Next Article in Journal
Investigation into Antioxidant Mechanism of Lycium barbarum Extract in Carbendazim-Induced PC12 Cell Injury Model through Transcriptomics and Metabolomics Analyses
Next Article in Special Issue
Effects of Several Tea-like Plants on Liver Injury Induced by Alcohol via Their Antioxidation, Anti-Inflammation, and Regulation of Gut Microbiota
Previous Article in Journal
Comparative Study of the Antibacterial Effects of S-Nitroso-N-acetylcysteine and Sodium Nitrite against Escherichia coli and Their Application in Beef Sausages
Previous Article in Special Issue
Algae-Boosted Chickpea Hummus: Improving Nutrition and Texture with Seaweeds and Microalgae
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 13
Issue 15
10.3390/foods13152385
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

UV-B Radiation Exhibited Tissue-Specific Regulation of Isoflavone Biosynthesis in Soybean Cell Suspension Cultures

by
Mian Wang
1,
Yiting Wang
1,
Muhammad Bilal
1,
Chong Xie
1,2,
Pei Wang
1,2,
Xin Rui
1 and
Runqiang Yang
1,2,*
1
College of Food Science and Technology, Whole Grain Food Engineering Research Center, Nanjing Agricultural University, Nanjing 210095, China
2
Sanya Institute of Nanjing Agricultural University, Sanya 572024, China
*
Author to whom correspondence should be addressed.
Foods 2024, 13(15), 2385; https://doi.org/10.3390/foods13152385
Submission received: 5 July 2024 / Revised: 23 July 2024 / Accepted: 26 July 2024 / Published: 28 July 2024
(This article belongs to the Special Issue Plant-Based Food：From Nutritional Value to Health Benefits)
Browse Figures
Review Reports Versions Notes

Abstract

:
Isoflavones, a class of substances with high biological activity, are abundant in soybeans. This study investigated isoflavone biosynthesis in soybean cell suspension cultures under UV-B radiation. UV-B radiation enhanced the transcription level and activity of key enzymes involved in isoflavone synthesis in cell suspension cultures. As a result, the isoflavone contents significantly increased by 19.80% and 91.21% in hypocotyl and cotyledon suspension cultures compared with the control, respectively. Meanwhile, a significant difference was observed in the composition of isoflavones between soybean hypocotyl and cotyledon suspension cultures. Genistin was only detected in hypocotyl suspension cultures, whereas glycitin, daidzein, and genistein accumulated in cotyledon suspension cultures. Therefore, UV-B radiation exhibited tissue-specific regulation of isoflavone biosynthesis in soybean cell suspension cultures. The combination of suspension cultures and abiotic stress provides a novel technological approach to isoflavone accumulation.

1. Introduction

In recent years, as the economy has developed, there has been a rapid improvement in people’s living standards. Consequently, there has been a growing emphasis on food nutrition and health. Functional foods have emerged as a vital part of people’s daily diet and healthy lifestyle. These foods offer various benefits, including boosting immunity, improving physiological functions, preventing chronic diseases, delaying aging, and addressing subhealth issues [1]. Also, the demand for functional foods has significantly increased due to the aging population. Therefore, the development of functional foods with beneficial components has become increasingly popular in the food industry.
Isoflavones, the main secondary metabolites in leguminous plants [2], have a protective effect against ultraviolet (UV) radiation. Isoflavones have various physiological effects on the human body, including estrogen regulation, osteoporosis prevention, anti-cancer, blood lipid reduction, and cardiovascular protection [3]. Light stress is an effective pathway for the accumulation of isoflavones, especially UV-B radiation [4]. The total isoflavone content in germinated soybeans reached approximately 8000 µg/g under UV-B stress [5]. Lim et al. [6] reported that short-term light exposure increased the levels of light-sensitive compounds in soybean seedlings, such as malonyl daidzin and malonyl genistin. Yin et al. [7] also found that UV-B radiation induced isoflavone synthesis in 4-day-old germinated soybeans, such as daidzein and genistein. Therefore, the accumulation of isoflavones through UV-B radiation enhances the nutritional value and utilization of soybeans and other grain crops. Nonetheless, the impact of UV-B radiation on soybean suspension cultures remains unclear, necessitating further investigation into whether UV-B radiation could improve the enrichment of isoflavones in suspension cells.
Traditional methods of enriching functional compounds in plants, such as germination or crop breeding [8], are often constrained by high costs and natural conditions, making large-scale production challenging. In contrast to whole plants, plant cell suspension cultures demonstrate elevated cellular metabolic rates and offer a range of benefits, including cost-effectiveness, high yields, resource conservation, reduced land requirements, and environmental sustainability [9]. It provides a promising platform for producing functional compounds and has already shown successful applications in crops like soybeans and wheat [10]. Rani and Vimolmangkang [11] reported that the total isoflavone content reached up to 46.3 mg/g DW in soybean suspension cells. Bioreactors have facilitated the sustained production of daidzein and genistein, with concentrations ranging from 10 to 200 µg/g DW, for a period exceeding two months. Jeong et al. [12] observed a high production of glycosidic isoflavones in soybean suspension cell cultures under methyl jasmonate treatment, resulting in a 10-fold increase in total isoflavones. Devi et al. [13] also investigated the biosynthesis of isoflavones in cell cultures of soybeans, and pointed out that IFS2 was the key gene responsible for isoflavone accumulation. Furthermore, the heterologous expression of the AtCPK1-Ca gene through gene editing technology increased the total isoflavone content to 208.09 mg/L in cell cultures, along with an increase in isoflavone aglycones [14]. Therefore, soybean suspension cultures hold great potential for the production of bioactive components, such as isoflavones. The isoflavone content varies across different parts of the soybean plant. The hypocotyl and cotyledon of soybeans are known to have relatively high isoflavone levels [11]. Previous studies have analyzed the composition and quantities of isoflavone monomers in soybean hypocotyl and cotyledon calluses [15]. Thus, there may be variations in the nutritional composition and metabolic levels of soybean suspension cultures induced from different explants. The accumulation of isoflavones and their monomer composition still need further analysis.
The aim of this study was to observe the response of soybean cell suspension cultures to UV-B radiation, reveal the differences in isoflavone synthesis between soybean hypocotyl and cotyledon suspension cultures, and explore the effects of UV-B radiation on the regulation of isoflavone synthesis in cell suspension cultures. These findings could present a novel biosynthesis approach for the accumulation of functional compounds, such as isoflavones. They are beneficial for reducing resource wastage and achieving a continuous production of secondary metabolites.

2. Materials and Methods

2.1. Chemicals

Glycine max L. seeds (Dongnong, 2021) were collected from the Jiangsu Academy of Agricultural Sciences, China. All reagents used were obtained from Aladdin (Aladdin Reagent Co., Ltd., Shanghai, China), including isoflavone standards (daidzin, glycitin, genistin, malonyl daidzin, malonyl glycitin, malonyl genistin, daidzein, glycitein, genistein (purity ≥ 90%)), sucrose, agar, Murashige and Skoog (MS) basal medium (without sugar and agar), 1/2 MS medium, methanol (HPLC grade), ethyl acetate, acetonitrile (HPLC grade), glacial acetic acid (HPLC grade), rutin, gallic acid, perchloric acid, 1,1-diphenyl-2-picrylhydrazyl, 2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), Trolox, β-mercaptoethanol, etc.

2.2. Preparation of Cell Suspension Cultures

The establishment of explants and the induction of callus were performed as previously described by us [15]. The cell suspension cultures were initiated from 14-day-old soybean hypocotyl and cotyledon callus. The callus (approximately 1.0 g) was dissected into small pieces using a scalpel and propagated in MS liquid medium (containing 1.0 mg/L 2,4,-D, 0.5 mg/L 6-BA and 3% sucrose) in the dark at 25 °C by shake culturing. The cultures were passaged weekly into a fresh liquid medium at a 1:4 volume ratio. Cell suspension cultures were consistently established after 3–5 passages.
The cultures exposed to 40 μW/cm2 UV-B for 2 h, followed by a 12 h incubation in the dark, were the UV-B group (UV-B). Cell suspension cultures without UV-B radiation served as the control group (control). Subsequently, some cultures were freeze-dried and stored at −20 °C for further analysis. Others were stored at −80 °C until analysis.

2.3. Microscopic Observations

To assess the viability of cells, the soybean cell cultures were incubated with 0.04 mg/mL 3,6-diacetoxyfluoran for 30 min. Following three washes with PBS (pH 5.8, 0.01 M), cells were resuspended in a fresh culture medium. The fluorescence of viable cells was observed using Zeiss Axio imaging equipment (Borex Technology Co., Ltd., Beijing, China).

2.4. Cell Growth and Viability

Cell growth: The growth of suspended cells was quantified based on dry weight (DW). Cells were collected every 3 days, filtered, and recovered. The fresh cell mass was dried to a constant weight at 45 °C. The cell biomass represented the dry weight of cells harvested per 40 mL culture (g/flask).
Cell viability: The TTC method [16] was used to measure cell viability. The suspension cultures were incubated with 0.5% triphenyltetrazolium chloride for 13–16 h, then extracted with 95% ethanol until colorless. The cell viability was determined at 485 nm.

2.5. Physiological Metabolism

The oxidative damage level of suspension cultures was determined as described by Wang et al. [15], including MDA content and electrolyte leakage. ATP, ADP, and AMP contents were measured as described by Jin et al. [17].
The key enzyme activity of energy metabolism was determined using a succinate dehydrogenase (SDH) kit (BC0950, Solarbio Technology Co., Ltd., Beijing, China), a cytochrome oxidase (CCO) ELISA kit (SJ01680, Jining Industrial Co., Ltd., Shanghai, China), an H+-ATPase kit (A070-4, Jiancheng Bioengineering Institute, Nanjing, China) and a Ca2+-ATPase kit (A069-1, Jiancheng Bioengineering Institute, Nanjing, China), respectively. Cell suspension cultures were thoroughly ground in 9% physiological saline. The enzyme extraction solution was the supernatant obtained after centrifugation (4 °C, 3500× g for 15 min) for further analysis.

2.6. Phenolics and Flavonoid Contents and Their Antioxidant Capacity

The extraction and quantification of phenolics and flavonoids were performed as described by our previous study [18]. The antioxidant capacity of the extracts was also assessed. The contents of phenolics and flavonoids were calculated using gallic acid and rutin as equivalents, respectively. Trolox was used for the quantitative analysis of the antioxidant capacity.

2.7. Identification and Quantification of Isoflavonoids

The extraction of isoflavonoids was performed as previously described by us [19]. The amount of 20 mg of freeze-dried cell culture was ultrasonically extracted with 80% (v/v) methanol. The extract was then filtered through a 0.45 μm membrane.
Chromatographic separation was performed using a reversed-phase column (Ultimate AQ-C18, 4.6 × 250 mm, 5 μm particle size). The mobile phase consisted of solvent A, 0.1% acetic acid in water, and solvent B, 0.1% acetic acid in acetonitrile. A 52 min gradient was programmed as follows: 0–50 min, 13–35% B; 50–51 min, 35–13% B; 51–52 min, 13% B. The column temperature was maintained at 35 °C throughout the analysis. A sample injection volume of 20 μL was used, at a constant flow rate of 1.0 mL/min. The analytes were detected by monitoring the absorbance at 260 nm. Typical HPLC chromatograms of isoflavone monomers are shown in Figure S1.

2.8. Gene Expression and Enzyme Activity in Isoflavone Synthesis

The relative expression and activity of key enzymes were determined as described by us [20], including phenylalanine ammonialyase (PAL), cinnamate-4-hydroxylase (C4H), 4-coumarate-CoA ligase (4CL), chalcone ketone synthase (CHS), chalcone reductase (CHR), chalcone isomerase (CHI), and isoflavone synthase (IFS). The sequence-specific primers are listed in Table 1.

2.9. Statistical Analysis

Statistical analyses were performed using SPSS 18.0 (SPSS Inc., Chicago, IL, USA). All tests were three biological replicates and analyzed by Duncan’s multiple-range tests at p-values < 0.05.

3. Results

3.1. Physiological Indicators of Cell Suspension Cultures

Cell suspension cultures consisted of numerous cell clusters and single cells, with high fluorescence intensity and strong cellular vitality. As shown in Figure 1a,b, soybean cells displayed three distinct shapes: round, oval, and elongated, with cotyledon cells being relatively smaller than hypocotyl cells. The vitality of cell suspension cultures showed a significant increase in the early stage, reaching its peak on days 6 to 8. And the vitality gradually decreased as the cultivation time extended (Figure 1d). Correspondingly, the biomass of cell cultures significantly increased in the early stages of cultivation and entered a stable phase thereafter, accompanied by signs of cellular aging and apoptosis (Figure 1c). Notably, the vitality and biomass accumulation of soybean cotyledon cells were both higher than those of hypocotyl cells.
The physiological metabolism levels of the cell suspension cultures are shown in Figure 1e,f. The MDA content in cotyledon suspension cultures significantly increased by 60.65% under UV-B radiation. The electrolyte permeability of hypocotyl and cotyledon suspension cultures significantly increased by 36.23% and 14.84%, respectively.

3.2. Energy Metabolism of Cell Suspension Cultures

The energy reserves in cell suspension cultures are mainly ATP and AMP (Table 2). UV-B radiation promoted the production of ADP. There was a significant accumulation of AMP in hypocotyl suspension cultures. The ATP content only significantly increased in cotyledon suspension cultures under UV-B radiation. Correspondingly, the energy charge significantly decreased in soybean hypocotyl cultures, while it increased in soybean cotyledon cultures.
The activity of energy metabolism-related enzymes was investigated (Figure 2). The activity of CCO, H+-ATPase, and Ca2+-ATPase in soybean hypocotyl cultures under UV-B radiation significantly increased by 50.29%, 67.31%, and 25.53%, respectively. The activity of SDH and H+-ATPase in cotyledon suspension cultures significantly increased by 29.23% and 17.21%, respectively.

3.3. The Accumulation of Secondary Metabolites in Cell Suspension Cultures

As shown in Figure 3a,b, free phenolics and flavonoids accumulated in cell suspension cultures under UV-B radiation. Bound phenolics and flavonoids only accumulated in cotyledon suspension cultures. The total phenolic contents in soybean hypocotyl and cotyledon suspension cultures significantly increased by 21.18% and 91.29% compared with the control, respectively. Also, the total flavonoid contents in soybean hypocotyl and cotyledon suspension cultures increased by 13.92% and 22.82%, indicating that cotyledon suspension cultures displayed a higher sensitivity to UV-B radiation.
As shown in Figure 3c,d, the antioxidant capacity of free phenolics was greatly affected by UV-B radiation. In cotyledon suspension cultures, the ABTS and DPPH free radical scavenging ability significantly improved by 41.28% and 49.02%, respectively. The DPPH free radical scavenging ability in hypocotyl suspension cultures also improved by 33.84% under UV-B radiation.

3.4. Isoflavone Composition and Quantification of Cell Suspension Cultures

As shown in Table 3, the total isoflavone contents in hypocotyl and cotyledon suspension cultures significantly increased by 19.80% and 91.21% under UV-B radiation, respectively. Isoflavones mainly existed in the form of glycosides and malonyl glycosides (Table 3 and Figure S1). Five isoflavones were detected in hypocotyl suspension cultures, and four major isoflavones were found in cotyledon suspension cultures. In addition, daidzin, malonyl glycitin, and genistein were only found in cotyledon suspension cultures (UV-B group). Interestingly, UV-B radiation induced the degradation of malonyl genistein in cell suspension cultures.

3.5. The Key Enzyme Activities and Relative Expression of Isoflavone Synthesis

The effects of UV-B on the activity of key enzymes involved in isoflavone biosynthesis in cell suspension cultures are shown in Figure 4A–G. In hypocotyl suspension cultures, the activity of PAL, C4H, and 4CL reached their maxima at 4 h after UV-B radiation, with significant increases of 31.34%, 30.72%, and 20.69%, respectively. The activity of CHS, CHR, CHI, and IFS significantly increased by 52.70%, 59.49%, 27.61%, and 33.49% at 0 h after UV-B radiation, respectively. In soybean cotyledon suspension cultures, PAL activity significantly increased by 267.88% at 8 h after UV-B radiation. The activity of C4H and 4CL reached their maxima at 4 h after UV-B radiation, displaying significant increases of 22.47% and 13.18%. CHS, CHR, CHI, and IFS activity decreased at 8 h after UV-B radiation, followed by a rapid increase at 12 h after UV-B radiation.
The genes’ expression was generally consistent with their activities; however, a time lag phenomenon was observed among them (Figure 4). The key genes showed significant changes at 0–8 h after UV-B radiation and had no significant difference after 12 h in soybean suspension cultures compared with the control. Among them, PAL expression significantly increased at 0 and 8 h after UV-B radiation. The relative expression of C4H and 4CL was higher at 4–8 h after UV-B radiation. In addition, the relative expression of CHS, CHR2, CHR4, CHI4A, and IFS1 was regulated by UV-B in hypocotyl suspension cultures, while CHR4 and CHI1A expression significantly increased in cotyledon suspension cultures compared with the control.

4. Discussion

Soybean suspension cells were composed of a large number of cell clusters and single cells, with high cellular vitality (Figure 1a–d). ATP and AMP were identified as the main energy reserves in cell suspension cultures (Table 2). The stability of cell membranes and the physiological metabolism of soybean suspension cells were affected by UV-B radiation (Figure 1e,f). SDH, CCO, and ATPases were activated by UV-B radiation, promoting ADP production and phosphorylation (Figure 2 and Table 2). The energy metabolism of cell suspension cultures plays a crucial role in cell proliferation and material accumulation under abiotic stress [21]. The production and consumption of energy are regulated by key enzymes involved in oxidative phosphorylation and ATP production [22]. As the functional protein in cell membranes, H+-ATPase promotes the hydrolysis of ATP into ADP with the release of energy. The balance and transport of intracellular Ca2+ are regulated by Ca2+-ATPase to ensure energy production [23]. SDH and CCO, as key enzymes in the TCA cycle and mitochondrial respiratory chain, affect cellular energy production and transduction [24]. The UV-B signal captured by soybean cells regulated the activity of ATPases, SDH, and CCO (Figure 2), thereby promoting the production and phosphorylation of ADP to maintain intracellular ATP and energy charge levels. The high energy metabolism level of cell suspension cultures not only ensured normal cell proliferation, but also sustained the energy required for secondary metabolite synthesis, like isoflavones. Hence, UV-B radiation promoted the production and phosphorylation of ADP in cell cultures by regulating the activity of ATPases, SDH, and CCO, thereby providing energy for cell growth and material accumulation.
Phenolics and flavonoids accumulated in cell suspension cultures under UV-B radiation (Figure 3). Interestingly, the suspension cultures of cotyledon were more sensitive to UV-B. As shown in Table 3, the isoflavone contents showed significant increases by 19.80% and 91.21% in hypocotyl and cotyledon suspension cultures treated with UV-B, respectively. The content of isoflavones could be as high as 700 µg/g DW. Compared to germinated soybeans, the yield of isoflavones was higher in cell suspension cultures [5]. Glycosidic and malonyl glycosidic isoflavones were the main isoflavone components. Soybean cell suspension cultures were undifferentiated thin-walled cells, and their gene expression was more susceptible to UV-B radiation compared with the entire plant (Figure 4). Glycosidic isoflavones are commonly used to form thin-walled layers or organelle membranes of cells to maintain structural stability [25]. Wang et al. [15] observed that malonyl glycosidic isoflavones accumulated in soybean calluses treated with UV-B. Liu et al. [26] also found that the glycosylation of isoflavones was effected by UV-B radiation in two Astragalus plants. Furthermore, UV-B induced the synthesis of glycoside flavonols in peach fruit [27]. These facts imply that UV-B stimulates the synthesis of isoflavones in cell suspension cultures, particularly bound isoflavones.
The biosynthesis of individual isoflavones was regulated by UV-B radiation with tissue specificity (Table 3). UV-B radiation stimulated the synthesis of malonyl daidzin, malonyl glycitin, and daidzin in cell suspension cultures. Interestingly, the synthesis of genistin mainly occurred in soybean hypocotyl cells, while daidzein, genistein, and glycitin were mainly present in cotyledon cells. UV-B radiation induces the tissue-specific accumulation of secondary metabolites in plant cells [28]. As the nutrient storage organ of the soybean plant, the cotyledon contains abundant macromolecular nutrients such as starch and protein [29]. UV-B radiation activates the expression of various endogenous enzymes in plant cells, which leads to the degradation of macromolecular nutrients into small molecules, including amino acids and glycosides [30], providing energy and essential nutrients for cells. Thus, there were plentiful isoflavones in soybean cotyledon suspension cultures, including aglycone isoflavone (daidzein and genistein). In contrast, the hypocotyl is the initial stem that emerges from the cotyledon, which transmits energy and material for the plant [29]. The formation process of the soybean hypocotyl involves tissue fibrosis [19], leading to a higher content of bound isoflavones. These compounds are often used to form cell walls and organelle membranes to protect plant cells. UV-B radiation disrupts the stability of cell membranes, resulting in the production of glycosidic and malonyl glycosidic isoflavones specifically in soybean hypocotyl cells [11]. Therefore, UV-B radiation promoted the synthesis of individual isoflavones in suspension cultures induced by different organs of soybean.
The enzymes of isoflavone biosynthesis were activated by UV-B radiation (Figure 4). The activity of six enzymes was higher at 4–8 h after UV-B radiation, and their relative expression was upregulated after UV-B radiation for 2 h. There was a temporal lag between gene expression and the activity of key enzymes in response to UV-B, indicating that six key genes of isoflavone biosynthesis showed a transient UV-B dose-dependent activation, and their expression was an early response. A delay was also detected in mRNA, protein, and isoflavone accumulation in Arabidopsis seedlings [31]. As the initial enzymes of isoflavonoid synthesis, PAL, C4H, and 4CL regulate the early stages of isoflavone biosynthesis, providing precursor substances like 4-coumaryl CoA [19]. Newton et al. [32] used CRISPR-guided DNA methylation to downregulate PAL, with the result of a decrease in total flavonoids in Taxus baccata L. cell cultures. Bamneshin et al. [33] found that light-induced activation of PAL transcription increased the content of total phenolics. Additionally, the activated CHS, CHR, CHI, and IFS further catalyzed substrates to promote the synthesis of isoflavone monomers [19]. Also, the upregulated expression of these genes promoted isoflavone synthesis in cell cultures, including Sophora flavescens [34], Dalbergia odorifera [35], and other plants. In sum, UV-B radiation induced isoflavone accumulation in cell cultures by regulating key enzymes involved in isoflavone biosynthesis at the transcriptional and substrate–enzyme levels.

5. Conclusions

To sum up, UV-B radiation modulated the growth and energy metabolism of soybean suspension cells, and promoted the accumulation of phenolic compounds in soybean cell suspension cultures. UV-B radiation upregulated the mRNA expression levels and enzyme activities of seven key enzymes, including PAL, C4H, and CHS. This upregulation ultimately induced the biosynthesis of isoflavones in soybean cell suspension cultures. Interestingly, the cotyledon suspension cultures were more sensitive to UV-B radiation. Notably, there were significant differences in the composition of isoflavones in soybean suspension cultures derived from different organs. Glycosidic and malonyl glycosidic isoflavone contents were higher in the soybean hypocotyl suspension cultures, whereas aglycone isoflavone was exclusively synthesized in the soybean cotyledon suspension cultures.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/foods13152385/s1, Figure S1. Typical HPLC chromatograms of nine isoflavone monomers in soybean cell suspension cultures. a: Typical HPLC chromatograms of nine isoflavone monomers; 1, daidzin; 2, glycitin; 3, genistin; 4, malonyl daidzin; 5, malonyl glycitin; 6, malonyl genistin; 7, daidzein; 8, glycitein; 9, genistein. b: Typical HPLC chromatograms of isoflavones in soybean hypocotyl cell suspension cultures. c: Typical HPLC chromatograms of isoflavones in soybean cotyledon cell suspension cultures.

Author Contributions

Conceptualization, M.W. and R.Y.; methodology, M.W. and Y.W.; software, P.W. and X.R.; data curation, M.W.; writing—original draft, M.W.; writing—review and editing, M.B. and C.X.; visualization, C.X., X.R. and R.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Natural Science Foundation of Hainan Province (324CXTD427), the Jiangsu Key R&D Program Project (BE2023318), the Fundamental Research Funds for the Central Universities (CXCYL2023005), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials; further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Vuolo, M.M.; Lima, V.S.; Maróstica Junior, M.R. Phenolic compounds: Structure, classification, and antioxidant power. In Bioactive Compounds; Woodhead Publishing: Sawston, UK, 2019; pp. 33–50. [Google Scholar]
  2. David, C.K.; John, A.E. Phytoestrogen-a short review. Maturitas 1995, 22, 167–175. [Google Scholar]
  3. Chen, L.R.; Nai, Y.; Kuo, H. Isoflavone supplements for menopausal women: A systematic review. Nutrients 2019, 11, 2649. [Google Scholar] [CrossRef] [PubMed]
  4. Thoma, F.; Somborn-Schulz, A.; Schlehuber, D.; Keuter, V.; Deerberg, G. Effects of light on secondary metabolites in selected leafy greens: A review. Front. Plant Sci. 2020, 11, 497. [Google Scholar] [CrossRef] [PubMed]
  5. Ma, M.; Wang, P.; Yang, R.Q.; Gu, Z.X. Effects of UV-B radiation on the isoflavone accumulation and physiological-biochemical changes of soybean during germination Physiological-biochemical change of germinated soybean induced by UV-B. Food Chem. 2018, 250, 259–267. [Google Scholar] [CrossRef] [PubMed]
  6. Lim, Y.J.; Kwon, S.J.; Eom, S.H. Red and blue light-specific metabolic changes in soybean seedlings. Front. Plant Sci. 2023, 14, 1128001. [Google Scholar] [CrossRef]
  7. Yin, Y.Q.; Tian, X.; Yang, J.; Yang, Z.F.; Tao, J.; Fang, W.M. Melatonin mediates isoflavone accumulation in germinated soybeans (Glycine max L.) under ultraviolet-B stress. Plant Physiol. Biochem. 2022, 175, 23–32. [Google Scholar] [CrossRef]
  8. Eum, H.L.; Park, Y.; Yi, T.G.; Lee, J.W.; Ha, K.S.; Choi, I.Y.; Park, N.I.L. Effect of germination environment on the biochemical compounds and anti-inflammatory properties of soybean cultivars. PLoS ONE 2020, 15, e0232159. [Google Scholar] [CrossRef]
  9. Occhialini, A.; Nguyen, M.-A.; Dice, L.; Pfotenhauer, A.C.; Sultana, M.S.; Neal Stewart, C., Jr.; Lenaghan, S.C. High-throughput transfection and analysis of soybean (Glycine max) protoplasts. Methods Mol. Biol. 2022, 2464, 245–259. [Google Scholar]
  10. Huckelhoven, R.; Schuphan, I.; Thiede, B.; Schmidt, B. Biotransformation of pyrene by cell cultures of soybean (Glycine max L), wheat (Triticum aestivum L), jimsonweed (Datura stramonium L), and purple foxglove (Digitalis purpurea L). J. Agric. Food Chem. 1997, 4, 263–269. [Google Scholar] [CrossRef]
  11. Rani, D.; Vimolmangkang, S. Trends in the biotechnological production of isoflavonoids in plant cell suspension cultures. Phytochem. Rev. 2022, 21, 1843–1862. [Google Scholar] [CrossRef]
  12. Jeong, Y.J.; An, C.H.; Park, S.C.; Pyun, J.W.; Lee, J.; Kim, S.W.; Kim, H.S.; Kim, H.R.; Jeong, J.C.; Kim, C.Y. Methyl jasmonate increases isoflavone production in soybean cell cultures by activating structural genes involved in isoflavonoid biosynthesis. J. Agric. Food Chem. 2018, 66, 4099–4105. [Google Scholar] [CrossRef] [PubMed]
  13. Devi, M.K.A.; Kumar, G.; Giridhar, P. Effect of biotic and abiotic elicitors on isoflavone biosynthesis during seed de-velopment and in suspension cultures of soybean (Glycine max L.). 3 Biotech. 2020, 10, 98. [Google Scholar] [CrossRef] [PubMed]
  14. Veremeichik, G.N.; Grigorchuk, V.P.; Silanteva, S.A.; Shkryl, Y.N.; Bulgakov, D.V.; Brodovskaya, E.V.; Bulgakov, V.P. Increase in isoflavonoid content in Glycine max cells transformed by the constitutively active Ca2+ independent form of the AtCPK1 gene. Phytochemistry 2019, 157, 111–120. [Google Scholar] [CrossRef]
  15. Wang, M.; Liu, G.N.; Guo, T.W.; Xie, C.; Wang, P.; Yang, R.Q. UV-B radiation enhances isoflavone accumulation and antioxidant capacity of soybean calluses. Front. Nutr. 2023, 10, 1139698. [Google Scholar] [CrossRef] [PubMed]
  16. Towill, L.E.; Mazur, P. Studies on the reduction of 2,3,5-triphenyltetrazolium chloride as a viability assay for plant tissue cultures. Can. J. Bot. 1975, 53, 1097–1102. [Google Scholar] [CrossRef]
  17. Jin, P.; Zhang, Y.; Shan, T.M.; Huang, Y.P.; Xu, J.; Zheng, Y.H. Low-temperature conditioning alleviates chilling injury in loquat fruit and regulates glycine betaine content and energy status. J. Agric. Food Chem. 2015, 63, 3654–3659. [Google Scholar] [CrossRef] [PubMed]
  18. Wang, M.; Leng, C.; Zhu, Y.; Wang, P.; Gu, Z.; Yang, R. UV-B treatment enhances phenolic acids accumulation and antioxidant capacity of barley seedlings. LWT 2022, 153, 112445. [Google Scholar] [CrossRef]
  19. Ma, M.; Xu, W.L.; Wang, P.; Gu, Z.X.; Zhang, H.Z.; Yang, R.Q. UV-B-triggered H2O2 production mediates isoflavones synthesis in germinated soybean. Food Chem. X 2022, 14, 100331. [Google Scholar] [CrossRef] [PubMed]
  20. Ma, Y.; Wang, P.; Zhou, T.; Chen, Z.J.; Yang, R.Q. NaCl stress on physio-biochemical metabolism and antioxidant ca-pacity in germinated hulless barley (Hordeum vulgare L.). J. Sci. Food Agric. 2019, 99, 1755–1764. [Google Scholar] [CrossRef]
  21. Li, D.; Limwachiranon, J.; Li, L.; Du, R.X.; Luo, Z.S. Involvement of energy metabolism to chilling tolerance induced by hydrogen sulfide in cold-stored banana fruit. Food Chem. 2016, 208, 272–278. [Google Scholar] [CrossRef]
  22. Jin, P.; Zhu, H.; Wang, L.; Shan, T.M.; Zheng, Y.H. Oxalic acid alleviates chilling injury in peach fruit by regulating energy metabolism and fatty acid contents. Food Chem. 2014, 161, 87–93. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, Z.L.; Li, L.; Luo, Z.S.; Zeng, F.F.; Jiang, L.; Tang, K.C. Effect of brassinolide on energy status and proline me-tabolism in postharvest bamboo shoot during chilling stress. Postharvest Biol. Technol. 2016, 111, 240–246. [Google Scholar] [CrossRef]
  24. Nassarawa, S.S.; Bao, N.A.; Zhang, X.T.; Ru, Q.M.; Luo, Z.S. Evaluation of light irradiation on anthocyanins and energy metabolism of grape (Vitis vinifera L.) during storage. Food Chem. 2024, 431, 137141. [Google Scholar] [CrossRef] [PubMed]
  25. Bi, W.; Zhao, G.; Zhou, Y.; Xia, X.; Wang, J.; Wang, G.; Lu, S.; He, W.; Bi, T.; Li, J. Metabonomics analysis of fla-vonoids in seeds and sprouts of two Chinese soybean cultivars. Sci. Rep. 2022, 12, 5541. [Google Scholar] [PubMed]
  26. Liu, Y.; Liu, J.; Wang, Y.; Abozeid, A.; Tian, D.M.; Zhang, X.N.; Tang, Z.H. The different resistance of two Astragalus plants to UV-B stress is tightly associated with the organ-specific isoflavone metabolism. Photochem. Photobiol. 2018, 94, 115–125. [Google Scholar] [CrossRef]
  27. Santin, M.; Castagna, A.; Miras-Moreno, B.; Rocchetti, G.; Lucini, L.; Hauser, M.T.; Ranieri, A. Beyond the visible and below the peel: How UV-B radiation influences the phenolic profile in the pulp of peach fruit. A biochemical and molecular study. Front. Plant Sci. 2020, 11, 579063. [Google Scholar] [CrossRef] [PubMed]
  28. Nam, T.-G.; Lim, Y.J.; Eom, S.H. Flavonoid accumulation in common buckwheat (Fagopyrum esculentum) sprout tissues in response to light. Hortic. Environ. Biotechnol. 2018, 59, 19–27. [Google Scholar] [CrossRef]
  29. Kakade, M.L.; Simons, N.R.; Liener, I.E.; Lambert, J.W. Biochemical and nutritional assessment of different varieties of soybeans. J. Agric. Food Chem. 1972, 20, 87–90. [Google Scholar] [CrossRef]
  30. Jimenez-Lopez, C.; Pereira, A.G.; Lourenco-Lopes, C.; Garcia-Oliveira, P.; Cassani, L.; Fraga-Corral, M.; Prieto, M.A.; Simal-Gandara, J. Main bioactive phenolic compounds in marine algae and their mechanisms of action supporting potential health benefits. Food Chem. 2020, 341, 128262. [Google Scholar] [CrossRef]
  31. Nakabayashi, R.; Mori, T.; Nishizawa, T.; Saito, K. Temporal lag between gene expression and metabolite accumulation in flavonol biosynthesis of Arabidopsis roots. Phytochem Lett. 2017, 22, 44–48. [Google Scholar] [CrossRef]
  32. Newton, C.B.; Young, E.M.; Roberts, S.C. Targeted control of supporting pathways in paclitaxel biosynthesis with CRISPR-guided methylation. Front. Bioeng. Biotech. 2023, 11, 1272811. [Google Scholar]
  33. Bamneshin, M.; Mirjalili, M.H.; Naghavi, M.R.; Cusido, R.M.; Palazon, J. Gene expression pattern and taxane bio-synthesis in a cell suspension culture of Taxus baccata L. subjected to light and a phenylalanine ammonia lyase (PAL) in-hibitor. J. Photochem. Photobiol. B 2022, 234, 112532. [Google Scholar] [CrossRef] [PubMed]
  34. Kim, S.; Jeong, Y.J.; Park, S.H.; Park, S.C.; Lee, S.B.; Lee, J.; Kim, S.W.; Ha, B.K.; Kim, H.S.; Kim, H.; et al. The synergistic effect of co-treatment of methyl jasmonate and cyclodextrins on pterocarpan production in Sophora flavescens cell cultures. Int. J. Mol. Sci. 2020, 21, 3944. [Google Scholar] [CrossRef] [PubMed]
  35. Sun, Y.; Gao, M.; Kang, S.O.C.; Yang, C.M.; Meng, H.; Yang, Y.; Zhao, X.S.; Gao, Z.H.; Xu, Y.H.; Jin, Y.; et al. Molecular mechanism underlying mechanical wounding-induced flavonoid accumulation in Dalbergia odorifera T. Chen, an endangered tree that produces Chinese rosewood. Genes 2020, 11, 478. [Google Scholar] [CrossRef] [PubMed]
Foods 13 02385 g001
Figure 1. Cell morphology and physiological metabolism in cell suspension cultures. (a,b): cell morphology; (c): cellular biomass; (d): cellular vitality; (e): MDA content; (f): electrolyte permeability. UV-B: the cultures were exposed to 40 μW/cm2 UV-B for 2 h, followed by a 12 h incubation in the dark. Control: the cells were cultured for 14 h in the dark. The lowercase letters indicate a significant difference at p < 0.05 between UV-B and the control; t-test was used for data analysis.
Figure 1. Cell morphology and physiological metabolism in cell suspension cultures. (a,b): cell morphology; (c): cellular biomass; (d): cellular vitality; (e): MDA content; (f): electrolyte permeability. UV-B: the cultures were exposed to 40 μW/cm2 UV-B for 2 h, followed by a 12 h incubation in the dark. Control: the cells were cultured for 14 h in the dark. The lowercase letters indicate a significant difference at p < 0.05 between UV-B and the control; t-test was used for data analysis.
Foods 13 02385 g001
Foods 13 02385 g002
Figure 2. Effects of UV-B on SDH (a), CCO (b), H+-ATPase (c), and Ca2+-ATPase (d) activity in cell suspension cultures. The lowercase letters indicate a significant difference at p < 0.05 between treatments, and the t-test was used for data analysis.
Figure 2. Effects of UV-B on SDH (a), CCO (b), H+-ATPase (c), and Ca2+-ATPase (d) activity in cell suspension cultures. The lowercase letters indicate a significant difference at p < 0.05 between treatments, and the t-test was used for data analysis.
Foods 13 02385 g002
Foods 13 02385 g003
Figure 3. Effects of UV-B on the phenolic (a) and flavonoid contents (b) and ABTS (c) and DPPH (d) radical scavenging activity in cell suspension cultures. The lowercase letters indicate a significant difference at p < 0.05 between treatments, and the t-test was used for data analysis.
Figure 3. Effects of UV-B on the phenolic (a) and flavonoid contents (b) and ABTS (c) and DPPH (d) radical scavenging activity in cell suspension cultures. The lowercase letters indicate a significant difference at p < 0.05 between treatments, and the t-test was used for data analysis.
Foods 13 02385 g003
Foods 13 02385 g004
Figure 4. Effects of UV-B on the activity and relative expression of key enzymes in cell suspension cultures. (A): PAL activity; (B): C4H activity; (C): 4CL activity; (D): CHS activity; (E): CHR activity; (F): CHI activity; (G): IFS activity. h and c represent soybean suspension cultures induced by hypocotyls and cotyledons as explants, respectively. The lowercase letters indicate a significant difference at p < 0.05 between treatments. One-way ANOVA was used for data analysis.
Figure 4. Effects of UV-B on the activity and relative expression of key enzymes in cell suspension cultures. (A): PAL activity; (B): C4H activity; (C): 4CL activity; (D): CHS activity; (E): CHR activity; (F): CHI activity; (G): IFS activity. h and c represent soybean suspension cultures induced by hypocotyls and cotyledons as explants, respectively. The lowercase letters indicate a significant difference at p < 0.05 between treatments. One-way ANOVA was used for data analysis.
Foods 13 02385 g004
Table 1. Primers used for qRT-PCR.
Table 1. Primers used for qRT-PCR.
GenePrimer NamePrimer Sequences (5′→3′)Accession Number
PALSenseGCTAAGAAGTTGCATGAGATTGANM_001357058.1
Ant-senseTCATTGACAAGCTCAGAGAATTG
C4HSenseCGATTTGGCCAAAAAATTCGGTGNM_001250388.3
Ant-senseCCTTTCCGGTGAAGATGTCG
C4H1SenseCGTAGAATTTGGCTCTCGCCCNM_001371219.1
Ant-senseGCTGAAGCCGCCTTCTGAT
4CL1SenseCGGTGAAATTTGCATAAGAGGCNM_001250821.2
Ant-senseAATCCTTTGTATTTGATCAATTCCT
4CL3SenseATCTCCAACCACCTCCCTNM_001250341.2
Ant-senseGGATTCCGAGGTTGGACAAT
CHSSenseGCTATTGATGGACACCTTCGNM_001371381.1
Ant-senseACCAGGGTGTGCAATCCA
CHI1ASenseCATTGGATGGTCGTGAATACGTNM_001248290.2
Ant-senseTTGTAGAAAACAGTGGAGCCTG
CHI1BSenseCATTGGATGGTCGTGAATACGTNM_001249826.2
Ant-senseTTGTAGAAAACAGTGGAGCCTG
CHI4ASenseATCTTTGCTTGGCCATGGAATNM_001249853.2
Ant-senseAGCTGCCAACCTATCCCT
CHR1SenseACTTCCAAGCTTTGGGTCACNM_001249044.2
Ant-senseAGGCCAAGTTTCTGGCACT
CHR2SenseGATTCATTGGCCAGTGAGGCNM_001367003.1
Ant-senseTCCACCTGATTGACAGCAGGA
CHR4SenseAGCAGGCTCTTGGAGAAGNM_001367005.1
Ant-senseCCGAAGCGAATTTTGTAGAGCA
IFS1SenseGAGAGCTGGCCTCACAGTTCNM_001249093.2
Ant-senseTGCGATGGCAAGACACTACT
IFS2SenseTGGAAGTTCGTGAGGAAGNM_001251586.2
Ant-senseATGGAGATGGTGCTGTTG
EF1bSenseCCACTGCTGAAGAAGATGATGATGNM_001249608.2
Ant-senseAAGGACAGAAGACTTGCCACTC
Table 2. The ATP, ADP, and AMP contents and energy charge levels in cell suspension cultures under UV-B radiation.
Table 2. The ATP, ADP, and AMP contents and energy charge levels in cell suspension cultures under UV-B radiation.
PartTreatmentContent (µg/g FW)Energy Charge
ATPADPAMP
HypocotylControl30.59 ± 1.49 aND20.67 ± 0.43 b0.60 ± 0.02 a
UV-B30.45 ± 0.57 a11.12 ± 0.37 a25.77 ± 1.11 a0.54 ± 0.01 b
CotyledonControl26.51 ± 1.41 bND32.40 ± 1.87 a0.45 ± 0.01 b
UV-B34.18 ± 1.07 a9.47 ± 1.16 a26.96 ± 1.63 b0.55 ± 0.01 a
ND means not detected. The lowercase letters in the same column indicate a significant difference at p < 0.05 between UV-B and the control in the same soybean suspension culture. A t-test was used. The data are presented as mean ± SD, n = 3.
Table 3. The contents of individual isoflavones (µg/g DW) in cell suspension cultures under UV-B radiation.
Table 3. The contents of individual isoflavones (µg/g DW) in cell suspension cultures under UV-B radiation.
IsoflavoneHypocotylCotyledon
ControlUV-BControlUV-B
Daidzin45.19 ± 2.05 b173.33 ± 12.66 aND74.22 ± 2.86 a
GlycitinNDND25.78 ± 1.07 b36.59 ± 0.59 a
Genistin89.66 ± 1.49 b139.57 ± 8.36 aNDND
Malonyl daidzin106.54 ± 8.64 b217.20 ± 5.43 a161.47 ± 12.17 b279.28 ± 10.90 a
Malonyl glycitin54.78 ± 4.92 b98.00 ± 9.08 aND34.94 ± 1.69 a
Malonyl genistin297.49 ± 9.48 a83.11 ± 5.99 b83.74 ± 0.62 a68.93 ± 6.13 b
DaidzeinNDND27.98 ± 2.07 b47.15 ± 2.54 a
GlyciteinNDNDNDND
GenisteinNDNDND30.56 ± 0.65 a
Total593.65 ± 14.42 b711.21 ± 16.08 a298.97 ± 12.51 b571.65 ± 13.10 a
Effects of UV-B on the contents of individual isoflavones in soybean hypocotyl and cotyledon suspension cultures. ND means not detected. The lowercase letters in the same row indicate significant differences at p < 0.05 between UV-B and the control in the same callus. A t-test was used. The data are presented as mean ± SD, n = 3.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, M.; Wang, Y.; Bilal, M.; Xie, C.; Wang, P.; Rui, X.; Yang, R. UV-B Radiation Exhibited Tissue-Specific Regulation of Isoflavone Biosynthesis in Soybean Cell Suspension Cultures. Foods 2024, 13, 2385. https://doi.org/10.3390/foods13152385

AMA Style

Wang M, Wang Y, Bilal M, Xie C, Wang P, Rui X, Yang R. UV-B Radiation Exhibited Tissue-Specific Regulation of Isoflavone Biosynthesis in Soybean Cell Suspension Cultures. Foods. 2024; 13(15):2385. https://doi.org/10.3390/foods13152385

Chicago/Turabian Style

Wang, Mian, Yiting Wang, Muhammad Bilal, Chong Xie, Pei Wang, Xin Rui, and Runqiang Yang. 2024. "UV-B Radiation Exhibited Tissue-Specific Regulation of Isoflavone Biosynthesis in Soybean Cell Suspension Cultures" Foods 13, no. 15: 2385. https://doi.org/10.3390/foods13152385

APA Style

Wang, M., Wang, Y., Bilal, M., Xie, C., Wang, P., Rui, X., & Yang, R. (2024). UV-B Radiation Exhibited Tissue-Specific Regulation of Isoflavone Biosynthesis in Soybean Cell Suspension Cultures. Foods, 13(15), 2385. https://doi.org/10.3390/foods13152385

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop