Next Article in Journal
Sequence Segmentation of Nematodes in Atlantic Cod with Multispectral Imaging Data
Previous Article in Journal
The Consumption of the Fibrous Fraction of Solanum lycocarpum St. Hil. Does Not Preserve the Intestinal Mucosa in TNBS-Induced Rats
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence, Molecular Serogroups, Antimicrobial Susceptibility and Identification by MALDI-TOF MS of Listeria monocytogenes Isolated from RTE Meat Products in Southern Poland

by
Renata Pyz-Łukasik
1,*,
Anna Piróg-Komorowska
2 and
Agata Policht
2
1
Department of Food Hygiene of Animal Origin, Faculty of Veterinary Medicine, University of Life Sciences in Lublin, Akademicka, 12, 20-033 Lublin, Poland
2
Department of Veterinary Hygiene, Provincial Veterinary Inspectorate in Krakow, Brodowicza, 13b, 30-965 Kraków 69, Poland
*
Author to whom correspondence should be addressed.
Foods 2024, 13(18), 2950; https://doi.org/10.3390/foods13182950
Submission received: 18 August 2024 / Revised: 9 September 2024 / Accepted: 12 September 2024 / Published: 18 September 2024
(This article belongs to the Section Food Microbiology)

Abstract

L. monocytogenes is considered one of the most dangerous foodborne pathogens. This study aimed to determine the occurrence of L. monocytogenes in RTE meat products from southern Poland, including serogroups and antimicrobial susceptibility, and to assess the usefulness of MALDI-TOF MS as a tool for identifying L. monocytogenes. A total of 848 production batches of RTE meat products were analyzed for L. monocytogenes. All L. monocytogenes isolates were serotyped using the multiplex PCR method, tested for antimicrobial susceptibility using the disk diffusion method and identified using the MALDI-TOF MS method. L. monocytogenes was detected in 52/848 batches of RTE meat products (6.13%). The isolates belonged to four serogroups: 17/52 (33%) isolates to IVb; 15/52 (29%) isolates to IIa; 10/52 (19%) isolates to IIc and 10/52 (19%) isolates to IIb. All isolates (52/52) showed susceptibility to the tested antimicrobials. Using MALDI-TOF MS, 10/52 isolates (19.2%) were identified at the level of secure genus identification, probable species identification; 37/52 isolates (71.2%) were identified at the level of probable genus identification; 3/52 isolates (5.8%) were incorrectly identified as L. innocua; and 2/52 isolates (3.8%) were not identified. The occurrence of L. monocytogenes in RTE meat products was low. Almost half of the analyzed isolates were L. monocytogenes of serogroups, which are most often associated with listeriosis in humans in Poland. All isolates showed susceptibility to five commonly used antimicrobials for treating listeriosis. The use of MALDI-TOF MS as a tool for the identification of L. monocytogenes indicated its limitations related to the insufficient representation of the pathogen in the reference database.

1. Introduction

Listeria monocytogenes is a foodborne pathogen responsible for listeriosis in humans. Surveillance of listeriosis in humans focuses on invasive forms of the disease, which take a severe, life-threatening course and most often manifest themselves as sepsis, meningitis or spontaneous abortion [1]. Invasive listeriosis primarily affects elderly people, pregnant women, newborns and individuals with compromised immune systems [1]. However, the infection may also occur in people with no known predisposing factors [2]. According to the European Food Safety Authority, the incidence rate of listeriosis in the population is low (0.62 cases per 100,000) but it is associated with high rates of hospitalization (96%) and mortality (18%), making L. monocytogenes one of the most dangerous foodborne pathogens [1]. Data on reported listeriosis cases in 2023 in Poland [https://www.pzh.gov.pl, accessed on 6 September 2024] showed that the incidence rate is comparable to the estimated European level (243 cases; 0.64 per 100,000). The data also indicated an increase in the number of reported cases compared to the previous year (142 cases; 0.38 per 100,000). Furthermore, the analysis of epidemiological data on listeriosis reported in the years 2012–2021 showed that the median incidence was 52.2% higher compared to the previous 5-year period (2007–2011) (0.23 and 0.11 cases per 100,000, respectively) [3]. In the analyzed period, the vast majority of voivodeships in the country reported cases of listeriosis with a hospitalization rate of 97.1% (870/896) and mortality of 8.33–20.83% (in 2020–2021) [3]. In Poland, no listeriosis outbreaks have been reported to date [1,3].
Listeriosis is frequently associated with consuming contaminated ready-to-eat (RTE) food products, with RTE meat products often identified as vehicles of infection [1,4]. There is significant evidence of a high variability in the virulence potential and pathogenicity of L. monocytogenes isolates [5,6]. Epidemiological data combined with serotyping results indicate that four molecular serogroups, including IVb (comprising serotypes 4b, 4d and 4e), IIa (comprising serotypes 1/2a and 3a), IIb (comprising serotypes 1/2b, 3b and 7) and IIc (comprising serotypes 1/2c and 3c) were associated with cases of invasive listeriosis in Poland [7]. Of these serogroups, serogroups IVb and IIa were responsible for 90% of the infections, with serogroup IVb responsible for 55.8% of them (n = 192/344) [7]. Identifying potential food vehicles of L. monocytogenes and the typing of isolates provides information for assessing the risk of exposure to L. monocytogenes.
Antimicrobial resistance in pathogenic bacteria is an increasing problem on a global scale [8]. The main strategy for treating infections caused by L. monocytogenes is the use of antimicrobials [2]. Resistance in L. monocytogenes isolates recovered from various sources, i.e., humans, food and food processing environments, has been reported worldwide [4,9,10,11]. Concerns regarding antimicrobial resistance in L. monocytogenes have been increasing for several years and are the subject of research at national and international levels [4,12,13].
MALDI-TOF MS (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry) is standard for identifying pathogenic bacteria within clinical laboratories [14,15]. However, despite its demonstrated efficacy in clinical laboratories, substantial utilization of this method has not been found within food laboratories thus far. MALDI-TOF MS identification is valued for its simplicity, rapidity and cost-effectiveness [14], underscoring its suitability for high-throughput sample applications in routine food control within the food industry.
The current study aimed to determine the occurrence of L. monocytogenes in RTE meat products from southern Poland, including serogroups and antimicrobial susceptibility, and to assess the usefulness of MALDI-TOF MS for identifying L. monocytogenes.

2. Materials and Methods

2.1. Food Samples

Samples were collected from meat processing plants in southern Poland as part of the food safety surveillance program from January 2017 to December 2018. A total of 848 production batches of RTE meat products were analyzed for L. monocytogenes according to PN-EN ISO 11290-1:1999/A1:2005 and PN-EN ISO 11290-1: 2017-7 [16,17]. The confirmed L. monocytogenes isolates were stored in a brain–heart infusion broth with 15% glycerol at −80 °C until the current analyses. In the present study, these isolates were subject to re-identification according to the procedure described below.

2.2. Multiplex PCR

The isolates were cultured on TSYEA medium at 37 ± 1 °C for 18–24 h (Biomaxima, Lublin, Poland). DNA was isolated using the Genomic Mini kit (A & A Biotechnology, Gdańsk, Poland) according to the protocol provided by the manufacturer with the modification of adding 20 µL of lysozyme (10 mg/mL; Merck Sigma-Aldrich, St. Louis, MO, USA) and incubation of the samples for 30 min at 37 ± 1 °C. The identification and classification of L. monocytogenes to molecular serogroups was determined with multiplex PCR in accordance with Doumith et al. [18] using primers and the conditions presented in Table 1. The PCR reaction mixture consisted of 5 µL of a nucleotide mixture at a concentration of 2 mM each; 6 µL of a MgCl2 solution at a concentration of 25 mM; 5 µL of an enzyme buffer for PCR; 0.5 µL of DNA primers (Genomed, Warszawa, Poland) for the following target genes corresponding to specific serogroups: prs and lmo0737 for IIa, prs and ORF2819 for IIb, prs, lmo1118 and lmo0737 for IIc, and prs, ORF2110 and ORF2819 for IVb (concentration of 10 µM each); 2 µL of thermostable Taq DNA polymerase (concentration of 1 U/µL); and 45.0 µL of DNase- and RNase-free water to obtain the final volume. Moreover, 5 µL of DNA extracted from L. monocytogenes was added to the reaction mixture. PCR reagents originated from Thermo Fisher Scientific (Waltham, MA, USA). Gene amplification was carried out in a thermal cycler (Biometra, Göttingen, Germany). L. monocytogenes 05CEB424LM, 13CEB102LM (1/2a); 06CEB406LM, 06CEB435LM (1/2b); 06CEB405LM, 13CEB1022LM (1/2c); 06CEB422LM, 16CEL724LM (4b); L. innocua ATCC 33090; and L. ivanovii ATCC 19119 were used as reference strains (ANSES, Maisons-Alfort, France; Microbiologics, MN, USA).

2.3. Determination of Antimicrobial Susceptibility

The antibiotic susceptibility of the isolates was determined by the disk diffusion method. For each isolate, the inoculum with a density of 0.5 McFarland scale was prepared and plated on Mueller–Hinton agar with addition of 5% of defibrinated horse blood and 20 mg/L β-NAD (MH-F) (Biomaxima, Lublin, Poland), and then discs with benzylpenicillin (1 U), ampicillin (2 µg), meropenem (10 µg), erythromycin (15 µg) and trimethoprim–sulfamethoxazole (1.25–23.75 µg) (Biomaxima, Lublin, Poland) were added. Antibiograms were incubated in an atmosphere enriched with 5% CO2 at 35 °C for 18 ± 2 h. After the incubation, the growth inhibition zones around the antibiotic discs were measured and analyzed in accordance with EUCAST v. 12.0 [19]. The ATCC 49619 strain of Streptococcus pneumoniae was used as a quality control.

2.4. MALDI TOF MS Identification

The isolates were cultured on a tryptone soya yeast extract agar medium (TSYEA) (Biomaxima, Lublin, Poland) at 37 ± 1 °C for 24 ± 1 h and processed according to the manufacturer’s instructions using the extraction method. For the analysis, 1 μL of supernatant was spotted on the MSP 96 steel target plate (Bruker, Bremen, Germany), air-dried and overlaid with 1 μL of matrix solution (α-cyano-4-hydroxycinnamic acid) (Bruker Daltonics, Bremen, Germany). The dry plate was then placed in the analysis chamber. Mass spectra were generated and analyzed (m/z range of 2000–20,000 Da) using an UltrafleXtreme mass spectrometer and MALDI Biotyper (v. 3.1 software package) with a reference database (8468 reference profiles) and the manufacturer’s settings (Bruker Daltonics, Bremen, Germany). For each isolate, 3000 laser shots were collected. Analysis of each sample was performed in triplicate. The Bruker bacterial test standard (Bruker Daltonics, Bremen, Germany) was used for calibration according to the manufacturer’s instructions. Identification results were interpreted according to the manufacturer’s criteria, i.e., 0–1.699—not reliable identification; 1.700–1.999—probable genus identification; 2.000–2.299—secure genus identification, probable species identification; and 2.300–3.000—highly probable species identification. The classification of the analyzed isolates was verified by generating an MSP dendrogram using the MALDI Biotyper (v. 3.1 software package) (Bruker Daltonics, Bremen, Germany).

3. Results

3.1. Occurrence and Serogroups of L. monocytogenes Isolates

L. monocytogenes was detected in 52/848 production batches (6.13%) of RTE meat products (total n = 4240 detection units tested, of which positive samples accounted for 2.3%). The isolates were classified into four serogroups: 17/52 (33%) isolates to serogroup IVb (comprising serotypes 4b, 4d and 4e); 15/52 (29%) isolates to serogroup IIa (1/2a and 3a); 10/52 (19%) isolates to serogroup IIc (1/2c and 3c); and 10/52 (19%) isolates to serogroup IIb (1/2b, 3b and 7) (Figure 1). The distribution of individual serogroups in five types of RTE meat products was as follows: serogroups IVb, IIa, IIc and IIb were found in smoked meats and sausages; serogroups IVb, IIa and IIc were found in offal meats; serogroups IIa and IIc were found in block products; and serogroups IVb, IIa and IIb were found in delicatessen with meat (Figure 1).

3.2. Antimicrobial Susceptibility of L. monocytogenes Isolates

All L. monocytogenes isolates (52/52) showed susceptibility to antimicrobial drugs such as benzylpenicillin (1 U), ampicillin (2 µg), meropenem (10 µg), erythromycin (15 µg) and trimethoprim–sulfamethoxazole (1.25–23.75 µg).

3.3. Identification of L. monocytogenes Isolates Using MALDI-TOF MS

None of the isolates (0/52) were identified at the level of highly probable species identification (i.e., score values 2.300–3.000); 10/52 isolates (19.2%) were identified at the level of secure genus identification, probable species identification (2.000–2.999); 37/52 isolates (71.2%) were identified at the level of probable genus identification (1.700–1.999); 3/52 isolates (5.8%) were incorrectly identified as L. innocua; and 2/52 isolates (3.8%) were not identified (<1.999) (Figure 2). The MSP dendrogram revealed that the mass spectra (MSPs) of the 52 analyzed L. monocytogenes isolates formed a distinct branch separate from the MSPs of the reference L. monocytogenes strains (Figure 3).

