The Stressogenic Impact of Bacterial Secretomes Is Modulated by the Size of the Milk Fat Globule Used as a Substrate
Abstract
1. Introduction
2. Materials and Methods
2.1. Primary Culture
2.2. Materials
2.3. Bacterial Secretome Collection
2.4. Experimental Design
2.5. Lipid Droplets Staining
2.6. Fluorescence Microscopy and Lipid Droplet Size Measurements
2.7. Image Analysis—Cell Count
2.8. RNA Extraction and cDNA Synthesis
2.9. Real-Time PCR Analysis
2.10. Cell Viability Test
2.11. Mitochondrial Membrane Potential Determination
2.12. Statistical Analysis
3. Results
3.1. MEC Response to Stress—Gene Expression and Mitochondria Potential after Exposure to LPS and H2O2
3.2. Lipid Droplet Image Analysis
3.3. MEC Response to Stress—Morphometric Features of Lipid Droplets
3.4. MEC Response to Exposure to Postbiotics from Bacillus subtilis Grown on Small and Large MFGs—Morphometric Features of Lipid Droplets
3.5. MEC Response to Postbiotics from Bacillus subtilis Incubated with Small or Large MFGs—Gene Expression
3.6. MEC Response to Exposure to Postbiotics from E. coli Grown on Small and Large MFGs—Morphometric Features of Lipid Droplets
3.7. MEC Response to Postbiotics from E. coli Grown on Small and Large MFGs—Gene Expression
3.8. MEC Response to Exposure to Postbiotics from Bacillus subtilis and E. coli Grown on Small and Large MFGs—Cell Viability Test
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Park, Y.W.; Juárez, M.; Ramos, M.; Haenlein, G.F.W. Physico-chemical characteristics of goat and sheep milk. Small Rumin. Res. 2007, 68, 88–113. [Google Scholar] [CrossRef] [Scilit]
- Faustini, M.; Colombani, C.; Vigo, D.; Communod, R.; Russo, V.; Chlapanidas, T.; Munari, E.; Morandotti, A.; Torre, M.L. Dimensional analysis of milk fat globules in sow milk: Effects of the lactation stage and fat content and comparison with vaccine milk. Vet. Res. Commun. 2010, 34, 29–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Masedunskas, A.; Chen, Y.; Stussman, R.; Weigert, R.; Mather, I.H. Kinetics of milk lipid droplet transport, growth, and secretion revealed by intravital imaging: Lipid droplet release is intermittently stimulated by oxytocin. Mol. Biol. Cell. 2017, 28, 935–946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Michalski, M.C.; Briard, V.; Michel, F.; Tasson, F.; Poulain, P. Size distribution of fat globules in human colostrum, breast milk, and infant formula. J. Dairy Sci. 2005, 88, 1927–1940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walter, L.; Narayana, V.K.; Fry, R.; Logan, A.; Tull, D.; Leury, B. Milk fat globule size development in the mammary epithelial cell: A potential role for ether phosphatidylethanolamine. Sci. Rep. 2020, 10, 12299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McManaman, J.L.; Reyland, M.E.; Thrower, E.C. Secretion and Fluid Transport Mechanisms in the Mammary Gland: Comparisons with the Exocrine Pancreas and the Salivary Gland. J. Mammary Gland. Biol. Neoplasia 2006, 11, 249–268. [Google Scholar] [CrossRef] [Scilit]
- Monks, J.; Ladinsky, M.S.; McManaman, J.L. Organellar Contacts of Milk Lipid Droplets. Contact Thousand Oaks Ventura Cty. Calif. 2020, 3. [Google Scholar] [CrossRef] [Scilit]
- Malis, Y.; Armoza-Eilat, S.; Nevo-Yassaf, I.; Dukhovny, A.; Sklan, E.H.; Hirschberg, K. Rab1b facilitates lipid droplet growth by ER–to–lipid droplet targeting of DGAT2. Sci. Adv. 2024, 10, eade7753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sathyanarayan, A.; Mashek, M.T.; Mashek, D.G. ATGL Promotes Autophagy/Lipophagy via SIRT1 to Control Hepatic Lipid Droplet Catabolism. Cell Rep. 2017, 19, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Majchrzak, M.; Stojanović, O.; Ajjaji, D.; M’barek, K.B.; Omrane, M.; Thiam, A.R.; Klemm, R.W. Perilipin membrane integration determines lipid droplet heterogeneity in differentiating adipocytes. Cell Rep. 2024, 43, 114093. [Google Scholar] [CrossRef] [Scilit]
- Ponugoti, B.; Kim, D.H.; Xiao, Z.; Smith, Z.; Miao, J.; Zang, M.; Wu, S.Y.; Chiang, C.M.; Veenstra, T.D.; Kemper, J.K. SIRT1 Deacetylates and Inhibits SREBP-1C Activity in Regulation of Hepatic Lipid Metabolism. J. Biol. Chem. 2010, 285, 33959–33970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Afrin, M.s.t.R.; Arumugam, S.; Pitchaimani, V.; Karuppagounder, V.; Thandavarayan, R.A.; Harima, M.; Hossain, C.F.; Suzuki, K.; Sone, H.; Matsubayashi, Y.; et al. Le Carbone prevents liver damage in non-alcoholic steatohepatitis-hepatocellular carcinoma mouse model via AMPKα-SIRT1 signaling pathway activation. Heliyon 2021, 7, e05888. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mesilati-Stahy, R.; Argov-Argaman, N. Changes in lipid droplets morphometric features in mammary epithelial cells upon exposure to non-esterified free fatty acids compared with VLDL. PLoS ONE 2018, 13, e0209565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, B.C.; Shamay, A.; Argov-Argaman, N. Regulation of lipid droplet size in mammary epithelial cells by remodeling of membrane lipid composition-a potential mechanism. PLoS ONE 2015, 10, e0121645. [Google Scholar] [CrossRef] [Scilit]
- Gluchowski, N.L.; Becuwe, M.; Walther, T.C.; Farese, R.V. Lipid droplets and liver disease: From basic biology to clinical implications. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 343–355. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.; Li, P. The size matters: Regulation of lipid storage by lipid droplet dynamics. Sci. China Life Sci. 2017, 60, 46–56. [Google Scholar] [CrossRef] [Scilit]
- Ouyang, Q.; Chen, Q.; Ke, S.; Ding, L.; Yang, X.; Rong, P.; Feng, W.; Cao, Y.; Wang, Q.; Li, M.; et al. Rab8a as a mitochondrial receptor for lipid droplets in skeletal muscle. Dev. Cell. 2023, 58, 289–305.e6. [Google Scholar] [CrossRef] [Scilit]
- Elblehi, S.S.; Hafez, M.H.; El-Sayed, Y.S. L-α-Phosphatidylcholine attenuates mercury-induced hepato-renal damage through suppressing oxidative stress and inflammation. Environ. Sci. Pollut. Res. 2019, 26, 9333–9342. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.; Walther, T.C.; Rao, M.; Stuurman, N.; Goshima, G.; Terayama, K.; Wong, J.S.; Vale, R.D.; Walter, P.; Farese, R.V. Functional genomic screen reveals genes involved in lipid-droplet formation and utilization. Nature 2008, 453, 657–661. [Google Scholar] [CrossRef] [Scilit]
- Ruegg, P.L. The bovine milk microbiome—An evolving science. Domest. Anim. Endocrinol. 2022, 79, 106708. [Google Scholar] [CrossRef] [Scilit]
- Kitamura, Y.; Sun, J.F.; Takahashi, S.; Hansen, C.L. Growth characteristics of Bacillus subtilis (natto) in milk. Int. J. Dairy Technol. 2010, 63, 418–422. [Google Scholar] [CrossRef] [Scilit]
- Raz, C.; Shemesh, M.; Argov-Argaman, N. The role of milk fat globule size in modulating the composition of postbiotics produced by Bacillus subtilis and their effect on mammary epithelial cells. Food Chem. 2023, 427, 136730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, B.C.; Raz, C.; Shamay, A.; Argov-Argaman, N. Lipid Droplet Fusion in Mammary Epithelial Cells is Regulated by Phosphatidylethanolamine Metabolism. J. Mammary Gland. Biol. Neoplasia 2017, 22, 235–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, R.J.; Macallan, D.C.; Sedgwick, P.; Remick, D.G.; Griffin, G.E. Kinetics of endotoxin-induced acute-phase protein gene expression and its modulation by TNF-alpha monoclonal antibody. Am. J. Physiol. 1992, 262, R786–R793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, Y.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gribar, S.C.; Richardson, W.M.; Sodhi, C.P.; Hackam, D.J. No Longer an Innocent Bystander: Epithelial Toll-Like Receptor Signaling in the Development of Mucosal Inflammation. Mol. Med. 2008, 14, 645–659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jian, Z.; Li, K.; Song, P.; Zhu, G.; Zhu, L.; Cui, T.; Liu, B.; Tang, L.; Wang, X.; Wang, G.; et al. Impaired Activation of the Nrf2-ARE Signaling Pathway Undermines H2O2-Induced Oxidative Stress Response: A Possible Mechanism for Melanocyte Degeneration in Vitiligo. J. Investig. Dermatol. 2014, 134, 2221–2230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bruce, K.D.; Cagampang, F.R.; Argenton, M.; Zhang, J.; Ethirajan, P.L.; Burdge, G.C.; Bateman, A.C.; Clough, G.F.; Poston, L.; Hanson, M.A.; et al. Maternal high-fat feeding primes steatohepatitis in adult mice offspring, involving mitochondrial dysfunction and altered lipogenesis gene expression. Hepatology 2009, 50, 1796–1808. [Google Scholar] [CrossRef] [Scilit]
- Mahmood, S.; Birkaya, B.; Rideout, T.C.; Patel, M.S. Lack of mitochondria-generated acetyl-CoA by pyruvate dehydrogenase complex downregulates gene expression in the hepatic de novo lipogenic pathway. Am. J. Physiol.-Endocrinol. Metab. 2016, 311, E117–E127. [Google Scholar] [CrossRef] [Scilit]
- Begriche, K.; Massart, J.; Robin, M.A.; Borgne-Sanchez, A.; Fromenty, B. Drug-induced toxicity on mitochondria and lipid metabolism: Mechanistic diversity and deleterious consequences for the liver. J. Hepatol. 2011, 54, 773–794. [Google Scholar] [CrossRef] [Scilit]
- Zhao, T.; Wu, K.; Hogstrand, C.; Xu, Y.H.; Chen, G.H.; Wei, C.C.; Luo, Z. Lipophagy mediated carbohydrate-induced changes of lipid metabolism via oxidative stress, endoplasmic reticulum (ER) stress and ChREBP/PPARγ pathways. Cell Mol. Life Sci. 2020, 77, 1987–2003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strable, M.S.; Ntambi, J.M. Genetic control of de novo lipogenesis: Role in diet-induced obesity. Crit. Rev. Biochem. Mol. Biol. 2010, 45, 199–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sekiya, M.; Hiraishi, A.; Touyama, M.; Sakamoto, K. Oxidative stress induced lipid accumulation via SREBP1c activation in HepG2 cells. Biochem. Biophys. Res. Commun. 2008, 375, 602–607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moyes, K.M.; Drackley, J.K.; Morin, D.E.; Bionaz, M.; Rodriguez-Zas, S.L.; Everts, R.E.; Lewin, H.A.; Loor, J.J. Gene network and pathway analysis of bovine mammary tissue challenged with Streptococcus uberis reveals induction of cell proliferation and inhibition of PPAR signaling as potential mechanism for the negative relationships between immune response and lipid metabolism. BMC Genom. 2009, 10, 542. [Google Scholar]
- Ma, N.; Abaker, J.A.; Wei, G.; Chen, H.; Shen, X.; Chang, G. A high-concentrate diet induces an inflammatory response and oxidative stress and depresses milk fat synthesis in the mammary gland of dairy cows. J. Dairy Sci. 2022, 105, 5493–5505. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Zhang, X.; He, X.; Yang, B.; Wang, H.; Shan, X.; Li, C.; Sun, D.; Wu, R. LPS-induced reduction of triglyceride synthesis and secretion in dairy cow mammary epithelial cells via decreased SREBP1 expression and activity. J. Dairy Res. 2018, 85, 439–444. [Google Scholar] [CrossRef] [Scilit]
- Argov-Argaman, N. Symposium review: Milk fat globule size: Practical implications and metabolic regulation. J. Dairy Sci. 2019, 102, 2783–2795. [Google Scholar] [CrossRef] [Scilit]
- Oosting, A.; Vlies, N.; van Kegler, D.; Schipper, L.; Abrahamse-Berkeveld, M.; Ringler, S.; Verkade, H.J.; van der Beek, E.M. Effect of dietary lipid structure in early postnatal life on mouse adipose tissue development and function in adulthood. Br. J. Nutr. 2014, 111, 215–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Argov-Argaman, N.; Altman, H.; Janssen, J.N.; Daeem, S.; Raz, C.; Mesilati-Stahy, R.; Penn, S.; Monsonego-Ornan, E. Effect of milk fat globules on growth and metabolism in rats fed an unbalanced diet. Front. Nutr. 2024, 10, 1270171. Available online: https://www.frontiersin.org/articles/10.3389/fnut.2023.1270171 (accessed on 18 April 2024). [CrossRef] [Scilit]
