The Effects of Paddy Cultivation and Microbiota Members on Arsenic Accumulation in Rice Grain
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling Site Selection and Sample Collection
2.2. Arsenic Analysis of Various Plant Tissues, Soil, and Water
2.3. Preparation of Total Bacterial DNA
2.4. Primers
2.5. Quantitative Real-Time PCR (qRT-PCR) Conditions
2.6. Next-Generation Sequencing (NGS) and Metabarcoding
3. Results
3.1. Characteristics of the Sampling Sites and Samples
3.2. Chemical Analysis
3.3. Quantification of the Total Bacteria and arsC and mcrA Genes in Paddy Samples by qRT-PCR
3.4. Bacterial Diversity of Water, Soil, and Sludge Samples from Rice Farms
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kennedy, D. The Importance of Rice. Science 2002, 296, 13. [Google Scholar] [CrossRef] [PubMed]
- Smith, P.; Martino, D.; Cai, Z.; Gwary, D.; Janzen, H.; Kumar, P.; McCarl, B.; Ogle, S.; O’Mara, F.; Rice, C.; et al. Greenhouse Gas Mitigation in Agriculture. Philos. Trans. R. Soc. Lond. B 2008, 363, 789–813. [Google Scholar] [CrossRef] [PubMed]
- Hare, V.; Chowdhary, P. Changes in Growth Responses in Rice Plants Grown in the Arsenic Affected Area: Implication of As Resistant Microbes in Mineral Content and Translocation. SN Appl. Sci. 2019, 1, 882. [Google Scholar] [CrossRef]
- Islam, S.F.U.; Sander, B.O.; Quilty, J.R.; De Neergaard, A.; Van Groenigen, J.W.; Jensen, L.S. Mitigation of Greenhouse Gas Emissions and Reduced Irrigation Water Use in Rice Production Through Water-Saving Irrigation Scheduling, Reduced Tillage and Fertiliser Application Strategies. Sci. Total Environ. 2020, 739, 140215. [Google Scholar] [CrossRef] [PubMed]
- Rokonuzzaman, M.; Chin, L.W.; Bon, M.Y.; Fai, T.Y.; Zhihong, Y. Arsenic Accumulation in Rice: Sources, Human Health Impact and Probable Mitigation Approaches. Rice Sci. 2022, 29, 309–327. [Google Scholar] [CrossRef]
- Chen, Y.; Han, Y.H.; Cao, Y.; Zhu, Y.G.; Rathinasabapathi, B.; Ma, L.Q. Arsenic Transport in Rice and Biological Solutions to Reduce Arsenic Risk From Rice. Front. Plant Sci. 2017, 8, 268. [Google Scholar] [CrossRef]
- Zhao, F.J.; McGrath, S.P.; Meharg, A.A. Arsenic as a Food Chain Contaminant: Mechanisms of Plant Uptake and Metabolism and Mitigation Strategies. Annu. Rev. Plant Biol. 2010, 61, 535–559. [Google Scholar] [CrossRef]
- Majumder, S.; Banik, P. Geographical Variation of Arsenic Distribution in Paddy Soil, Rice and Rice-Based Products: A Meta-Analytic Approach and Implications to Human Health. J. Environ. Manag. 2019, 233, 184–199. [Google Scholar] [CrossRef]
- Shikawa, S.; Arao, T.; Makino, T. Agronomic Strategies for Reducing Arsenic Risk in Rice. In Arsenic Contamination in Asia; Yamauchi, H., Sun, G., Eds.; Springer: Singapore, 2019; pp. 181–198. [Google Scholar]