4. Discussion

In European Union countries, RTE meat products are subject to official food control for L. monocytogenes in accordance with Commission Regulation (EC) No. 2073/2005 [20]. The zero policy for L. monocytogenes was adopted with respect to the analyzed RTE meat products [20]. National food control systems are pivotal in ensuring food safety and protecting consumers’ health. In the present study, the official control of 848 production batches of RTE meat products showed that 52 were contaminated with L. monocytogenes. The pathogen was found in a wide range of RTE meat products, such as smoked meats, sausages, offal meats, block products and delicatessen with meat (Figure 1). Of the 4240 detection units, 2.3% of the samples were positive for L. monocytogenes. This monitoring showed a low occurrence of L. monocytogenes in the analyzed RTE meat products. The occurrence of L. monocytogenes has been noted in a wide range of RTE meat products worldwide, with high variability in the percentage (%) of positive samples (2.1–64.5%) [1,21,22,23]. The differences in the proportions (%) of positive samples between countries are related to sampling strategy, analytical methods or type of tested food [1,22]. The ubiquitous nature of L. monocytogenes presents challenges for controlling and managing this pathogen in food processing plants [21,24]. Listeria monocytogenes can enter food processing plants (FPPs) through contaminated raw materials and colonize these environments [21,24]. It is not uncommon to find reports of persistent L. monocytogenes isolated over months or years and insufficient disinfection in FPPs [21,24,25]. A large-scale survey concerning L. monocytogenes involving twelve European food processing plants producing RTE foods of animal origin, using a harmonized sampling scheme (n = 2242), showed that each plant tested positive at least once over the sampling period, with the overall incidence of L. monocytogenes reported as being four times higher in meat plants than in dairy plants (n = 282; 32% and 8.8%, respectively) [26]. Contamination of the final product with L. monocytogenes in FPPs may be related to both contaminated raw material and cross-contamination at the production stage [21,24,25]. The results of this study and literature data clearly show that L. monocytogenes remains a constant threat to food safety. Therefore, the potential public health threat posed by L. monocytogenes in ready-to-eat food depends on the control and monitoring procedures, which at the production stage should encompass the hazard analysis and critical control points (HACCP), good hygiene practices (GHPs) and sampling procedures to assess adherence to food safety criteria for L. monocytogenes [20,27]. Since some listeriosis outbreaks linked to the consumption of ready-to-eat meat products were both associated with social and community events and consumption in households, it is important to raise awareness of the risks associated with the consumption of these types of foods in risk groups [27].
In the present study, four serogroups were identified among the L. monocytogenes isolates, i.e., IVb, IIa, IIb and IIc (Figure 1). Isolates belonging to the serogroups most frequently responsible for listeriosis in humans in Poland accounted for 62% of all isolates (IVb 17/52; 32.6% and IIb 15/52; 28.9%), which indicates that RTE meat products from this region of Poland may be a potential source of foodborne listeriosis. The distribution of individual serogroups in the analyzed RTE product category differed from those reported by other authors in the same product category. Maćkiw et al. [13] (n = 70) found that the most frequent serogroup was IIa (51%), then serogroups IIc (21%), IIb (14%) and IVb (13%), while Henriques et al. [23] (n = 81) showed that the most frequent serogroup was IIb (33%), followed by IVb (27%), IIa (27%), IVa (7%) and IIc (7%). Qualitative and quantitative differences in distribution patterns of the serogroups were also observed between RTE product categories [28]. Serogroup IVb and/or IIa were most frequently reported in RTE meat products, serogroup IIc or IIa in fish products, serogroup IVb or IIa in dairy products and serogroup IIc or IIa in vegetable products [28]. An analysis of the prevalence of individual serogroups linked to producers and ingredients of RTE foods showed that their distribution was related to the prevalence of “intra-plant isolates” of L. monocytogenes, which persistently colonized the food processing environments [28].
Prompt implementation of appropriate antimicrobial treatment is crucial to prevent possible complications and long-term sequelae of invasive listeriosis in humans [2]. Penicillin, ampicillin, meropenem, erythromycin and trimethoprim–sulfamethoxazole are used to treat L. monocytogenes infections [2]. In the present study, all L. monocytogenes isolates were found to be susceptible to these antimicrobials. The susceptibility of L. monocytogenes isolates from various sources, including food and food-related sources (100%; n = 283) to penicillin, ampicillin and trimethoprim–sulfamethoxazole, and from cases of invasive listeriosis (100%; n = 344) to penicillin, ampicillin, meropenem, erythromycin and trimethoprim–sulfamethoxazole, was also reported in Poland [7,12]. However, the resistance of L. monocytogenes isolates to the antibiotics analyzed in the current study was also described in other studies from Poland, Italy, Iran and South Africa, with the percentage of isolates resistant to penicillin ranging from 14% to 100% (n = 100 and 108, respectively), ampicillin from 44.98% to 83% (n = 269 and 70, respectively), meropenem from 10% to 13% (n = 108 and 269, respectively), erythromycin from 0.4 to 98.2% (n = 283 and 108, respectively), and trimethoprim–sulfamethoxazole from 37.54 to 78.9% (n = 269 and 108, respectively) [11,12,13,29,30]. Literature data indicate that the rate of multidrug resistance in L. monocytogenes is considered low, although it is characterized by an increasing trend and differences between countries [9,10,31]. Resistance to two or more antibiotics in L. monocytogenes isolates (n = 68) in Spain significantly increased between 1993 (18.6%) and 2006 (84%), and the average number of antibiotics to which the strains were resistant was lower in 1993 (1.6) than in 2006 (4.2) [9]. In turn, antibiotic resistance, including multidrug resistance among L. monocytogenes strains in Germany, was more common than in other European countries and the USA [10]. The emergence of resistance to antimicrobials, including those commonly used to treat listeriosis, highlights the need for continuous surveillance to assess resistance patterns of L. monocytogenes over time.
Identification of bacteria by MALDI-TOF MS is based on the comparison of a unique protein profile (spectrum composed of mass-to-charge ratio (m/z) peaks with varying intensities) specific to a particular bacterial species with a set of mass spectra of the reference database [32]. An alternative method for the identification of L. monocytogenes isolates should ensure both the identification of the pathogen at the species level and credible results in the identification process. In the present study, none of the tested isolates achieved a score value ≥ 2300, a threshold indicative of highly probable species identification. Additionally, 10% of the tested isolates were misidentified as L. innocua or remained unidentified (Figure 2). These results corroborate prior research, establishing that MALDI-TOF MS, irrespective of the system employed, lacks efficacy in accurately identifying L. monocytogenes isolates at the species level [33,34]. This suggests that MALDI-TOF MS possesses inherent limitations, necessitating consideration in its application. MALDI-TOF spectra reflect highly conserved proteins that are minimally affected by environmental conditions [35]. Several studies focused on the identification of microorganisms, including L. monocytogenes, using the MALDI-TOF MS method have shown that factors such as the age of the culture or different culture conditions, including the type of medium, do not significantly affect the performance of MALDI-TOF MS when sufficient representation of the tested microorganisms in the database is ensured and pre-analytical and analytical procedures are consistent with those used to create the database [35,36,37,38]. In the present study, adherence to the manufacturer’s sample preparation instructions facilitated the acquisition of high-quality spectra vital for the precise identification of the tested isolates, but these spectra were inadequately represented in the set of reference spectra within the database, as confirmed by the MSP dendrogram (Figure 3). The MSP dendrogram illustrating the phyloproteomic relationship between the tested isolates and the reference strains of L. monocytogenes revealed two main separate clades with ingroups. The first main clade included the reference strains of L. monocytogenes from the proprietary reference database, while the second main clade included the tested isolates of L. monocytogenes. As widely acknowledged, a limited number of mass spectra in the reference database can lead to both subpar species discrimination and misidentification [32], as observed in the current study.

5. Conclusions

L. monocytogenes is a constant threat to food safety, which highlights the importance of food control and supervision of compliance with cleaning and disinfection procedures in food production environments. RTE meat products may be a potential source of foodborne listeriosis, especially in susceptible populations. Monitoring the antimicrobial susceptibility of L. monocytogenes is critical to assessing time-related trends in resistance and ensuring the effective treatment of listeriosis. The future use of MALDI-TOF MS as a tool for identifying L. monocytogenes requires expansion of the reference database to ensure the accuracy and reliability of the identification process.

Author Contributions

Conceptualization, R.P.-Ł.; methodology, R.P.-Ł., A.P.-K. and A.P.; validation, R.P.-Ł., A.P.-K. and A.P.; formal analysis, R.P.-Ł., A.P.-K. and A.P.; investigation, R.P.-Ł., A.P.-K. and A.P.; resources, A.P.-K. and A.P.; data curation, R.P.-Ł., A.P.-K. and A.P.; writing—original draft preparation, R.P.-Ł.; writing—review and editing, R.P.-Ł.; visualization, R.P.-Ł.; supervision, R.P.-Ł., A.P.-K. and A.P.; project administration, R.P.-Ł.; funding acquisition, R.P.-Ł. All authors have read and agreed to the published version of the manuscript.