- Reddy, J.K.; Sambasiva Rao, M. Lipid Metabolism and Liver Inflammation. II. Fatty liver disease and fatty acid oxidation. Am. J. Physiol.-Gastrointest. Liver Physiol. 2006, 290, G852–G858. [Google Scholar] [CrossRef] [Scilit]
- Mizuno, K.; Hatsuno, M.; Aikawa, K.; Takeichi, H.; Himi, T.; Kaneko, A.; Kodaira, K.; Takahashi, H.; Itabashi, K. Mastitis Is Associated with IL-6 Levels and Milk Fat Globule Size in Breast Milk. J. Hum. Lact. 2012, 28, 529–534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, R.; Paramonov, M.M.; Moshe, S.; Argov-Argaman, N. The milk fat globule size governs a physiological switch for biofilm formation by Bacillus subtilis. Front. Nutr. 2022, 9, 844587. [Google Scholar]
- Qiu, M.; Feng, L.; Zhao, C.; Gao, S.; Bao, L.; Zhao, Y.; Fu, Y.; Hu, X. Commensal Bacillus subtilis from cow milk inhibits Staphylococcus aureus biofilm formation and mastitis in mice. FEMS Microbiol. Ecol. 2022, 98, fiac065. [Google Scholar] [CrossRef] [Scilit]
- Bannerman, D.D.; Paape, M.J.; Lee, J.W.; Zhao, X.; Hope, J.C.; Rainard, P. Escherichia coli and Staphylococcus aureus elicit differential innate immune responses following intramammary infection. Clin. Diagn. Lab. Immunol. 2004, 11, 463–472. [Google Scholar] [PubMed]
- Liu, Z.; Ezernieks, V.; Wang, J.; Arachchillage, N.W.; Garner, J.B.; Wales, W.J.; Cocks, B.G.; Rochfort, S. Heat Stress in Dairy Cattle Alters Lipid Composition of Milk. Sci. Rep. 2017, 7, 961. [Google Scholar] [CrossRef] [Scilit]
- Boren, J.; Brindle, K.M. Apoptosis-induced mitochondrial dysfunction causes cytoplasmic lipid droplet formation. Cell Death Differ. 2012, 19, 1561–1570. [Google Scholar] [CrossRef] [Scilit]











| Gene Name | Accession Num. | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
|---|---|---|---|
| 18S | NC_037354.1 | CGGCTACCACATCCAAGGAA | GGGCCCCGAAAGAGTCCTG |
| UXT | NM_001037471.2 | TGTGGCCCTTGGATATGGTT | GGTTGTCGCTGAGCTCTGTG |
| IL-6 | NM_173923.2 | GCTGAATCTTCCAAAAATGGAGG | GCTTCAGGATCTGGATCAGTG |
| TNFα | NM_173966.3 | TCTTCTCAAGCCTCAAGTAACAAGT | CCATGAGGGCATTGGCATAC |
| NRE2L2 (NRF2) | NM_001011678.2 | AGGACATGGATTTGATTGAC | TACCTGGGAGTAGTTGGCA |
| DGAT | NM_174693.2 | CGACTCCTGGAGATGCTGTT | ATGCGGGAGTAGTCCATGTC |
| FASN | NM_001012669.1 | GCATCGCTGGCTACTCCTAC | GTGTAGGCCATCACGAAGGT |
| ACC | NM_174224.2 | AGCTGAATTTTCGCAGCAAT | GGTTTTCTCCCCAGGAAAAG |
| Analysis | Lipid Droplet Size | SD | CV | Lipid Droplet Number a | SD | CV | Analysis Per Min |
|---|---|---|---|---|---|---|---|
| Manual | 1.77 | 0.013 | 0.74 | 4.57 | 1.01 | 22.07 | <1 image |
| Automated | 1.38 | 0.018 | 1.28 | 87.69 | 4.13 | 4.70 | 30 images |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tzirkel-Hancock, N.; Raz, C.; Sharabi, L.; Argov-Argaman, N. The Stressogenic Impact of Bacterial Secretomes Is Modulated by the Size of the Milk Fat Globule Used as a Substrate. Foods 2024, 13, 2429. https://doi.org/10.3390/foods13152429
Tzirkel-Hancock N, Raz C, Sharabi L, Argov-Argaman N. The Stressogenic Impact of Bacterial Secretomes Is Modulated by the Size of the Milk Fat Globule Used as a Substrate. Foods. 2024; 13(15):2429. https://doi.org/10.3390/foods13152429
Chicago/Turabian StyleTzirkel-Hancock, Noam, Chen Raz, Lior Sharabi, and Nurit Argov-Argaman. 2024. "The Stressogenic Impact of Bacterial Secretomes Is Modulated by the Size of the Milk Fat Globule Used as a Substrate" Foods 13, no. 15: 2429. https://doi.org/10.3390/foods13152429
APA StyleTzirkel-Hancock, N., Raz, C., Sharabi, L., & Argov-Argaman, N. (2024). The Stressogenic Impact of Bacterial Secretomes Is Modulated by the Size of the Milk Fat Globule Used as a Substrate. Foods, 13(15), 2429. https://doi.org/10.3390/foods13152429