- Upadhyay, M.K.; Majumdar, A.; Suresh Kumar, J.; Srivastava, S. Arsenic in Rice Agro-Ecosystem: Solutions for Safe and Sustainable Rice Production. Front. Sustain. Food Syst. 2020, 4, 53. [Google Scholar] [CrossRef]
- Williams, P.N.; Villada, A.; Deacon, C.; Raab, A.; Figuerola, J.; Green, A.J.; Feldmann, J.; Meharg, A.A. Greatly Enhanced Arsenic Shoot Assimilation in Rice Leads to Elevated Grain Levels Compared to Wheat and Barley. Environ. Sci. Technol. 2007, 41, 6854–6859. [Google Scholar] [CrossRef]
- Upadhyay, M.K.; Shukla, A.; Yadav, P.; Srivastava, S. A Review of Arsenic in Crops, Vegetables, Animals and Food Products. Food Chem. 2019, 276, 608–618. [Google Scholar] [CrossRef]
- Zhang, S.Y.; Zhao, F.J.; Sun, G.X.; Su, J.Q.; Yang, X.R.; Li, H.; Zhu, Y.G. Diversity and Abundance of Arsenic Biotransformation Genes in Paddy Soils from Southern China. Environ. Sci. Technol. 2015, 49, 4138–4146. [Google Scholar] [CrossRef]
- Rosenstein, R.; Peschel, A.; Wieland, B.; Gotz, F. Expression and Regulation of the Antimonite, Arsenite, and Arsenate Resistance Operon of Staphylococcus xylosus Plasmid pSX267. J. Bacteriol. 1992, 174, 3676–3683. [Google Scholar] [CrossRef]
- Carlin, A.; Shi, W.; Dey, S.; Rosen, B.P. The ars Operon of Escherichia coli Confers Arsenical and Antimonial Resistance. J. Bacteriol. 1995, 177, 981–986. [Google Scholar] [CrossRef]
- Cai, J.; Salmon, K.; DuBow, M.S. A Chromosomal ars Operon Homologue of Pseudomonas aeruginosa Confers Increased Resistance To Arsenic And Antimony In Escherichia coli. Microbiology 1998, 144, 2705–2729. [Google Scholar] [CrossRef]
- Prithivirajsingh, S.; Mishra, S.K.; Mahadevan, A. Functional Analysis of a Chromosomal Arsenic Resistance Operon in Pseudomonas fluorescens Strain MSP3. Mol. Biol. Rep. 2001, 28, 63–72. [Google Scholar] [CrossRef]
- Govarthanan, M.; Lee, S.M.; Kamala-Kannan, S.; Oh, B.T. Characterization, Real-Time Quantification and in Silico Modeling of Arsenate Reductase (arsC) Genes in Arsenic-Resistant Herbaspirillum sp. GW103. Res. Microbiol. 2015, 166, 196–204. [Google Scholar] [CrossRef]
- Mukhopadhyay, R.; Rosen, B.P.; Phung, L.T.; Silver, S. Microbial Arsenic: From Geocycles to Genes and Enzymes. FEMS Microbiol. Rev. 2002, 26, 311–325. [Google Scholar] [CrossRef]
- Achour, A.R.; Bauda, P.; Billard, P. Diversity of Arsenite Transporter Genes From Arsenic-Resistant Soil Bacteria. Res. Microbiol. 2007, 158, 128–137. [Google Scholar] [CrossRef]
- Brye, K.R.; Nalley, L.L.; Tack, J.B.; Dixon, B.L.; Barkley, A.P.; Rogers, C.W.; Smartt, A.D.; Norman, R.J.; Jagadish, K.S.V. Factors Affecting Methane Emissions From Rice Production in The Lower Mississippi River Valley, USA. Geoderma Reg. 2016, 7, 223–229. [Google Scholar] [CrossRef]
- Steinberg, L.M.; Regan, J.M. mcrA-targeted Real-Time Quantitative PCR Method to Examine Methanogen Communities. Appl. Environ. Microbiol. 2009, 75, 4435–4442. [Google Scholar] [CrossRef] [PubMed]
- Heid, C.A.; Stevens, J.; Livak, K.J.; Williams, P.M. Real Time Quantitative PCR. Genome Res. 1996, 6, 986–994. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative Real-Time RT-PCR–A Perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.U.H.; Gannon, V.; Kent, R.; Koning, W.; Lapen, D.R.; Miller, J.; Neumann, N.; Phillips, R.; Robertson, W.; Topp, E.; et al. Development of A Rapid Quantitative PCR Assay for Direct Detection and Quantification of Culturable and Non-culturable Escherichia coli from Agriculture Watersheds. J. Microbiol. Methods. 2007, 69, 480–488. [Google Scholar] [CrossRef] [PubMed]
- Udvardi, M.K.; Czechowski, T.; Scheible, W.R. Eleven Golden Rules of Quantitative RT-PCR. Plant Cell 2008, 20, 1736–1737. [Google Scholar] [CrossRef]
- Antonkiewicz, J.; Gworek, B. Remediation of Contaminated Soils and Lands; Wydawnictwo Naukowe PWN: Warsaw, Poland, 2023; p. 2002. ISBN 978-83-01-22827-9. [Google Scholar]
- Yang, L.; Donahoe, R.J.; Redwine, J.C. In Situ Chemical Fixation of Arsenic-Contaminated Soils: An Experimental Study. Sci. Total Environ. 2007, 387, 28–41. [Google Scholar] [CrossRef]
- Ersoy Omeroglu, E.; Sudagidan, M.; Ogun, E. Arsenic Pollution and Anaerobic Arsenic Metabolizing Bacteria in Lake Van, the World’s Largest Soda Lake. Life 2022, 12, 1900. [Google Scholar] [CrossRef]
- Corbisier, P.; Ji, G.; Nuyts, G.; Mergeay, M.; Silver, S. luxAB Gene Fusions with the Arsenic and Cadmium Resistance Operons of Staphylococcus aureus Plasmid pI258. FEMS Microbiol. Lett. 1993, 110, 231–238. [Google Scholar] [CrossRef]
- Omidinia, E.; Samadi, A.; Taherkhani, H.; Khatami, S.; Moazami, N.; Pouraie, R.R.; Asano, Y. Cloning and Expression of Bacillus sphaericus Phenylalanine Dehydrogenase Gene in Bacillus subtilis Cells: Purification and Enzyme Properties. World J. Microbiol. Biotechnol. 2002, 18, 593–597. [Google Scholar] [CrossRef]
- Suzuki, K.; Wakao, N.; Sakurai, Y.; Kimura, T.; Sakka, K.; Ohmiya, K. Transformation of Escherichia coli with a Large Plasmid of Acidiphilium multivorum AIU 301 Encoding Arsenic Resistance. Appl. Environ. Microbiol. 1997, 63, 2089–2091. [Google Scholar] [CrossRef]
- Antonella, P.; Luca, G. The Quantitative Real-Time PCR Applications in the Monitoring of Marine Harmful Algal Bloom (HAB) Species. Environ. Sci. Poll. Res. 2013, 20, 6851–6862. [Google Scholar] [CrossRef]
- Sun, Y.; Polishchuk, E.A.; Radoja, U.; Cullen, W.R. Identification and Quantification of arsC Genes in Environmental Samples by Using Real-Time PCR. J. Microbiol. Methods. 2004, 58, 335–349. [Google Scholar] [CrossRef]
- Ersoy Omeroglu, E.; Sudagidan, M.; Yurt, M.N.Z.; Tasbasi, B.B.; Acar, E.E.; Ozalp, V.C. Microbial Community of Soda Lake Van as Obtained from Direct and Enriched Water, Sediment and Fish Samples. Sci. Rep. 2021, 11, 18364. [Google Scholar] [CrossRef]
- Mazumder, D.N.G.; Ghosh, A.; Majumdar, K.K.; Ghosh, N.; Saha, C.; Mazumder, R. Arsenic Contamination of Ground Water and Its Health İmpact on Population of District of Nadia, West Bengal, India. Indian J. Commun. Med. 2010, 35, 331–338. [Google Scholar] [CrossRef]
- Zhang, H.; Huo, S.; Yeager, K.M.; Xi, B.; Zhang, J.; He, Z.; Ma, C.; Wu, F. Accumulation of Arsenic, Mercury and Heavy Metals in Lacustrine Sediment in Relation to Eutrophication: Impacts of Sources and Climate Change. Ecol. Indic. 2018, 93, 771–780. [Google Scholar] [CrossRef]
- Naik, P.K. Remediation of Arsenic Contamination in Groundwater. In Proceedings of the Workshop on ‘Arsenic Contamination in Groundwater’, Chandigarh, India, 26 March 2015; pp. 1–14. [Google Scholar]
- Mackenzie, J.S.; Jeggo, M. The One Health Approach—Why is It So Important? Trop. Med. Infect. Dis. 2019, 4, 88. [Google Scholar] [CrossRef]
- Rahman, M.S.; Jamal, M.A.H.M.; Biswas, P.K.; Rahman, S.M.; Sharma, S.P.; Saha, S.K.; Hong, S.T.; Islam, M.R. Arsenic Remediation in Bangladeshi Rice Varieties with Enhance Plant Growth by Unique Arsenic-Resistant Bacterial Isolates. Geomicrobiol. J. 2020, 37, 130–142. [Google Scholar] [CrossRef]
- Schimel, J. Rice, Microbes and Methane. Nature 2000, 403, 375–377. [Google Scholar] [CrossRef]
- Chakraborti, D.; Mukherjee, S.C.; Pati, S.; Sengupta, M.K.; Rahman, M.M.; Chowdhury, U.K.; Lodh, D.; Chanda, C.R.; Chakraborti, A.K.; Basu, G.K. Arsenic Groundwater Contamination in Middle Ganga Plain, Bihar, India: A Future Danger? Environ. Health Perspect. 2003, 111, 1194–1201. [Google Scholar] [CrossRef]
- Rahman, M.A.; Hasegawaa, H.; Rahman, M.M.; Miah, M.A.M.; Tasmin, A. Arsenic Accumulation in Rice (Oryza sativa L.): Human Exposure Through Food Chain. Ecotoxicol. Environ. Saf. 2008, 69, 317–324. [Google Scholar] [CrossRef]
- Chowdhury, N.R.; Das, R.; Joardar, M.; Ghosh, S.; Bhowmick, S.; Roychowdhury, T. Arsenic Accumulation in Paddy Plants at Different Phases of Pre-Monsoon Cultivation. Chemosphere 2018, 210, 987–997. [Google Scholar] [CrossRef] [PubMed]
- Häder, D.P.; Banaszak, A.T.; Villafañe, V.E.; Narvarte, M.A.; González, R.A.; Helbling, E.W. Anthropogenic Pollution of Aquatic Ecosystems: Emerging Problems with Global İmplications. Sci. Total Environ. 2020, 713, 136586. [Google Scholar] [CrossRef] [PubMed]
- Mitra, A.; Chatterjee, S.; Moogouei, R.; Gupta, D.K. Arsenic Accumulation in Rice and Probable Mitigation Approaches: A Review. Agronomy 2017, 7, 67. [Google Scholar] [CrossRef]
- Lenart-Boroń, A.; Boroń, P. The Effect of İndustrial Heavy Metal Pollution on Microbial Abundance and Diversity in Soils—A Review; IntechOpen: London, UK, 2014. [Google Scholar]
- Bagi, A.; Knapik, K.; Baussant, T. Abundance and Diversity of N-Alkane and PAH-Degrading Bacteria and Their Functional Genes–Potential for Use in Detection of Marine Oil Pollution. Sci. Total Environ. 2022, 810, 152238. [Google Scholar] [CrossRef] [PubMed]
- Paruch, L.; Paruch, A.M.; Eiken, H.G.; Sørheim, R. Faecal pollution Affects Abundance and Diversity of Aquatic Microbial Community in Anthropo-Zoogenically İnfluenced Lotic Ecosystems. Sci. Rep. 2019, 9, 19469. [Google Scholar] [CrossRef] [PubMed]
- Ben Fekih, I.; Zhang, C.; Li, Y.P.; Zhao, Y.; Alwathnani, H.A.; Saquib, Q.; Rensing, C.; Cervantes, C. Distribution of Arsenic Resistance Genes in Prokaryotes. Front. Microbiol. 2018, 9, 2473. [Google Scholar] [CrossRef]
- Ji, G.; Silver, S. Reduction of Arsenate to Arsenite by the ArsC Protein of the Arsenic Resistance Operon of Staphylococcus aureus Plasmid pI258. Proc. Nat. Acad. Sci. USA 1992, 89, 9474–9478. [Google Scholar] [CrossRef]
- Meharg, A.A.; Jardine, L. Arsenite Transport into Paddy Rice (Oryza sativa) Roots. New Phytol. 2003, 157, 39–44. [Google Scholar] [CrossRef]
- Ma, J.F.; Yamaji, N.; Mitani, N.; Xu, X.Y.; Su, Y.H.; McGrath, S.P.; Zhao, F.J. Transporters of Arsenite in Rice and Their Role in Arsenic Accumulation in Rice Grain. Proc. Nat. Acad. Sci. USA 2008, 105, 9931–9935. [Google Scholar] [CrossRef]
- Su, Y.H.; McGrath, S.P.; Zhao, F.J. Rice is More Efficient in Arsenite Uptake and Translocation Than Wheat and Barley. Plant Soil 2010, 328, 27–34. [Google Scholar] [CrossRef]
- Lee, H.J.; Kim, S.Y.; Kim, P.J.; Madsen, E.L.; Jeon, C.O. Methane Emission and Dynamics of Methanotrophic and Methanogenic Communities in a Flooded Rice Field Ecosystem. FEMS Microbiol. Ecol. 2014, 88, 195–212. [Google Scholar] [CrossRef]
- Hahn, M.W.; Kasalický, V.; Jezbera, J.; Brandt, U.; Jezberova, J.; Šimek, K. Limnohabitans curvus gen. nov., sp. nov., A Planktonic Bacterium Isolated from A Freshwater Lake. Int. J. Syst. Evol. Microbiol. 2010, 60, 1358–1365. [Google Scholar] [CrossRef]
Primer Code | Primer Sequence (5′-3′) | |
---|---|---|
Arsenate reductase | arsC-F | AATGAGATWCTGATATGAGCAACAT |
arsC-F2 | TTGTAATGAGATWCTGATATGAGCA | |
arsC-R | CCRCTGTTGCGGATCATYTC | |
arsC-R2 | CCCATATCBGCAATRAGTTT | |
arsC-PMGB | FAM-ATGATCCGCAACAG-MGB-Q530 | |
Methyl coenzyme M reductase | Mcr_aF | ATG BTS TAY GAC CAG WTV TGG |
Mcr_aR | TAYCCGAAGAAKCCSAGTC | |
Mcr_P1 | FAM-TAC ATG TCA GGT GGT GTM GGA TT-BHQ1 | |
Mcr_P2 | FAM-TAC ATG AGC GGT GGT GTY GGT TT-BHQ1 | |
Mcr_R1 | CACTTCGGTGGTTCCCAGA | |
Mcr_R2 | CACTTCGGTGGATCGCA | |
Mcr_R3 | CACTTCGGTGGATCTGTT | |
Total bacteria | BAC338F | ACTCCTACGGGAGGCAG |
BAC805R | GACTACCAGGGTATCTAATC | |
BAC516 | FAM-TGCCAGCAGCCGCGGTAATAC-BHQ1 |
Region | Sample Code | Sample | Date | Time | Temperature | Depth | Irrigation Water | Soil Characteristic | Coordinates |
---|---|---|---|---|---|---|---|---|---|
Danakumu | DKS1 | Water | 6 May 2021 | 15:03 | 24 °C | 25 cm | Ground water | Light | Lat → 40°08′30″ N Long → 027°39′30″ E |
DKT1 | Soil | ||||||||
DKB1 | Sludge | 7 May 2021 | 14:30 | 29 °C | |||||
DKS2 | Water | 26 May 2021 (the first sprouding) | 10:48 | 21 °C | |||||
DKB2 | Sludge | ||||||||
DKR1 | Root | ||||||||
DKSh1 | Shoot | ||||||||
DKS3 | Water | 12 June 2021 (the first tillering) | 09:43 | 23 °C | |||||
DKB3 | Sludge | ||||||||
DKR2 | Root | ||||||||
DKSh2 | Shoot | ||||||||
DKS4 | Water | 17 September 2021 (grain formation) | 14:13 | 29 °C | |||||
DKB4 | Sludge | ||||||||
DKR3 | Root | ||||||||
DKSh3 | Shoot | ||||||||
DKP1 | Grain | ||||||||
DKK1 | Husk | ||||||||
DKG1 | Grain + Husk | ||||||||
Ulukır | UKS1 | Water | 6 May 2021 | 15:45 | 24 °C | 25 cm | Gönen River | Medium | Lat → 40°15′33″ N Long → 027°36′44″ E |
UKT1 | Soil | ||||||||
UKB1 | Sludge | 7 May 2021 | 15:36 | 29 °C | |||||
UKS2 | Water | 26 May 2021 (the first sprouding) | 12:00 | 19 °C | |||||
UKB2 | Sludge | ||||||||
UKR1 | Root | ||||||||
UKSh1 | Shoot | ||||||||
UKS3 | Water | 12 June 2021 (the first tillering) | 11:15 | 23 °C | |||||
UKB3 | Sludge | ||||||||
UKR2 | Root | ||||||||
UKSh2 | Shoot | ||||||||
UKS4 | Water | 17 September 2021 (grain formation) | 15:05 | 27 °C | |||||
UKB4 | Sludge | ||||||||
UKR3 | Root | ||||||||
UKSh3 | Shoot | ||||||||
UKP1 | Grain | ||||||||
UKK1 | Husk | ||||||||
UKG1 | Grain + Husk | ||||||||
Gündoğan | GDS1 | Water | 6 May 2021 | 17:00 | 24 °C | 25 cm | Gönen Yenice Dam | Heavy | Lat → 40°10′48″ N Long → 027°37′54″ E |
GDT1 | Soil | ||||||||
GDB1 | Sludge | 7 May 2021 | 15:09 | 29 °C | |||||
GDS2 | Water | 26 May 2021 (the first sprouding) | 11:32 | 20 °C | |||||
GDB2 | Sludge | ||||||||
GDR1 | Root | ||||||||
GDSh1 | Shoot | ||||||||
GDS3 | Water | 12 June 2021 (the first tillering) | 10:11 | 23 °C | |||||
GDB3 | Sludge | ||||||||
GDR2 | Root | ||||||||
GDSh2 | Shoot | ||||||||
GDS4 | Water | 17 September 2021 (grain formation) | 14:40 | 29 °C | |||||
GDB4 | Sludge | ||||||||
GDR3 | Root | ||||||||
GDSh3 | Shoot | ||||||||
GDP1 | Grain | ||||||||
GDK1 | Husk | ||||||||
GDG1 | Grain + Husk |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ersoy Omeroglu, E.; Bayer, A.; Sudagidan, M.; Ozalp, V.C.; Yasa, I. The Effects of Paddy Cultivation and Microbiota Members on Arsenic Accumulation in Rice Grain. Foods 2023, 12, 2155. https://doi.org/10.3390/foods12112155
Ersoy Omeroglu E, Bayer A, Sudagidan M, Ozalp VC, Yasa I. The Effects of Paddy Cultivation and Microbiota Members on Arsenic Accumulation in Rice Grain. Foods. 2023; 12(11):2155. https://doi.org/10.3390/foods12112155
Chicago/Turabian StyleErsoy Omeroglu, Esra, Asli Bayer, Mert Sudagidan, Veli Cengiz Ozalp, and Ihsan Yasa. 2023. "The Effects of Paddy Cultivation and Microbiota Members on Arsenic Accumulation in Rice Grain" Foods 12, no. 11: 2155. https://doi.org/10.3390/foods12112155
APA StyleErsoy Omeroglu, E., Bayer, A., Sudagidan, M., Ozalp, V. C., & Yasa, I. (2023). The Effects of Paddy Cultivation and Microbiota Members on Arsenic Accumulation in Rice Grain. Foods, 12(11), 2155. https://doi.org/10.3390/foods12112155