Next Article in Journal
Extraction of Bioactive Compounds from Wine Lees: A Systematic and Bibliometric Review
Previous Article in Journal
Early-Life Supplementation Enhances Gastrointestinal Immunity and Microbiota in Young Rats
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 13
Issue 13
10.3390/foods13132059
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence, Molecular Characterization, and Antimicrobial Resistance Profiles of Shiga Toxin-Producing Escherichia coli Isolated from Raw Beef, Pork, and Chicken Meat in Vietnam

by
Hoang Minh Duc
1,*,
Cam Thi Thu Ha
1,
Tran Thi Khanh Hoa
1,
Le Van Hung
2,
Nguyen Van Thang
2 and
Hoang Minh Son
3
1
Department of Veterinary Public Health, Faculty of Veterinary Medicine, Vietnam National University of Agriculture Trau Quy, Gia Lam, Hanoi 12400, Vietnam
2
Veterinary Hospital, Faculty of Veterinary Medicine, Vietnam National University of Agriculture Trau Quy, Gia Lam, Hanoi 12400, Vietnam
3
Department of Anatomy and Histology, Faculty of Veterinary Medicine, Vietnam National University of Agriculture, Trau Quy, Gia Lam, Hanoi 12400, Vietnam
*
Author to whom correspondence should be addressed.
Foods 2024, 13(13), 2059; https://doi.org/10.3390/foods13132059
Submission received: 24 May 2024 / Revised: 25 June 2024 / Accepted: 26 June 2024 / Published: 28 June 2024
(This article belongs to the Section Food Microbiology)
Versions Notes

Abstract

:
Shiga toxin-producing Escherichia coli (STEC) is one of the most important foodborne pathogens, and the rise of antibiotic resistance to it is a significant threat to global public health. The purpose of this study is to investigate the prevalence, molecular characterization, and antibiotic resistance of STEC isolated from raw meat in Vietnam. The findings in this study showed that the prevalence of STEC in raw beef, pork, and chicken meat was 9.72% (7/72), 5.56% (4/72), and 1.39% (1/72), respectively. The STEC isolates were highly resistant to ampicillin (91.67%) and tetracycline (91.67%), followed by trimethoprim/sulfamethoxazole (83.33%), streptomycin (75%), and florfenicol (66.67%). The incidence of STEC virulence-associated genes, including stx1, stx2, eae, and ehxA, was 8.33% (1/12), 91.67% (11/12), 33.33% (4/12), and 58.33% (7/12), respectively. STEC serogroups O157, O26, and O111 were detected in 3 out of 12 STEC isolates. Two isolates were found to be ESBL producers carrying the blaCTX-M-55 gene, and three isolates were colistin-resistant strains harboring the mcr-1 gene. Notably, a STEC O111 isolate from chicken meat harbored both the blaCTX-M-55 and mcr-1 genes.

1. Introduction

Shiga toxin-producing Escherichia coli (STEC) is recognized as one of the most dangerous foodborne pathogens that can cause severe symptoms, including diarrhea, bloody diarrhea, hemorrhagic colitis (HC), and life-threatening conditions such as haemolytic uraemic syndrome (HUS) and thrombotic thrombocytopaenic purpura (TTP) [1,2]. The severity of STEC infection is known to be serotype-dependent. Although more than 500 STEC serotypes have been identified, a few serogroups, such as O157 and the non-O157 groups O26, O45, O103, O111, O121, and O145, have been previously reported to be associated with HC, HUS, and TTP [3]. Yearly, STEC infections are responsible for more than 265,000 illnesses in the United States [4,5] and 2.8 million acute infections with 4000 cases of HUS worldwide [6]. It has been estimated that 36% of all STEC infections in humans were linked to O157 [5,7]. Meanwhile, the “Big Six” STEC serogroups (O26, O45, O103, O111, O121, and O145) accounted for 71% of STEC infections [8]. The treatment cost per STEC infection case ranged from USD 26 to USD 211,084 depending on the severity of infection [9].
STEC, part of the normal microflora in cattle intestines, can contaminate beef during improper slaughter, making beef a potential transmission vector [10,11,12]. Pork and chicken meat have also been reported as contaminated with STEC due to environmental factors and mishandling during processing [12,13,14,15]. In addition, previous studies have reported that STEC contamination has led to significant financial losses due to the recall of meat products [16].
Antimicrobial resistance (AMR) poses a global threat to human and animal health [17,18], with the World Health Organization (WHO) recently reporting at least 700,000 deaths annually due to AMR [19]. This number could rise to 10 million deaths per year by 2050 [17,19]. The overuse and misuse of antibiotics in both clinical and veterinary settings have been attributed to the emergence of antibiotic resistance, leading to the loss of antibiotic efficacy and the limitation of antibiotic options for treating bacterial infection [20,21]. When treating a STEC infection, the administration of antibiotics must be carefully considered, as certain antibiotics such as ciprofloxacin and trimethoprim/sulfamethoxazole can enhance the production of the Shiga toxin (Stx). Therefore, only a few antibiotics such as azithromycin, fosfomycin, and meropenem are recommended for the treatment of early-stage STEC infections, as they have been shown to effectively eliminate the pathogen, prevent the release of the Shiga toxin, and reduce the risk of kidney failure. As a result, treating antibiotic-resistant STEC infections poses significant challenges. Furthermore, STEC can transfer mobile plasmid-containing antibiotic-resistant genes to commensal E. coli, thereby transforming susceptible strains into antibiotic-resistant ones [22].
Despite the growing concern regarding the antibiotic resistance of STEC, there is a lack of information on the antibiotic resistance profile of STEC isolated from meat. This study aims to determine the prevalence, molecular characteristics, and antibiotic resistance profile of STEC isolated from raw beef, pork, and chicken meat sold at wet markets and supermarkets in Vietnam.

2. Materials and Methods

2.1. Sample Collection

A total of 216 meat samples (72 beef, 72 pork, and 72 chicken) were randomly collected from wet markets (108 samples) and supermarkets (108 samples) in Hanoi from July 2022 to May 2023. Samples were transported to the laboratory in sterile bags and ice boxes within 24 h.

2.2. Prevalence of STEC in Beef, Pork, and Chicken Meat

Each 25 g meat sample was homogenized using a Seward stomacher 400 circulator (Seward Ltd., Worthing, UK) in 225 mL of modified EC broth with novobiocin and incubated at 42 °C for 18-24 h. After enrichment, DNA was extracted from 1 mL of the culture using the DNeasy tissue kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The DNA was screened for stx1 and stx2 genes using PCR with the primers listed in Table 1 [23].
The PCR was performed in a 25 µL reaction volume, comprising 2.5 μL of 10× PCR Buffer, 10 µL of 1 mM dNTPs, 5 µL of 5U Taq polymerase, 1 µL of each primer (5 μM), 2 μL of DNA template, and 1.5 µL of deionized water.
The PCR thermal cycling included an initial denaturation at 95 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 59.4 °C for 80 s, and 68 °C for 75 s, and a final elongation at 68 °C for 7 min. Post-amplification, the PCR product was analyzed by 2% agarose electrophoresis and viewed under ultraviolet light using a BioRad Molecular Imager® GelDocTM XR (BioRad Laboratories, Hercules, CA, USA).
Stx-positive enriched cultures were used for the isolation of STEC. Briefly, 5 mL of the culture was inoculated into 45 mL of MacConkey broth (Oxoid Ltd., Hants, UK) and then incubated at 37 °C for 13 h. After incubation, a portion of the sample (1 mL) was withdrawn and serially diluted with Phosphate-Buffered Saline (PBS; 137 mM NaCl, 8.10 mM Na2HPO4, 2.68 mM KCl, 1.47 mM KH2PO4) before being spread on CHROMagar O157 (CHROMagar, Paris, France) supplemented with cefixime (0.05 mg/L) and tellurite (2.5 mg/L). The plates were then incubated overnight at 37 °C. The following day, up to 30 colonies exhibiting the typical morphology of E. coli were randomly selected for colony PCR to detect stx genes using the same primers as mentioned above. Stx-positive colonies were then re-streaked on CHROMagar O157. Afterward, presumptive STEC colonies on CHROMagar O157 were confirmed again via PCR. Finally, STEC isolates were preserved at −86 °C for further characterization.

2.3. Detection of STEC Virulence-Associated Genes and Serogroup-Specific Genes

STEC isolates were subjected to multiplex PCR for the detection of accessory virulence genes (eae and ehxA), and serogroups-specific genes (rfbO157, wzxO145, wzqEO121/wzqFO121, wzxO111, wzxO103, wzxO45, and wzxO26) following the same method as mentioned above, with some modifications [23]. The primers used in this assay are presented in Table 1.
Each PCR reaction was conducted in a volume of 25 μL, consisting of 2.5 μL of 10× PCR Buffer, 10 µL of 1 mM dNTPs, 5 µL of 5U Taq polymerase, 0.5 μL of each O111 primer (10 μM), 0.25 µL each of other primers (10 µM; O157, O145, O121, O103, O45, O26, eae, and ehxA), 2 μL of DNA template, and 0.5 µL of deionized water. The PCR amplification program used in this experiment was the same as that used for the detection of stx genes.

2.4. Antimicrobial Susceptibility Profile of STEC Isolates

STEC isolates were selected for the antimicrobial susceptibility test using broth dilution methods according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [24]. Fifteen antibiotics were used in this study, including ampicillin, tetracycline, streptomycin, gentamicin, colistin, azithromycin, trimethoprim/sulfamethoxazole, florfenicol, meropenem, cefotaxime, cefoxitin, cefepime, ceftazidime, ciprofloxacin, and nalidixic acid. E. coli strain ATCC 25922 served as a quality control strain. Isolates showing resistance to at least 1 antibiotic from 3 or more antibiotic classes were classified as multidrug-resistant strains.
Isolated STEC strains resistant to cefotaxime and/or ceftazidime were specifically chosen to assess their ability to produce extended-spectrum β-lactamase (ESBL), using an ESBL test as previously described by CLSI [24].

2.5. Detection of ESBL and Colistin-Resistant Genes

STEC isolates capable of producing ESBL were tested for the presence of β-lactamase-encoding genes (ESBL genes) using multiplex PCR according to the previously described method [25]. The primers for detecting ESBL genes are shown in Table 2.
The volume of each PCR reaction was 25 µL, consisting of 2.5 μL of 10× PCR Buffer, 5 µL of 1 mM dNTPs, 2.5 µL of 5U Taq polymerase, 0.5 uL of each primer (50 μM), 2 μL of DNA template, and 7 µL of deionized water.
The PCR amplification conditions were as follows: an initial denaturation at 95 °C/5 min, followed by 25 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 90 s, extension at 72 °C for 90 s, and a final extension at 68 °C for 10 min. PCR amplicons were then visualized according to the procedure mentioned above. For further molecular characterization, PCR products were amplified and sequenced with the Sanger method using an Applied Biosystems 3500 genetic analyzer (ABI 3500, Applied Biosystems, Waltham, MA, USA). The nucleotide sequences were then analyzed using the BLASTP [26] and Resfinder-3.1 server [27].
Colistin-resistant STEC isolates were also subjected to multiplex PCR for detecting mcr genes, including mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5 [28]. Primers used for the screening of mcr genes are displayed in Table 3. The PCR reaction mixture (25 μL) contained 12.5 µL of DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 5.5 µL of deionized water, 0.5 µL each of all primers (10 µM), and 2 µL of DNA template. The thermal cycler condition used for this assay comprised an initial denaturation at 94 °C for 5 min, followed by 25 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 90 s and 72 °C for 1 min, and a final elongation at 72 °C for 10 min. After amplification, the PCR product was analyzed as described above.

3. Results

3.1. Prevalence of STEC in Beef, Pork, and Chicken Meat

The PCR results in Table 4 showed that stx genes were detected in all meat types tested at the rate of 16.2% (35/216). The highest positive rate of stx was found in beef (23.61%; 17/72), followed by pork (15.28%; 11/72), and then chicken meat (9.72%; 7/72). The stx2 gene (12.96%; 28/216) was more frequently detected than stx1 (4.17%; 9/216). Only two samples (0.93%; 2/216) tested positive for both the stx1 and stx2 genes.
The findings in Table 4 also revealed that 12 (5.56%) out of 216 meat samples tested were positive for STEC. The prevalence of STEC in beef, pork, and chicken meat was 9.72% (7/72), 5.56% (4/72), and 1.39% (1/72), respectively. A total of 21 STEC strains were isolated from 12 stx-positive samples. Among 21 STEC isolates, 2 (9.5%) carried stx1 and 19 (90.5%) harbored stx2. None of the STEC isolates carried both the stx1 and stx2 genes. A STEC strain harboring stx1 was isolated from the chicken meat sample, while STEC strains harboring stx2 were isolated from the beef and pork samples. Overall, the prevalence of STEC in meat purchased in wet markets (6.48%; 7/108) was found to be higher than in supermarkets (4.63%; 5/108).

3.2. Detection of STEC Virulence-Associated Genes and Serogroup-Specific Genes

To avoid duplicates, only one STEC isolate per meat sample was selected to detect STEC virulence-associated genes and serogroup-specific genes and to determine antimicrobial resistance. Table 5 displays the virulence-associated gene profile of the 12 STEC isolates selected. The eae gene was detected in four (33.33%; 4/12) STEC isolates, including two from beef, one from pork, and one from chicken meat samples. Meanwhile, ehxA was found in seven (58.33%; 7/12) STEC isolates. Among them, five STEC strains were recovered from beef, one from pork, and one from chicken meat samples. Three out of twelve STEC isolates were serotypeable, belonging to three different serogroups, including O157, O26, and O111. On the contrary, the remaining nine isolates were unserotypeable. The STEC O157 strain was recovered from beef samples and carried stx2, eae, and ehxA genes. STEC O26, co-harboring stx2 and eae, was isolated from pork samples. STEC O111 isolate of chicken meat origin simultaneously carried stx1, eae, and ehxA.

3.3. Antimicrobial Susceptibility Profile of STEC Isolates

The antibiotic resistance profile of 12 STEC isolates is detailed in Table 5 and Table 6. The STEC strains isolated in this study exhibited the highest resistance rates to ampicillin (91.67%) and tetracycline (91.67%), followed by trimethoprim/sulfamethoxazole (83.33%), streptomycin (75%), and florfenicol (66.67%). In contrast, the lowest resistance rates were observed with respect to cefotaxime, ceftazidime, cefepime, gentamicin, and ciprofloxacin, all at a rate of 16.67% (2/12). None of the STEC isolates were found to be resistant to cefoxitin and meropenem. The results also showed that all STEC isolates were resistant to at least two antibiotics. In particular, the STEC O111 strain isolated from chicken meat in this study resisted 13/15 antibiotics tested. Ten (83.33%) out of twelve STEC isolates were identified as multidrug-resistant strains. In addition, two isolates were identified as ESBL producers, three were colistin-resistant, and one was resistant to both colistin and cephalosporins.

3.4. Detection of ESBL and Colistin-Resistant Genes

The results of multiplex PCR showed that two phenotypically confirmed ESBL isolates carried blaCTX-M1 group genes; a subsequent sequencing assay confirmed that these genes were blaCTX-M-55. Additionally, all three colistin-resistant STEC isolates harbored mcr-1 genes. In particular, the STEC O111 isolate carried both blaCTX-M-55 and mcr-1 genes.

4. Discussion

This study is the first report on the prevalence of STEC in raw beef, pork, and chicken meat in Vietnam. Our results showed that, respectively, 9.72%, 5.56%, and 1.39% of raw beef, pork, and chicken meat samples were contaminated with STEC. The findings in this study were higher than our previous study conducted in Japan, which reported that the prevalence of STEC in raw beef, pork, and chicken meat was 7.2%, 3.8%, and 0%, respectively [12]. A lower prevalence of STEC in meat was also observed in a study performed in Switzerland, where 5/211 (2.3%) minced beef samples and 2/189 (1%) minced pork samples tested positive for STEC [30]. In a study carried out in the USA, STEC was detected in 2 (5.2%) of 231 ground pork and 13 (5.2%) of 249 ground beef samples [31]. A higher prevalence of STEC was noted in a study in Iran, reporting that 29.70% of beef samples were contaminated with STEC [32]. Similarly, an investigation by Barlow et al. on the prevalence of STEC in retail meat in Australia showed that STEC was found in 46/285 (16%) ground beef and 111/275 (40%) lamb samples [33]. Egervan et al. examined the occurrence of STEC in the Swedish retail market. The results indicated that 6 (2.0%) of the 300 samples of Swedish beef, 17 (13%) of the 135 samples of beef from other EU countries, and 6 (14%) of the 42 samples of beef from countries outside of the EU were contaminated with STEC [34]. The differences in the prevalence of STEC may be due to the different collection methods, sample sizes and seasons, isolation protocols, and geographic locations [15].
Serogroups are important factors in determining the pathogenicity of STEC. STEC O157 has been widely recognized as the most common STEC serogroup responsible for human illness globally [35]. Among non-O157 STEC serogroups, O26 has been identified as the predominant one associated with human disease worldwide [36]. Meanwhile, STEC O111 has been reported as the primary cause of HUS [8]. In this study, only three of the twelve isolates were serotypeable, with O157, O26, and O111 being the identified serogroups. O157 was detected in raw beef samples, while O26 and O111 were found in pork and chicken meat samples, respectively. These findings align with the data from the Europe Food Safety Authority (EFSA) and the European Centre for Disease Prevention (ECDC), showing that the STEC serogroups most frequently detected in beef in Europe were O157 and O26, followed by O148, O145, O8, O113, O91, O130, O174, and O113 [37]. A study conducted in South Africa investigating the prevalence of STEC serogroups in swine feces indicated that 31.81% (7/22) of STEC isolates belonged to serogroup O26, while the remaining isolates were unserotypeable [38]. Although serogroup O26 was frequently reported in pork product chains in the U.S., Europe, and Africa [15], it has not been documented in Asia. As for STEC O111, this serogroup has been previously isolated in beef [11,39] and pork [40] but not in chicken meat. Overall, the current study is the first report on the occurrence of STEC O26 in pork and STEC O111 in chicken meat in Vietnam.
Virulence-associated genes are another crucial parameter for identifying the pathogenicity of STEC. Among various virulence factors, the Shiga toxin (Stx) has been known to play the most important role in damaging endothelial cells and causing HUS [41]. Stx has two types: Stx1, encoded by the stx1 gene, and Stx2, encoded by the stx2 gene. STEC strains may harbor stx1, stx2, or both. It has been observed that STEC strains carrying stx2 were more frequently linked to HC or HUS as compared to those harboring stx1 alone or both stx1 and stx2 [12,42]. In our study, 11 out of 12 STEC isolates carried only the stx2 gene, indicating their potential to cause severe diseases. This finding is consistent with previous research that has reported a high prevalence of STEC strains harboring only the stx2 gene in meat [12,43]. While the Shiga toxin is a key virulence factor, it is not solely responsible for causing diseases. Additional virulence factors, such as intimin and enterohemolysin, are also necessary for STEC infection [44,45]. Intimin, encoded by eae, facilitates the attachment of STEC strains to the host’s intestine, leading to lesions in intestinal epithelial cells. The presence of the eae gene has been reported to enhance the pathogenicity of STEC [46]. In our study, 33.33% (4/12) of STEC isolates tested positive for the eae gene, consistent with the previous findings in China (34.69%) and Japan (20%) [12,47]. Plasmid-carried enterohemolysin encoded by ehxA is a heat-labile, pore-forming toxin that can cause the hemolysis of host red blood cells. STEC strains harboring the ehxA gene have been known to be associated with HUS [48]. In the current study, we found that 58.33% (7/12) of STEC isolates possessed the ehxA gene, indicating their high pathogenicity.
In Vietnam, antibiotics such as ampicillin, tetracycline, trimethoprim/sulfamethoxazole, streptomycin, and florfenicol have been used extensively for many years in animal husbandry for animal disease prevention and treatment and growth promotion [49]. This could partly explain the high resistance rates (66.67%-91.67%) of STEC isolates to these antibiotics and the high MDR rate (83.33%; 10/12) observed in the present study. Similar results were recorded in a study conducted by Ahmed et al. in Egypt, where 31 out of 54 (57.4%) STEC O157:H7 isolates of food origin were MDR, with high resistance rates to kanamycin (96.8%), followed by spectinomycin (93.6%), ampicillin (90.3%), streptomycin (87.1%), and tetracycline (80.6%) [50]. Another study reported that STEC isolates of human, animal, and food origins resisted streptomycin, ampicillin, and tetracycline at high rates of 82.35%, 72,54%, and 43.13%, respectively [51]. In addition, Novella et al. found that 65% of STEC isolated from humans and cattle in Brazil were identified as MDR strains, exhibiting the highest resistance rates to tetracycline (100%), streptomycin (78.1%), and trimethoprim/sulfamethoxazole (56.2%) [52].
Both extended-spectrum cephalosporins and polymyxins (colistin) belong to the critically important antimicrobial group [53]. However, the effectiveness of these antibiotics is declining due to their excessive and inappropriate use in livestock [54]. A survey conducted by Carrique-Mas et al. (2014) and Dang et al. (2013) in Vietnam indicated that colistin was commonly used for disease prevention, disease treatment, and growth promotion [55,56]. Another investigation into antimicrobial usage in livestock in Vietnam also showed that beta-lactam (25%), polymyxin (20.7%), and macrolide (17.4%) were the most frequently used antibiotic classes in pig farms, while the most popular antibiotic classes in chicken farms were beta-lactam (27.6%), followed by tetracyclines (20.9%) and polymyxins (13.5%) [57]. In this study, we found that two STEC isolates were third-generation cephalosporins-resistant STEC isolates carrying the blaCTX-M-55 gene and that three isolates were colistin-resistant strains harboring the mcr-1 gene. In particular, the STEC O111 isolate possessed both the blaCTX-M-55 and mcr-1 genes. A study conducted by Bai et al. in China also reported that a STEC O116:H11 isolate of pig origin was resistant to 20 different antibiotics and carried both the blaCTX-M-55 and mcr-1 genes [58]. This study represents the first documentation of the co-existence of the blaCTX-M-55 and mcr-1 genes in a STEC O111 strain isolated from chicken meat in Vietnam. The appropriate use and management of antibiotics on farms is essential to reduce the transmission of antibiotic-resistant bacteria to meat.

5. Conclusions

In summary, the present study is the first to report on the prevalence, molecular characteristics, and antibiotic resistance profile of STEC isolates of meat origin in Vietnam. Overall, the incidence of STEC in meat in Vietnam was 5.56%, with most STEC isolates showing resistance to multiple antibiotic classes and testing positive for the stx2 gene. Notably, one STEC isolate co-carrying the blaCTX-M-55 and mcr-1 genes was also found in this study. Taken together, the data of our study suggest that meat could serve as a potential source of antibiotic-resistant STEC and emphasize the importance of developing intervention strategies.

Author Contributions

Conceptualization, H.M.D.; methodology, H.M.D.; software, H.M.D.; validation, H.M.D. and H.M.S.; formal analysis, T.T.K.H. and H.M.D.; investigation, H.M.D., H.M.S. and T.T.K.H.; resources, H.M.D.; data curation, H.M.S., N.V.T. and L.V.H.; writing—original draft preparation, H.M.D.; writing—review and editing, N.V.T., L.V.H., C.T.T.H. and H.M.S.; visualization, H.M.D. and C.T.T.H.; supervision, H.M.D. and C.T.T.H.; project administration, H.M.D., H.M.S. and C.T.T.H.; funding acquisition, H.M.D., H.M.S. and C.T.T.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Vietnam National University of Agriculture, grant number T2022-09-07TĐ.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

The authors are grateful for the support of the Vietnam National University of Agriculture (VNUA).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Xia, X.; Meng, J.; McDermott, P.F.; Ayers, S.; Blickenstaff, K.; Tran, T.T.; Abbott, J.; Zheng, J.; Zhao, S. Presence and characterization of Shiga toxin-producing Escherichia coli and other potentially diarrheagenic E. coli strains in retail meats. Appl. Environ. Microbiol. 2010, 76, 1709–1717. [Google Scholar] [CrossRef] [PubMed]
  2. Oporto, B.; Esteban, J.I.; Aduriz, G.; Juste, R.A.; Hurtado, A. Escherichia coli O157: H7 and non-O157 Shiga toxin-producing E. coli in healthy cattle, sheep and swine herds in northern Spain. Zoonoses Public Health 2008, 55, 73–81. [Google Scholar] [CrossRef] [PubMed]
  3. Mora, A.; Blanco, J.E.; Blanco, M.; Alonso, M.P.; Dhabi, G.; Echeita, A.; González, E.A.; Bernárdez, M.I.; Blanco, J. Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157: H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res. Microbiol. 2005, 156, 793–806. [Google Scholar] [CrossRef] [PubMed]
  4. Batz, M.B.; Hoffmann, S.; Morris, J.G. Ranking the disease burden of 14 pathogens in food sources in the united states using attribution data from outbreak investigations and expert elicitation. J. Food Prot. 2012, 75, 1278–1291. [Google Scholar] [CrossRef]
  5. Scallan, E.; Griffin, P.M.; Angulo, F.J.; Tauxe, R.V.; Hoekstra, R.M. Foodborne illness acquired in the United states-Unspecified agents. Emerg. Infect. Dis. 2011, 17, 16. [Google Scholar] [CrossRef] [PubMed]
  6. Majowicz, S.E.; Scallan, E.; Jones-Bitton, A.; Sargeant, J.M.; Stapleton, J.; Angulo, F.J.; Yeung, D.H.; Kirk, M.D. Global incidence of human shiga toxin-producing Escherichia coli infections and deaths: A systematic review and knowledge synthesis. Foodborne Pathog. Dis. 2014, 11, 447–455. [Google Scholar] [CrossRef]
  7. Lathrop, S.; Edge, K.; Bareta, J. Shiga toxin—Producing Escherichia coli, New Mexico, USA, 2004–2007. Emerg. Infect. Dis. 2009, 15, 1289. [Google Scholar] [CrossRef]
  8. Brooks, J.T.; Sowers, E.G.; Wells, J.G.; Greene, K.D.; Griffin, P.M.; Hoekstra, R.M.; Strockbine, N.A. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. J. Infect. Dis. 2005, 192, 1422–1429. [Google Scholar] [CrossRef]
  9. Mir, R.A.; Kudva, I.T. Antibiotic-resistant Shiga toxin-producing Escherichia coli: An overview of prevalence and intervention strategies. Zoonoses Public Health 2019, 66, 1–13. [Google Scholar] [CrossRef]
  10. Hussein, H.S.; Bollinger, L.M. Prevalence of Shiga toxin-producing Escherichia coli in beef cattle. J. Food Prot. 2005, 68, 2224–2241. [Google Scholar] [CrossRef]
  11. Hussein, H.S. Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products. J. Anim. Sci. 2007, 85 (Suppl. 13), E63–E72. [Google Scholar] [CrossRef] [PubMed]
  12. Minh, S.H.; Kimura, E.; Minh, D.H.; Honjoh, K.; Miyamoto, T. Virulence characteristics of Shiga toxin-producing Escherichia coli from raw meats and clinical samples. Microbiol. Immunol. 2015, 59, 114–122. [Google Scholar] [CrossRef] [PubMed]
  13. Zarei, O.; Shokoohizadeh, L.; Hossainpour, H.; Alikhani, M.Y. The Prevalence of Shiga Toxin-Producing Escherichia coli and Enteropathogenic Escherichia coli Isolated from Raw Chicken Meat Samples. Int. J. Microbiol. 2021, 2021, 3333240. [Google Scholar] [CrossRef] [PubMed]
  14. Honish, L.; Punja, N.; Nunn, S.; Nelson, D.; Hislop, N.; Gosselin, G.; Stashko, N.; Dittrich, D. Escherichia coli O157:H7 Infections Associated with Contaminated Pork Products—Alberta, Canada, July–October 2014. MMWR Morb. Mortal. Wkly. Rep. 2017, 65, 1477–1481. [Google Scholar] [CrossRef]
  15. Haque, M.; Bosilevac, J.M.; Chaves, B.D. A review of Shiga-toxin producing Escherichia coli (STEC) contamination in the raw pork production chain. Int. J. Food Microbiol. 2022, 377, 109832. [Google Scholar] [CrossRef] [PubMed]
  16. Hoffmann, S.; Batz, M.B.; Morris, J.G. Annual cost of illness and quality-adjusted life year losses in the united states due to 14 foodborne pathogens. J. Food Prot. 2012, 75, 1292–1302. [Google Scholar] [CrossRef] [PubMed]
  17. WHO. Antimicrobial Resistance. 2021. Available online: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance (accessed on 20 May 2023).
  18. Lencina, F.A.; Bertona, M.; Stegmayer, M.A.; Olivero, C.R.; Frizzo, L.S.; Zimmermann, J.A.; Signorini, M.L.; Soto, L.P.; Zbrun, M.V. Prevalence of colistin-resistant Escherichia coli in foods and food-producing animals through the food chain: A worldwide systematic review and meta-analysis. Heliyon 2024, 10, e26579. [Google Scholar] [CrossRef] [PubMed]
  19. O’Neill, J. Antimicrobial Resistance: Tackling a crisis for the health and wealth of nations. Rev. Antimicrob. Resist. 2014. Available online: https://amr-review.org/sites/default/files/AMR%20Review%20Paper%20-%20Tackling%20a%20crsis%20for%20the%20health%20and%20wealth%20of%20nations_1.pdf (accessed on 12 March 2024).
  20. Vidovic, N.; Vidovic, S. Antimicrobial resistance and food animals: Influence of livestock environment on the emergence and dissemination of antimicrobial resistance. Antibiotics 2020, 9, 52. [Google Scholar] [CrossRef] [PubMed]
  21. Bastidas-Caldes, C.; de Waard, J.H.; Salgado, M.S.; Villacís, M.J.; Coral-Almeida, M.; Yamamoto, Y.; Calvopiña, M. Worldwide Prevalence of mcr-mediated Colistin-Resistance Escherichia coli in Isolates of Clinical Samples, Healthy Humans, and Livestock—A Systematic Review and Meta-Analysis. Pathogens. 2022, 11, 659. [Google Scholar] [CrossRef]
  22. Sun, D.; Jeannot, K.; Xiao, Y.; Knapp, C.W. Editorial: Horizontal gene transfer mediated bacterial antibiotic resistance. Front. Microbiol. 2019, 10, 1933. [Google Scholar] [CrossRef]
  23. Bai, J.; Paddock, Z.D.; Shi, X.; Li, S.; An, B.; Nagaraja, T.G. Applicability of a multiplex PCR to detect the seven major Shiga toxin–producing Escherichia coli based on genes that code for serogroup-specific O-antigens and major virulence factors in cattle feces. Foodborne PathogDis. 2012, 9, 541–548. [Google Scholar] [CrossRef]
  24. CLSI Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing; CLSI Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2018; ISBN 9781684400324. [Google Scholar]
  25. Nguyen, D.T.A.; Kanki, M.; Do Nguyen, P.; Le, H.T.; Ngo, P.T.; Tran, D.N.M.; Le, N.H.; Van Dang, C.; Kawai, T.; Kawahara, R.; et al. Prevalence, antibiotic resistance, and extended-spectrum and AmpC β-lactamase productivity of Salmonella isolates from raw meat and seafood samples in Ho Chi Minh City, Vietnam. Int. J. Food Microbiol. 2016, 236, 115–122. [Google Scholar] [CrossRef]
  26. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. Available online: https://www.ncbi.nlm.nih.gov/pubmed/9254694 (accessed on 16 January 2024). [CrossRef]
  27. Zankari, E.; Hasman, H.; Cosentino, S.; Vestergaard, M.; Rasmussen, S.; Lund, O.; Aarestrup, F.M.; Larsen, M.V. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 2012, 67, 2640–2644. [Google Scholar] [CrossRef]
  28. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance 2018, 23, 17-00672. [Google Scholar] [CrossRef] [PubMed]
  29. Borowiak, M.; Fischer, J.; Hammerl, J.A.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi B. J. Antimicrob. Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef]
  30. Fantelli, K.; Stephan, R. Prevalence and characteristics of Shigatoxin-producing Escherichia coli and Listeria monocytogenes strains isolated from minced meat in Switzerland. Int. J. Food Microbiol. 2001, 70, 63–69. [Google Scholar] [CrossRef]
  31. Ju, W.; Shen, J.; Li, Y.; Toro, M.A.; Zhao, S.; Ayers, S.; Najjar, M.B.; Meng, J. Non-O157 Shiga toxin-producing Escherichia coli in retail ground beef and pork in the Washington D.C. area. Food Microbiol. 2012, 32, 371–377. [Google Scholar] [CrossRef] [PubMed]
  32. Momtaz, H.; Dehkordi, F.S.; Rahimi, E.; Ezadi, H.; Arab, R. Incidence of Shiga toxin-producing Escherichia coli serogroups in ruminant’s meat. Meat Sci. 2013, 95, 381–388. [Google Scholar] [CrossRef] [PubMed]
  33. Barlow, R.S.; Gobius, K.S.; Desmarchelier, P.M. Shiga toxin-producing Escherichia coli in ground beef and lamb cuts: Results of a one-year study. Int. J. Food Microbiol. 2006, 111, 1–5. [Google Scholar] [CrossRef]
  34. Egervärn, M.; Flink, C. Shiga toxin-producing Escherichia coli (STEC) in meat and leafy greens available in the Swedish retail market—Occurrence and diversity of stx subtypes and serotypes. Int. J. Food Microbiol. 2024, 408, 110446. [Google Scholar] [CrossRef] [PubMed]
  35. Gould, L.H.; Mody, R.K.; Ong, K.L.; Clogher, P.; Cronquist, A.B.; Garman, K.N.; Lathrop, S.; Medus, C.; Spina, N.L.; Webb, T.H.; et al. Increased recognition of non-O157 Shiga toxin–producing Escherichia coli infections in the United States during 2000–2010: Epidemiologic features and comparison with E. coli O157 infections. Foodborne Pathog. Dis. 2013, 10, 453–460. [Google Scholar] [CrossRef] [PubMed]
  36. Krüger, A.; Lucchesi, P.M.; Sanso, A.M.; Etcheverría, A.I.; Bustamante, A.V.; Burgán, J.; Fernández, L.; Fernández, D.; Leotta, G.; Friedrich, A.W.; et al. Genetic characterization of Shiga toxin-producing Escherichia coli O26: H11 strains isolated from animal, food, and clinical samples. Front. Cell. Infect. Microbiol. 2015, 5, 74. [Google Scholar] [CrossRef]
  37. EFSA. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2015. EFSA J. 2016, 14, e04634. [Google Scholar] [CrossRef]
  38. Iwu, C.J.; Iweriebor, B.C.; Obi, L.C.; Okoh, A.I. Occurrence of non-O157 Shiga toxin-producing Escherichia coli in two commercial swine farms in the Eastern Cape Province, South Africa. Comp. Immunol. Microbiol. Infect. Dis. 2016, 44, 48–53. [Google Scholar] [CrossRef]
  39. Gökmen, M.; İlhan, Z.; Tavşanlı, H.; Önen, A.; Ektik, N.; Göçmez, E.B. Prevalence and molecular characterization of shiga toxin-producing Escherichia coli in animal source foods and green leafy vegetables. Food Sci. Technol. Int. 2024, 30, 30–36. [Google Scholar] [CrossRef]
  40. Ojo, O.E.; Ajuwape, A.T.P.; Otesile, E.B.; Owoade, A.A.; Oyekunle, M.A.; Adetosoye, A.I. Potentially zoonotic shiga toxin-producing Escherichia coli serogroups in the faeces and meat of food-producing animals in Ibadan, Nigeria. Int. J. Food Microbiol. 2010, 142, 214–221. [Google Scholar] [CrossRef]
  41. Karama, M.; Cenci-Goga, B.T.; Malahlela, M.; Smith, A.M.; Keddy, K.H.; El-Ashram, S.; Kabiru, L.M.; Kalake, A. Virulence Characteristics and Antimicrobial Resistance Profiles of Shiga Toxin-Producing Escherichia coli Isolates from Humans in South Africa: 2006–2013. Toxins 2019, 11, 424. [Google Scholar] [CrossRef]
  42. Johannes, L.; Römer, W. Shiga toxins—From cell biology to biomedical applications. Nat. Rev. Microbiol. 2010, 8, 105–116. [Google Scholar] [CrossRef] [PubMed]
  43. Brusa, V.; Aliverti, V.; Aliverti, F.; Ortega, E.E.; de la Torre, J.H.; Linares, L.H.; Sanz, M.E.; Etcheverría, A.I.; Padola, N.L.; Galli, L.; et al. Shiga toxin-producing Escherichia coli in beef retail markets from Argentina. Front. Cell. Infect. Microbiol. 2013, 2, 171. [Google Scholar] [CrossRef]
  44. Paton, J.C.; Paton, A.W. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 1998, 11, 450–479. [Google Scholar] [CrossRef] [PubMed]
  45. Paton, A.W.; Srimanote, P.; Talbot, U.M.; Wang, H.; Paton, J.C. A new family of potent AB(5) cytotoxins produced by Shiga toxigenic Escherichia coli. J. Exp. Med. 2004, 200, 35–46. [Google Scholar] [CrossRef] [PubMed]
  46. Werber, D.; Fruth, A.; Buchholz, U.; Prager, R.; Kramer, M.H.; Ammon, A.; Tschäpe, H. Strong Association between Shiga Toxin-Producing Escherichia coli O157 and Virulence Genes stx2 and eae as Possible Explanation for Predominance of Serogroup O157 in Patients with Haemolytic Uraemic Syndrome. Eur. J. Clin. Microbiol. Infect. Dis. 2003, 22, 726–730. [Google Scholar] [CrossRef] [PubMed]
  47. Nong, F.; Zhang, P.; Meng, J.; Xie, Q.; Li, Y.; Pan, Y.; Zhao, Y.; Liu, H. Characterization of Shiga-toxin producing Escherichia coli (STEC) isolated from retail raw meats in Southeast China. Food Control 2021, 126, 108061. [Google Scholar] [CrossRef]
  48. Jiang, C.; An, T.; Wang, S.; Wang, G.; Si, W.; Tu, Y.; Liu, Y.; Wu, J.; Liu, S.; Cai, X. Role of the ehxa gene from Escherichia coli serotype O82 in hemolysis, biofilm formation, and in vivo virulence. Can. J. Microbiol. 2015, 61, 335–341. [Google Scholar] [CrossRef] [PubMed]
  49. Van Cuong, N.; Nhung, N.T.; Nghia, N.H.; Mai Hoa, N.T.; Trung, N.V.; Thwaites, G.; Carrique-Mas, J. Antimicrobial Consumption in Medicated Feeds in Vietnamese Pig and Poultry Production. Ecohealth 2016, 13, 490–498. [Google Scholar] [CrossRef]
  50. Ahmed, A.M.; Shimamoto, T. Molecular analysis of multidrug resistance in Shiga toxin-producing Escherichia coli O157: H7 isolated from meat and dairy products. Int. J. Food Microbiol. 2015, 193, 68–73. [Google Scholar] [CrossRef] [PubMed]
  51. Rubab, M.; Oh, D.H. Virulence characteristics and antibiotic resistance profiles of shiga toxin-producing Escherichia coli isolates from diverse sources. Antibiotics 2020, 9, 587. [Google Scholar] [CrossRef] [PubMed]
  52. Cergole-Novella, M.C.; Pignatari, A.C.C.; Castanheira, M.; Guth, B.E.C. Molecular typing of antimicrobial-resistant Shiga-toxin-producing Escherichia coli strains (STEC) in Brazil. Res. Microbiol. 2011, 162, 117–123. [Google Scholar] [CrossRef]
  53. World Health Organization. Critically Important Antimicrobials for Human Medicine: 6th Revision 2018; World Health Organization: Geneva, Switzerland, 2019. [Google Scholar]
  54. Di, K.N.; Pham, D.T.; Tee, T.S.; Binh, Q.A.; Nguyen, T.C. Antibiotic usage and resistance in animal production in Vietnam: A review of existing literature. Trop. Anim. Health Prod. 2021, 53, 340. [Google Scholar] [CrossRef]
  55. Carrique-Mas, J.J.; Trung, N.V.; Hoa, N.T.; Mai, H.H.; Thanh, T.H.; Campbell, J.I.; Wagenaar, J.A.; Hardon, A.; Hieu, T.Q.; Schultsz, C. Antimicrobial usage in chicken production in the mekong delta of vietnam. Zoonoses Public Health 2015, 62, 70–78. [Google Scholar] [CrossRef] [PubMed]
  56. Dang, P.K.; Saegerman, C.; Douny, C.; Ton Vu Dinh, T.V.D.; Xuan BoHa, X.B.; Binh Dang Vu, B.D.V.; Ngan Pham Hong, N.P.H.; Scippo, M.L. First Survey on the Use of Antibiotics in Pig and Poultry Production in the Red River Delta Region of Vietnam. Food Public Health 2013, 3, 247–256. [Google Scholar]
  57. Luu, Q.H.; Nguyen, T.L.A.; Pham, T.N.; Vo, N.G.; Padungtod, P. Antimicrobial use in household, semi-industrialized, and industrialized pig and poultry farms in Viet Nam. Prev. Vet. Med. 2021, 189, 105292. [Google Scholar] [CrossRef] [PubMed]
  58. Bai, L.; Hurley, D.; Li, J.; Meng, Q.; Wang, J.; Fanning, S.; Xiong, Y. Characterisation of multidrug-resistant Shiga toxin-producing Escherichia coli cultured from pigs in China: Co-occurrence of extended-spectrum β-lactamase- and mcr-1-encoding genes on plasmids. Int. J. Antimicrob. Agents 2016, 48, 445–448. [Google Scholar] [CrossRef]
Table 1. Primer for detecting STEC virulence-associated genes and serogroups-specific genes.
Table 1. Primer for detecting STEC virulence-associated genes and serogroups-specific genes.
Target GenePrimerPrimer SequenceAmplicon
Size (bp)
stx1stx1-FTGTCGCATAGTGGAACCTCA655
stx1-RTGCGCACTGAGAAGAAGAGA
stx2stx2-FCCATGACAACGGACAGCAGTT477
stx2-RTGTCGCCAGTTATCTGACATTC
rfbO157O157-FCAGGTGAAGGTGGAATGGTTGTC296
O157-RTTAGAATTGAGACCATCCAATAAG
wzxO45O45-FGGGGCTGTCCAGACAGTTCAT890
O45-RTGTACTGCACCCAATGCACCT
wzxO103O103-FGCAGAAAATCAAGGTGATTACG740
O103-RGGTTAAAGCCATGCTCAACG
wzqEO121/wzqFO121O121-FTCAGCAGAGTGGAACTAATTTTGT587
O121-RTGAGCACTAGATGAAAAGTATGGCT
wzxO145O145-FTCAAGTGTTGGATTAAGAGGGATT523
O145-RCACTCGCGGACACAGTACC
wzxO26O26-FAGGGTGCGAATGCCATATT417
O26-RGACATAATGACATACCACGAGCA
wzxO111O111-FTGCATCTTCATTATCACACCA230
O111-RACCGCAAATGCGATAATAACA
eaeeae-FCATTATGGAACGGCAGAGGT375
eae-RACGGATATCGAAGCCATTTG
ehxAehxA-FGCGAGCTAAGCAGCTTGAAT199
ehxA-RCTGGAGGCTGCACTAACTCC
Table 2. Primers for detecting β-lactamase-encoding genes.
Table 2. Primers for detecting β-lactamase-encoding genes.
Target GenePrimerPrimer SequenceAmplicon Size (bp)
blaTEMTEM-FGGTCGCCGCATACACTATTCTC372
TEM-RTTTTATCCGCCTCCATCCAGTC
blaSHVSHV-FCCAGCAGGATCTGGTGGACTAC231
SHV-RCCGGGAAGCGCCCTCCAT
blaCTX-M-1CTX-M1-FGAATTAGAGCGGGAGTCGGG588
CTX-M1-RCACAACCCAGGAAGCAGGC
blaCTX-M-2CTX-M2-FGATGGCGACGCTACCCC107
CTX-M2-RCAAGCCGACCTCCCGAAC
blaCTX-M-9CTX-M9-FGTGCAACGGATGATGTTCGC475
CTX-M9-RGAAACGTCTCATCGCCGATC
blaCTX-M-8/25CTX-M8/25-FGCGACCCGCGCGATAC186
CTX-M8/25-RTGCCGGTTTTATCCCCG
Table 3. Primers for the detection of mcr genes.
Table 3. Primers for the detection of mcr genes.
Target GenePrimerPrimer SequenceAmplicon Size (bp)Reference
mcr-1mcr1 fAGTCCGTTTGTTCTTGTGGC320[28]
mcr1 rAGATCCTTGGTCTCGGCTTG
mcr-2mcr2 fCAAGTGTGTTGGTCGCAGTT715[28]
mcr2 rTCTAGCCCGACAAGCATACC
mcr-3mcr 3 fAAATAAAAATTGTTCCGCTTATG929[28]
mcr3 rAATGGAGATCCCCGTTTTT
mcr-4mcr4 fTCACTTTCATCACTGCGTTG1116[28]
mcr4 rTTGGTCCATGACTACCAATG
mcr-5mcr5 fATGCGGTTGTCTGCATTTATC1644[29]
mcr 5 rTCATTGTGGTTGTCCTTTTCTG
Table 4. Prevalence of stx genes and STEC in meat.
Table 4. Prevalence of stx genes and STEC in meat.
Market TypeMeat TypeNo. of Samples TestedDetection of stx Genes in Meat SamplesIsolation of STEC
Number of Positive Samples
(%)		No. of Samples Positive for Gene (%)Number of Positive Samples
(%)		No. of STEC Positive for Gene
stx1stx2stx1 and stx2stx1stx2stx1 and stx2
Wet MarketBeef369 (25)2 (5.56)8 (22.22)1 (2.78)4 (11.11)07 0
Pork366 (16.67)0 (0)6 (16.67)0 (0)2 (5.56)0 3 0
Chicken366 (16.67)2 (5.56)5 (13.89)1 (2.78)1 (2.78)2 00
Total10821 (19.44)4 (3.7)19 (17.59)2(1.85)7 (6.48)2 10 0
SupermarketBeef368 (22.22)3 (8.33)5 (13.89)0 (0)3 (8.33)0 6 0
Pork365 (13.89)2 (5.56)3 (8.33)0 (0)2 (5.56)0 3 0
Chicken361 (2.78)0 (0)1 (2.78)0 (0)0 (0)0 00
Total10814 (12.96)5 (4.63)9 (8.33)0 (0)5 (4.63)0 90
TotalBeef7217 (23.61)5 (6.94)13 (18.06)1 (1.39)7 (9.72)013 0
Pork7211 (15.28)2 (2.78)9 (12.5)0 (0)4 (5.56)0 60
Chicken727 (9.72)2 (2.78)6 (8.33)1 (1.39)1 (1.39)2 00
Total21635 (16.2)9 (4.17)28 (12.96)2 (0.93)12 (5.56)2 19 0
Table 5. Virulence-associated genes and antibiotic resistance patterns of STEC isolates.
Table 5. Virulence-associated genes and antibiotic resistance patterns of STEC isolates.
Meat TypeSerotypestx Gene Accessory Virulence GeneAntibiotic Resistance Pattern
eaeehxA
Beef (n = 7)USTstx2++AMP-STR-TET-FLO-STX
USTstx2−−AMP-TET
USTstx2−−TET-FLO-STX
USTstx2−+AMP-STR-TET-STX
USTstx2−+AMP-STR-TET-NAL-STX
O157stx2++AMP-GEN-STR-TET-CST-FLO-AZM-STX
USTstx2−+AMP-CTX-FEP-CAZ-STR-TET-FLO-CIP-NAL-STX
Pork (n = 4)USTstx2−+AMP-AZM
O26stx2+−AMP-STR-TET-FLO-STX
USTstx2−−AMP-STR-TET-FLO-STX
USTstx2−−AMP-STR-TET-CST-FLO-NAL-STX
Chicken (n = 1)O111stx1++AMP-CTX-FEP-CAZ-GEN-STR-TET-CST-FLO-AZM-CIP-NAL-STX
UST, unserotypeable; (+), Positive; (−), Negative; AMP, ampicillin; CTX, cefotaxime; FEP, cefepime; CAZ, ceftazidime; TET, tetracycline; STR, streptomycin; GEN, gentamicin; AZM, azithromycin; FLO, florfenicol; SXT, trimethoprim/sulfamethoxazole; CIP, ciprofloxacin; NAL, nalidixic acid; CST, colistin.
Table 6. Antibiotic resistance profile of STEC isolates.
Table 6. Antibiotic resistance profile of STEC isolates.
Antibiotic ClassAntibioticNo. of Isolates (Resistance Rate %)
Beef (n = 7)Pork (n = 4)Chicken (n = 1)Total (n = 12)
Penicillinsampicillin6 (85.71)4 (100)1 (100)11 (91.67)
cefoxitin0 (0)0 (0)0 (0)0 (0)
Cephalosporinscefotaxime 1 (14.29)0 (0)1 (100)2 (16.67)
ceftazidime 1 (14.29)0 (0)1 (100)2 (16.67)
cefepime1 (14.29)0 (0)1 (100)2 (16.67)
Cabarpenemsmeropenem0 (0)0 (0)0 (0)0 (0)
Polymyxinscolistin1 (14.29)1 (25)1 (100)3 (25)
Aminoglycosidesgentamicin1 (14.29)0 (0)1 (100)2 (16.67)
streptomycin5 (71.43)3 (75)1 (100)9 (75)
Tetracyclinestetracycline7 (100)3 (75)1 (100)11 (91.67)
Phenicolsflorfenicol4 (57.14)3 (75)1 (100)8 (66.67)
Macrolidesazithromycin1 (14.29)1 (25)1 (100)3 (25)
Fluoroquinolonesciprofloxacin1 (14.29)0 (0)1 (100)2 (16.67)
Quinolonesnalidixic acid2 (28.57)1 (25)1 (100)4 (33.33)
Sulfonamidestrimethoprim/
sulfamethoxazole		6 (85.71)3 (75)1 (100)10 (83.33)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Duc, H.M.; Ha, C.T.T.; Hoa, T.T.K.; Hung, L.V.; Thang, N.V.; Son, H.M. Prevalence, Molecular Characterization, and Antimicrobial Resistance Profiles of Shiga Toxin-Producing Escherichia coli Isolated from Raw Beef, Pork, and Chicken Meat in Vietnam. Foods 2024, 13, 2059. https://doi.org/10.3390/foods13132059

AMA Style

Duc HM, Ha CTT, Hoa TTK, Hung LV, Thang NV, Son HM. Prevalence, Molecular Characterization, and Antimicrobial Resistance Profiles of Shiga Toxin-Producing Escherichia coli Isolated from Raw Beef, Pork, and Chicken Meat in Vietnam. Foods. 2024; 13(13):2059. https://doi.org/10.3390/foods13132059

Chicago/Turabian Style

Duc, Hoang Minh, Cam Thi Thu Ha, Tran Thi Khanh Hoa, Le Van Hung, Nguyen Van Thang, and Hoang Minh Son. 2024. "Prevalence, Molecular Characterization, and Antimicrobial Resistance Profiles of Shiga Toxin-Producing Escherichia coli Isolated from Raw Beef, Pork, and Chicken Meat in Vietnam" Foods 13, no. 13: 2059. https://doi.org/10.3390/foods13132059

APA Style

Duc, H. M., Ha, C. T. T., Hoa, T. T. K., Hung, L. V., Thang, N. V., & Son, H. M. (2024). Prevalence, Molecular Characterization, and Antimicrobial Resistance Profiles of Shiga Toxin-Producing Escherichia coli Isolated from Raw Beef, Pork, and Chicken Meat in Vietnam. Foods, 13(13), 2059. https://doi.org/10.3390/foods13132059

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop