTCCATGCTCTACTT | ATCTGTATGGTGTTAGAAGA | 49.5 | 50.0 |
| HO-1 | CAAGCAGAACCCAGTCTATG | GCGTGCAAGGGATGATT | 54.9 | 54.2 |
| Nqo1 | GACAACGGTCCTTTCCAGAAT | CTCTGAATCGGCCAGAGAATG | 57.1 | 57.6 |
| Nrf2 | TTCCTCTGTCCTTTCCAGAAT | GCTCTTCCATTTCCGAGTCAC | 61.4 | 60.5 |
| Gapdh | TCACCACCACCATGGAGAAGGC | GCTAAGCAGTTGGTGGTGCA | 58.3 | 60.2 |
| Muc2 | CCTTAGCCAAGGGCTCGGAA | GGCCCGAGAGTAGACCTTGG | 60.9 | 60.7 |
| Occludin | ATGTCCGGCGATGCTCTC | TTTGGCTGCTCTTGGGTCTGT | 61.2 | 61.1 |
| ZO-1 | ACAGGCCATTACGAGCCTCT | GGAGGCTGTGGTTTGGTAGC | ||
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | 59.0 | 58.5 |
| Sample | Purity (Grams of β-Glucan/100 g Dried Sample) 1 |
|---|---|
| Megazyme™ standard Oat flour | 6.71 ± 2.9 |
| Solubilized Oat β-glucan | 5.51 ± 2.5 |
| Solubilized Barley β-glucan | 3.56 ± 2.5 |
| Solubilized Sorghum β-glucan | 0.81 ± 2.7 |
| Solubilized Millet β-glucan | 0.63 ± 2.7 |
| Solubilized AOB β-glucan extract powder | 9.76 ± 2.3 |
| Purified AOB β-glucan extract powder | 66.98 ± 2.9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Katimbwa, D.A.; Kim, Y.; Kim, M.J.; Jeong, M.; Lim, J. Solubilized β-Glucan Supplementation in C57BL/6J Mice Dams Augments Neurodevelopment and Cognition in the Offspring Driven by Gut Microbiome Remodeling. Foods 2024, 13, 3102. https://doi.org/10.3390/foods13193102
Katimbwa DA, Kim Y, Kim MJ, Jeong M, Lim J. Solubilized β-Glucan Supplementation in C57BL/6J Mice Dams Augments Neurodevelopment and Cognition in the Offspring Driven by Gut Microbiome Remodeling. Foods. 2024; 13(19):3102. https://doi.org/10.3390/foods13193102
Chicago/Turabian StyleKatimbwa, Dorsilla A., Yoonsu Kim, Min Jeong Kim, Minsoo Jeong, and Jinkyu Lim. 2024. "Solubilized β-Glucan Supplementation in C57BL/6J Mice Dams Augments Neurodevelopment and Cognition in the Offspring Driven by Gut Microbiome Remodeling" Foods 13, no. 19: 3102. https://doi.org/10.3390/foods13193102
APA StyleKatimbwa, D. A., Kim, Y., Kim, M. J., Jeong, M., & Lim, J. (2024). Solubilized β-Glucan Supplementation in C57BL/6J Mice Dams Augments Neurodevelopment and Cognition in the Offspring Driven by Gut Microbiome Remodeling. Foods, 13(19), 3102. https://doi.org/10.3390/foods13193102