Funding

The research was financed by a subsidy assigned to scientific activities of the Department of Food Hygiene of Animal Origin: WKH/S/41/2023/WET.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union One Health 2022 Zoonoses Report. EFSA J. 2023, 21, e8442. [Google Scholar] [CrossRef] [Scilit]
  2. Koopmans, M.M.; Brouwer, M.C.; Vázquez-Boland, J.A.; van de Beek, D. Human listeriosis. Clin. Microbiol. Rev. 2023, 36, e0006019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Księżak, E.; Sadkowska-Todys, M. Listeriosis in Poland in 2012–2021. Przegl. Epidemiol. 2023, 77, 531–543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Mpundu, P.; Mbewe, A.R.; Muma, J.B.; Mwasinga, W.; Mukumbuta, N.; Munyeme, M. A global perspective of antibiotic-resistant Listeria monocytogenes prevalence in assorted ready to eat foods: A systematic review. Vet. World 2021, 14, 2219–2229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Disson, O.; Moura, A.; Lecuit, M. Making sense of the biodiversity and virulence of Listeria monocytogenes. Trends Microbiol. 2021, 29, 811–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Quereda, J.J.; Morón-García, A.; Palacios-Gorba, C.; Dessaux, C.; García-Del Portillo, F.; Pucciarelli, M.G.; Ortega, A.D. Pathogenicity and virulence of Listeria monocytogenes: A trip from environmental to medical microbiology. Virulence 2021, 12, 2509–2545. [Google Scholar] [CrossRef] [Scilit]
  7. Kuch, A.; Goc, A.; Belkiewicz, K.; Filipello, V.; Ronkiewicz, P.; Gołębiewska, A.; Wróbel, I.; Kiedrowska, M.; Waśko, I.; Hryniewicz, W.; et al. Molecular diversity and antimicrobial susceptibility of Listeria monocytogenes isolates from invasive infections in Poland (1997–2013). Sci. Rep. 2018, 8, 14562. [Google Scholar] [CrossRef] [Scilit]
  8. Murray, C.J.L.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Aguilar, G.R.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [Scilit]
  9. Alonso-Hernando, A.; Prieto, M.; García-Fernández, C.; Alonso-Calleja, C.; Capita, R. Increase over time in the prevalence of multiple antibiotic resistance among isolates of Listeria monocytogenes from poultry in Spain. Food Control 2012, 23, 37–41. [Google Scholar] [CrossRef] [Scilit]
  10. Noll, M.; Kleta, S.; Al Dahouk, S. Antibiotic susceptibility of 259 Listeria monocytogenes strains isolated from food, food-processing plants and human samples in Germany. J. Infect. Public Health 2018, 11, 572–577. [Google Scholar] [CrossRef] [Scilit]
  11. Ntshanka, Z.; Ekundayo, T.C.; du Plessis, E.M.; Korsten, L.; Okoh, A.I. Occurrence and molecular characterization of multidrug-resistant vegetable-borne Listeria monocytogenes isolates. Antibiotics 2022, 11, 1353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Lachtara, B.; Wieczorek, K.; Osek, J. Antimicrobial resistance of Listeria monocytogenes serogroups IIa and IVb from food and food-production environments in Poland. J. Vet. Res. 2023, 67, 373–379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Maćkiw, E.; Stasiak, M.; Kowalska, J.; Kucharek, K.; Korsak, D.; Postupolski, J. Occurrence and characteristics of Listeria monocytogenes in ready-to-eat meat products in Poland. J. Food Prot. 2020, 83, 1002–1009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Chen, X.F.; Hou, X.; Xiao, M.; Zhang, L.; Cheng, J.W.; Zhou, M.L.; Huang, J.J.; Zhang, J.J.; Xu, Y.C.; Hsueh, P.R. Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) analysis for the identification of pathogenic microorganisms: A review. Microorganisms 2021, 9, 1536. [Google Scholar] [CrossRef] [Scilit]
  15. Li, D.; Yi, J.; Han, G.; Qiao, L. MALDI-TOF mass spectrometry in clinical analysis and research. ACS Meas. Sci. Au 2022, 27, 385–404. [Google Scholar] [CrossRef] [Scilit]
  16. PN-EN ISO 11290-1:1999; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Detection and Enumeration of Listeria monocytogenes—Part 1: Detection Method. PKN: Warszawa, Poland, 1999.
  17. PN-EN ISO 11290-1: 2017-07; Microbiology of the Food Chain—Horizontal Method for the Detection and Enumeration of Listeria monocytogenes and of Listeria spp.—Part 1: Detection Method. PKN: Warszawa, Poland, 2017.
  18. Doumith, M.; Buchrieser, C.; Glaser, P.; Jacquet, C.; Martin, P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J. Clin. Microbiol. 2004, 42, 3819–3822. [Google Scholar] [CrossRef] [Scilit]
  19. European Committee on Antimicrobial Susceptibility Testing (EUCAST): Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 12.0. 2022. Available online: http://www.eucast.org (accessed on 6 September 2024).
  20. Commission Regulation (EC) No 2073/2005 of 15 November 2005 on microbiological criteria for foodstuffs. Off. J. Eur. Union 2005, 338, 1–32.
  21. Bolocan, A.S.; Oniciuc, E.A.; Alvarez-Ordóñez, A.; Wagner, M.; Rychli, K.; Jordan, K.; Nicolau, A.I. Putative cross-contamination routes of Listeria monocytogenes in a meat processing facility in Romania. J. Food Prot. 2015, 78, 1664–1674. [Google Scholar] [CrossRef] [Scilit]
  22. Chen, M.; Cheng, J.; Zhang, J.; Chen, Y.; Zeng, H.; Xue, L.; Lei, T.; Pang, R.; Wu, S.; Wu, H.; et al. Isolation, potential virulence, and population diversity of Listeria monocytogenes from meat and meat products in China. Front. Microbiol. 2019, 10, 946. [Google Scholar] [CrossRef] [Scilit]
  23. Henriques, A.R.; Cristino, J.M.; Fraqueza, M.J. Genetic characterization of Listeria monocytogenes isolates from industrial and retail ready-to-eat meat-based foods and their relationship with clinical strains from human listeriosis in Portugal. J. Food Prot. 2017, 80, 551–560. [Google Scholar] [CrossRef] [Scilit]
  24. Lüth, S.; Halbedel, S.; Rosner, B.; Wilking, H.; Holzer, A.; Roedel, A.; Dieckmann, R.; Vincze, S.; Prager, R.; Flieger, A.; et al. Backtracking and forward checking of human listeriosis clusters identified a multiclonal outbreak linked to Listeria monocytogenes in meat products of a single producer. Emerg. Microbes Infect. 2020, 9, 1600–1608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Zhang, H.; Que, F.; Xu, B.; Sun, L.; Zhu, Y.; Chen, W.; Ye, Y.; Dong, Q.; Liu, H.; Zhang, X. Identification of Listeria monocytogenes contamination in a ready-to-eat meat processing plant in China. Front. Microbiol. 2021, 12, 628204. [Google Scholar] [CrossRef] [Scilit]
  26. Muhterem-Uyar, M.; Dalmasso, M.; Bolocan, A.S.; Hernandez, M.; Kapetanakou, A.E.; Kuchta, T.; Manios, S.G.; Melero, B.; Minarovičová, J.; Nicolau, A.I.; et al. Environmental sampling for Listeria monocytogenes control in food processing facilities reveals three contamination scenarios. Food Control 2015, 51, 94–107. [Google Scholar] [CrossRef] [Scilit]
  27. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards); Ricci, A.; Allende, A.; Bolton, D.; Chemaly, M.; Davies, R.; Fernàndez Escàmez, P.S.; Girones, R.; Herman, L.; Koutsoumanis, K.; et al. Scientific opinion on the Listeria monocytogenes contamination of ready-to-eat foods and the risk for human health in the EU. EFSA J. 2018, 16, 5134. [Google Scholar] [CrossRef] [Scilit]
  28. Szymczak, B.; Szymczak, M.; Trafiałek, J. Prevalence of Listeria species and L. monocytogenes in ready-to-eat foods in the West Pomeranian region of Poland: Correlations between the contamination level, serogroups, ingredients, and producers. Food Microbiol. 2020, 91, 103532. [Google Scholar] [CrossRef] [Scilit]
  29. Nemati, V.; Khomeiri, M.; Sadeghi Mahoonak, A.; Moayedi, A. Prevalence and antibiotic susceptibility of Listeria monocytogenes isolated from retail ready-to-eat meat products in Gorgan, Iran. Nutr. Food Sci. Res. 2020, 7, 41–46. [Google Scholar] [CrossRef] [Scilit]
  30. Rippa, A.; Bilei, S.; Peruzy, M.F.; Marrocco, M.G.; Leggeri, P.; Bossù, T.; Murru, N. Antimicrobial resistance of Listeria monocytogenes strains isolated in food and food-processing environments in Italy. Antibiotics 2024, 13, 525. [Google Scholar] [CrossRef] [Scilit]
  31. Olaimat, A.N.; Al-Holy, M.A.; Shahbaz, H.M.; Al-Nabulsi, A.A.; Abu Ghoush, M.H.; Osaili, T.M.; Ayyash, M.M.; Holley, R.A. Emergence of antibiotic resistance in Listeria monocytogenes isolated from food products: A Comprehensive Review. Compr. Rev. Food Sci. Food Saf. 2018, 17, 1277–1292. [Google Scholar] [CrossRef] [Scilit]
  32. Rychert, J. Benefits and limitations of MALDI-TOF mass spectrometry for the identification of microorganisms. J. Infect. Epidemiol. 2019, 2, 1–5. [Google Scholar] [CrossRef] [Scilit]
  33. Farfour, E.; Leto, J.; Barritault, M.; Barberis, C.; Meyer, J.; Dauphin, B.; Le Guern, A.S.; Leflèche, A.; Badell, E.; Guiso, N.; et al. Evaluation of the Andromas matrix-assisted laser desorption ionization-time of flight mass spectrometry system for identification of aerobically growing Gram-positive bacilli. J. Clin. Microbiol. 2012, 50, 2702–2707. [Google Scholar] [CrossRef] [Scilit]
  34. Pusztahelyi, T.; Szabó, J.; Dombrádi, Z.; Kovács, S.; Pócsi, I. Foodborne Listeria monocytogenes: A real challenge in quality control. Scientifica 2016, 2016, 5768526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Croxatto, A.; Prod’hom, G.; Greub, G. Applications of MALDI-TOF mass spectrometry in clinical diagnostic microbiology. FEMS Microbiol. Rev. 2012, 36, 380–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Barbuddhe, S.B.; Maier, T.; Schwarz, G.; Kostrzewa, M.; Hof, H.; Domann, E.; Chakraborty, T.; Hain, T. Rapid identification and typing of Listeria species by matrix-assisted laser desorption ionization-time of flight mass spectrometry. Appl. Environ. Microbiol. 2008, 74, 5402–5407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Bourassa, L.; Butler-Wu, S.M. MALDI-TOF mass spectrometry for microorganism identification. Methods Microbiol. 2015, 42, 37–85. [Google Scholar] [CrossRef] [Scilit]
  38. Lau, A.F.; Drake, S.K.; Calhoun, L.B.; Henderson, C.M.; Zelazny, A.M. Development of a clinically comprehensive database and a simple procedure for identification of molds from solid media by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 2013, 51, 828–834. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Molecular serogroups of the L. monocytogenes isolates in the RTE meat products.
Figure 1. Molecular serogroups of the L. monocytogenes isolates in the RTE meat products.
Foods 13 02950 g001
Figure 2. Identification of the L. monocytogenes isolates from RTE meat products by MALDI-TOF.
Figure 2. Identification of the L. monocytogenes isolates from RTE meat products by MALDI-TOF.
Foods 13 02950 g002
Figure 3. MALDI-TOF MS dendrogram for the 52 analyzed isolates (marked in red) and the reference strains of L. monocytogenes (marked in blue). Distance level represents the relative distance used in the clustering analysis.
Figure 3. MALDI-TOF MS dendrogram for the 52 analyzed isolates (marked in red) and the reference strains of L. monocytogenes (marked in blue). Distance level represents the relative distance used in the clustering analysis.
Foods 13 02950 g003
Table 1. Primers for molecular serogroup determination using multiplex PCR.
Table 1. Primers for molecular serogroup determination using multiplex PCR.
Gene *Primer NameSequence (5′→3′)Amplicon
Size (bp)
lmo0737lmo0737FAGGGCTTCAAGGACTTACCC691
lmo0737RACGATTTCTGCTTGCCATTC
lmo1118lmo1118FAGGGGTCTTAAATCCTGGAA906
lmo1118RCGGCTTGTTCGGCATACTTA
ORF2819ORF2819FAGCAAAATGCCAAAACTCGT471
ORF2819RCATCACTAAAGCCTCCCATTG
ORF2110ORF2110FAGTGGACAATTGATTGGTGAA597
ORF2110RCATCCATCCCTTACTTTGGAC
prsprsRGCTGAAGAGATTGCGAAAGAAG307
prsFCAAAGAAACCTTGGATTTGCGG
* Gene amplification was carried out under the following conditions: initial DNA denaturation at 95 °C for 5 min followed by 30 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min. The final cycle was performed at 55 °C for 2 min and 72 °C for 5 min.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pyz-Łukasik, R.; Piróg-Komorowska, A.; Policht, A. Occurrence, Molecular Serogroups, Antimicrobial Susceptibility and Identification by MALDI-TOF MS of Listeria monocytogenes Isolated from RTE Meat Products in Southern Poland. Foods 2024, 13, 2950. https://doi.org/10.3390/foods13182950

AMA Style

Pyz-Łukasik R, Piróg-Komorowska A, Policht A. Occurrence, Molecular Serogroups, Antimicrobial Susceptibility and Identification by MALDI-TOF MS of Listeria monocytogenes Isolated from RTE Meat Products in Southern Poland. Foods. 2024; 13(18):2950. https://doi.org/10.3390/foods13182950

Chicago/Turabian Style

Pyz-Łukasik, Renata, Anna Piróg-Komorowska, and Agata Policht. 2024. "Occurrence, Molecular Serogroups, Antimicrobial Susceptibility and Identification by MALDI-TOF MS of Listeria monocytogenes Isolated from RTE Meat Products in Southern Poland" Foods 13, no. 18: 2950. https://doi.org/10.3390/foods13182950

APA Style

Pyz-Łukasik, R., Piróg-Komorowska, A., & Policht, A. (2024). Occurrence, Molecular Serogroups, Antimicrobial Susceptibility and Identification by MALDI-TOF MS of Listeria monocytogenes Isolated from RTE Meat Products in Southern Poland. Foods, 13(18), 2950. https://doi.org/10.3390/foods13182950

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop