Antioxidant and Immunomodulatory Properties of Chia Protein Hydrolysates in Primary Human Monocyte–Macrophage Plasticity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Isolation of Chia Protein
2.2. Production of Chia Protein Hydrolysate
2.3. Chemical Characterization of Chia Isolate and Protein Hydrolysate
2.4. Isolation of Primary Human Monocytes
2.5. Cell Viability (MTT)
2.6. Differentiation and Polarization to Macrophages M1/M2
2.7. Reactive Oxygen Species (ROS) Production
2.8. Nitrite Production
2.9. Cytokine Quantification
2.10. RNA Isolation and RT-qPCR
2.11. Statistical Analysis
3. Results
3.1. Chemical Characterization of the CPI and CPH
3.2. CPH Decreases Oxidative Stress in Human Primary Monocytes
3.3. CPH Decreases Pro-Inflammatory Cytokine Levels and Gene Expression in Human Primary Monocytes
3.4. CPH Promotes M2 Polarization and Decreases the Pro-Inflammatory State in Human Monocyte-Derived Macrophages
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Santini, A.; Novellino, E. Nutraceuticals in hypercholesterolaemia: An overview. Br. J. Pharmacol. 2017, 174, 1450–1463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martínez-Leo, E.E.; Martín-Ortega, A.M.; Acebedo-Fernández, J.J.; Moo-Puc, R.; Segura-Campos, M.R. Peptides from Mucuna pruriens L., with protection and antioxidant in vitro effect on Hela cell line. J. Sci. Food Agric. 2019, 99, 4167–4173. [Google Scholar] [CrossRef] [PubMed]
- Ejima, A.; Nakamura, M.; Suzuki, Y.A.; Sato, K. Identification of food-derived peptides in human blood after ingestion of corn and wheat gluten hydrolysates. J. Food Bioact. 2018, 2, 104–111. [Google Scholar] [CrossRef] [Green Version]
- Lopez, D.; Galante, M.; Raimundo, G.; Spelzini, D.; Boeris, V. Functional properties of amaranth, quinoa and chía proteins and the biological activities of their hydrolysates. Food Res. Int. 2019, 116, 419–429. [Google Scholar] [CrossRef] [Green Version]
- Messina, V. Nutritional and health benefits of dried beans. Am. J Clin. Nutr. 2014, 100, 437S–442S. [Google Scholar] [CrossRef] [Green Version]
- Vernaza, M.G.; Dia, V.P.; de Mejia, E.G.; Chang, Y.K. Antioxidant and antiinflammatory properties of germinated and hydrolysed Brazilian soybean flours. Food Chem. 2012, 134, 2217–2225. [Google Scholar] [CrossRef]
- Millan-Linares, M.C.; Lemus-Conejo, A.; Yust, M.M.; Pedroche, J.; Carrillo-Vico, A.; Millán, F.; la Paz, S.M. GPETAFLR, a novel bioactive peptide from Lupinus angustifolius L. protein hydrolysate, reduces osteoclastogenesis. J. Funct. Foods 2018, 47, 299–303. [Google Scholar] [CrossRef] [Green Version]
- Perez-Ternero, C.; Claro, C.; Parrado, J.; Herrera, M.D.; de Sotomayor, M.A. Rice bran enzymatic extract reduces atherosclerotic plaque development and steatosis in high-fat fed ApoE−/− mice. Nutrition 2017, 37, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Martin, N.M.; la Paz, S.M.; Toscano, R.; Grao-Cruces, E.; Villanueva, A.; Pedroche, J.; Millan, F.; Millan-Linares, M.C. Hemp (Cannabis sativa L.) Protein Hydrolysates Promote Anti-Inflammatory Response in Primary Human Monocytes. Biomolecules 2020, 10, 803. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Zheng, L.; Jin, J.; Li, X.; Fu, J.; Wang, M.; Guan, Y.; Song, X. Phytochemical and Biological Characteristics of Mexican chia Seed Oil. Molecules 2018, 23, 3219. [Google Scholar] [CrossRef] [Green Version]
- Caruso, M.C.; Favati, F.; Di Cairano, M.; Galgano, F.; Labella, R.; Scarpa, T.; Condelli, N. Shelf-life evaluation and nutraceutical properties of chia seeds from a recent long-day flowering genotype cultivated in Mediterranean area. LWT-Food Sci. Technol. 2018, 87, 400–405. [Google Scholar] [CrossRef]
- Marineli, R.S.; Lenquiste, S.A.; Moraes, E.A.; Marostica, M.R. Antioxidant potential of dietary chia seed and oil (Salvia hispanica L.) in diet-induced obese rats. Food Res. Int. 2015, 76, 666–674. [Google Scholar] [CrossRef] [PubMed]
- Coelho, M.S.; de Araujo Aquino, S.; Machado Latorres, J.; Salas-Mellado, M.D.M. In vitro and in vivo antioxidant capacity of chia protein hydrolysates and peptides. Food Hydrocoll. 2019, 91, 19–25. [Google Scholar] [CrossRef]
- Ding, Y.; Lin, H.W.; Lin, Y.L.; Yang, D.J.; Yu, Y.S.; Chen, J.W.; Wang, S.Y.; Chen, Y.C. Nutritional composition in the chia seed and its processing properties on restructured ham-like products. J. Food Drug Anal. 2018, 26, 124–134. [Google Scholar] [CrossRef]
- Muñoz, L.A.; Cobos, A.; Diaz, O.; Aguilera, J.M. Chia seed (Salvia hispanica L.): An ancient grain and a new functional food. Food Rev. Int. 2013, 29, 394408. [Google Scholar] [CrossRef]
- Sandoval-Oliveros, M.R.; Paredes-López, O. Isolation and characterization of proteins from chia seeds (Salvia hispanica L.). J. Agr. Food Chem. 2013, 61, 193–201. [Google Scholar] [CrossRef] [PubMed]
- Xingú López, A.; Gonzalez Huerta, A.; De la Cruz Torres, E.; Sangerman Jarquín, D.M.; de Rosas, G.O.; Rubí Arriaga, M. Chía (Salvia hispanica L.), situación actual y tendencias futuras. Rev. Mexicana Cienc. Agric. 2017, 8, 1619–1631. [Google Scholar] [CrossRef] [Green Version]
- Brosnan, J.T.; Brosnan, M.E. Glutamate: A truly functional amino acid. Amino Acids 2013, 45, 413–418. [Google Scholar] [CrossRef]
- Karami, Z.; Akbari-adergani, B. Bioactive food derived peptides: A review on correlation between structure of bioactive peptides and their functional properties. J. Food Sci. Technol. 2019, 56, 535–547. [Google Scholar] [CrossRef]
- McCormack, W.P.; Hoffman, J.R.; Pruna, G.J.; Jajtner, A.R.; Townsend, J.R.; Stout, J.R.; Fukuda, D.H. Effects of L-alanyl-L-glutamine ingestion on one hour run performance. J. Am. Coll. Nutr. 2015, 34, 488–496. [Google Scholar] [CrossRef]
- Sudar-Milovanovic, E.; Obradovic, M.; Jovanovic, A.; Zaric, B.; Zafirovic, S.; Panic, A.; Radak, D.; Isenovic, E.R. Benefits of L-Arginine on Cardiovascular System. Mini Rev. Med. Chem. 2016, 16, 94–103. [Google Scholar] [CrossRef] [PubMed]
- Orona-Tamayo, M.; Valverde, B.; Nieto-Rendón, B.; Paredes-López, O. Inhibitory activity of chia (Salvia hispanica L.) protein fractions against angiotensin I-converting enzyme and antioxidant capacity. J. Food Sci. Technol. 2015, 64, 236–242. [Google Scholar] [CrossRef]
- Grancieri, M.; Duarte Martino, H.S.; Gonzalez de Mejia, E. Chia (Salvia hispanica L.) seed total protein and protein fractions digest reduce biomarkers of inflammation and atherosclerosis in macrophages in vitro. Mol. Nutr. Food Res. 2019, 63, 1900021. [Google Scholar] [CrossRef] [PubMed]
- Coelho, M.S.; Soares-Freitas, R.A.M.; Gomes-Areas, E.A.G.; Salas-Mellado, M.D.M. Peptides from chia Present Antibacterial Activity and Inhibit Chloresterol Synthesis. Plant Foods Hum. Nutr. 2018, 73, 101–107. [Google Scholar] [CrossRef] [PubMed]
- Bennett, J.E.; Stevens, G.A.; Mathers, C.D.; Bonita, R.; Rehm, J.; Kruk, M.E.; Riley, L.M.; Dain, K.; Kengne, A.P.; Chalkidou, K.; et al. NCD Countdown 2030: Worldwide trends in non-communicable disease mortality and progress towards Sustainable Development Goal target 3.4. NCD Countdown 2030 collaborators. Lancet 2018, 392, 1072–1088. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Zhang, L.; Caijia, Y.; Yang, X.F.; Wang, H. Monocyte and macrophage differentiation: Circulation inflammatory monocyte as biomarker for inflammatory diseases. Biomark. Res. 2014, 2, 1. [Google Scholar] [CrossRef] [Green Version]
- Zawada, A.M.; Rogacev, K.S.; Schirmer, S.H.; Sester, M.; Böhm, M.; Fliser, D.; Heine, G.H. Monocyte heterogeneity in human cardiovascular disease. Immunobiology 2012, 217, 1273–1284. [Google Scholar] [CrossRef]
- Wang, N.; Liang, H.; Zen, K. Molecular Mechanisms That Influence the Macrophage M1–M2 Polarization Balance. Front. Immunol. 2014, 5, 614. [Google Scholar] [CrossRef] [Green Version]
- Geissmann, F.; Manz, M.G.; Jung, S.; Sieweke, M.H.; Merad, M.; Ley, K. Development of monocytes, macrophages and dendritic cells. Science 2010, 327, 656–661. [Google Scholar] [CrossRef] [Green Version]
- Guilliams, M.; Mildner, A.; Yona, S. Developmental and Functional Heterogeneity of Monocytes. Immunity 2018, 49, 595–613. [Google Scholar] [CrossRef] [Green Version]
- La Paz, S.M.; Naranjo, M.C.; Lopez, S.; Abia, R.; Muriana, F.J.G.; Bermudez, B. Niacin and its metabolites as master regulators of macrophage activation. J. Nutr. Biochem. 2017, 39, 40–47. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, F.; Zhang, S.; Jeon, R.; Vuckovic, I.; Jiang, X.; Lerman, A.; Folmes, C.D.; Dzeja, P.D.; Herrmann, J. Interferon Gamma Induces Reversible Metabolic Reprogramming of M1 Macrophages to Sustain Cell Viability and Pro-Inflammatory Activity. EBioMedicine 2018, 30, 303–316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, T.; Gan, S.; Zhu, Q.; Dai, D.; Li, N.; Wang, H.; Chen, X.; Hou, D.; Wang, Y.; Pan, Q.; et al. Modulation of M2 macrophage polarization by the crosstalk between Stat6 and Trim24. Nat. Commun. 2019, 10, 4353. [Google Scholar] [CrossRef] [Green Version]
- Lqari, H.; Vioque, J.; Pedroche, J.; Millán, F. Lupinus angustifolius protein isolates: Chemical composition, functional properties and protein characterization. Food Chem. 2002, 76, 349–356. [Google Scholar] [CrossRef]
- Villanueva-Lazo, A.; la Paz, S.M.; Rodriguez-Martin, N.M.; Millan, F.; Carrera, C.; Pedroche, J.J.; Millan-Linares, M.C. Antihypertensive and Antioxidant Activity of Chia Protein Techno-Functional Extensive Hydrolysates. Foods 2021, 10, 2297. [Google Scholar] [CrossRef]
- Adler-Nissen, J. Determination of the degree of hydrolysis of food protein hydrolysates by trinitrobenzenesulfonic acid. J. Agric. Food Chem. 1979, 27, 1256–1262. [Google Scholar] [CrossRef]
- Alaiz, M.; Navarro, J.L.; Girón, J.; Vioque, E. Amino acid analysis by high-performance liquid chromatography after derivatization with diethyl ethoxymethylenemalonate. J. Chromatogr. A 1992, 591, 181–186. [Google Scholar] [CrossRef]
- Yust, M.M.; Pedroche, J.; Girón-Calle, J.; Vioque, J.; Millán, F.; Alaiz, M. Determination of tryptophan by high-performance liquid chromatography of alkaline hydrolysates with spectrophotometric detection. Food Chem. 2004, 85, 317–320. [Google Scholar] [CrossRef]
- Lee, S.C.; Prosky, L.; De Vries, J.W. Determination of Total, Soluble, and Insoluble Dietary Fiber in Foods—Enzymatic-Gravimetric Method, MES-TRIS Buffer: Collaborative Study. J. AOAC Int. 1992, 75, 395–416. [Google Scholar] [CrossRef]
- Mirea, A.M.; Tack, C.J.; Chavakis, T.; Joosten, L.A.B.; Toonen, E.J.M. IL-1 Family Cytokine Pathways Underlying NAFLD: Towards New Treatment Strategies. Trends Mol. Med. 2018, 24, 458–471. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, F.M.; Weschenfelder, J.; Sander, C.; Minkwitz, J.; Thormann, J.; Chittka, T.; Mergl, R.; Kirkby, K.C.; Faßhauer, M.; Stumvoll, M.; et al. Inflammatory cytokines in general and central obesity and modulating effects of physical activity. PLoS ONE 2015, 10, e0121971. [Google Scholar] [CrossRef] [PubMed]





| Target | GenBank Accession Number | Forward Reverse | Sequence (5′→3′) | 
|---|---|---|---|
| iNOS | NM_ 000625 | Forward Reverse | ACCCAGACTTACCCCTTTGG GCCTGGGGTCTAGGAGAGAC | 
| IL1β | NM_000576 | Forward Reverse | GGGCCTCAAGGAAAAGAATC TTCTGCTTGAGAGGTGCTGA | 
| IL6 | NM_000600 | Forward Reverse | TACCCCCAGGAGAAGATTCC TTTTCTGCCAGTGCCTCTTT | 
| TNFα | NM_000594 | Forward Reverse | TCCTTCAGACACCCTCAACC AGGCCCCAGTTTGAATTCTT | 
| IL10 | NM_000572 | Forward Reverse | GCCTAACATGCTTCGAGATC TGATGTCTGGGTCTTGGTTC | 
| CCR7 | NM_007719.2 | Forward Reverse | GTGTGCTTCTGCCAAGATGA CCACGAAGCAGATGACAGAA | 
| MRC1 | NM_ 138806 | Forward Reverse | GGCGGTGACCTCACAAGTAT ACGAAGCCATTTGGTAAACG | 
| HPRT | NM_001289746 | Forward Reverse | ACCCCACGAAGTGTTGGATA AAGCAGATGGCCACAGAACT | 
| GAPDH | NM_001289746 | Forward Reverse | CACATGGCCTCCAAGGAGTAAG CCAGCAGTGAGGGTCTCTCT | 
| CPI | CPH | |
|---|---|---|
| Protein (%) | 82.85 ± 0.11 | 75.03 ± 0.45 | 
| Moisture (%) | 4.80 ± 0.30 | 7.18 ± 0.08 | 
| Ash (%) | 0.13 ± 0.09 | 6.45 ± 0.17 | 
| Fiber (%) | 11.01 ± 0.80 | 11.20 ± 0.70 | 
| Other * (%) | 1.21 | 0.14 | 
| Indispensable Amino Acid Protein | CPI | CPH | 2007 FAO/WHO/UNU a,b | 
|---|---|---|---|
| Histidine | 37.9 ± 2.9 | 39.2 ± 0.5 | 15 | 
| Isoleucine | 35.2 ± 0.3 | 35.1 ± 0.0 | 30 | 
| Leucine | 70.4 ± 4.6 | 72.2 ± 0.7 | 59 | 
| Lysine | 46.4 ± 1.4 | 48.1 ± 0.6 | 45 | 
| Methionine + cysteine | 40.5 ± 1.9 | 40.3 ± 1.2 | 22 | 
| Methionine | 21.9 ± 1.8 | 21.1 ± 2.1 | 16 | 
| Cysteine | 18.6 ± 1.9 | 19.2 ± 0.4 | 6 | 
| Phenylalanine + tyrosine | 136.7 ± 1.9 | 135.5 ± 1.1 | 38 | 
| Threonine | 38.4 ± 2.1 | 38.0 ± 0.3 | 23 | 
| Tryptophan | 48.1 ± 0.6 | 49.3 ± 0.3 | 6 | 
| Valine | 46.9 ± 0.9 | 47.6 ± 0.8 | 39 | 
| Total indispensable amino acids | 500.5 | 505.3 | 277 | 
| Dispensable Amino Acid Protein | |||
| Aspartic acid | 85.2 ± 1.7 | 84.5 ± 1.3 | |
| Glutamic acid | 176.2 ± 2.7 | 178.3 ± 1.9 | |
| Serine | 71.9 ± 1.6 | 70.2 ± 0.7 | |
| Glycine | 44.5 ± 2.4 | 45.0± 0.6 | |
| Arginine | 108.0 ± 2.9 | 105.3 ± 1.1 | |
| Alanine | 48.0 ± 1.2 | 49.1 ± 0.4 | |
| Proline | 23.1± 1.0 | 17.6 ± 0.3 | |
| Total dispensable amino acids | 556.9 | 550 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Villanueva-Lazo, A.; Montserrat-de la Paz, S.; Grao-Cruces, E.; Pedroche, J.; Toscano, R.; Millan, F.; Millan-Linares, M.C. Antioxidant and Immunomodulatory Properties of Chia Protein Hydrolysates in Primary Human Monocyte–Macrophage Plasticity. Foods 2022, 11, 623. https://doi.org/10.3390/foods11050623
Villanueva-Lazo A, Montserrat-de la Paz S, Grao-Cruces E, Pedroche J, Toscano R, Millan F, Millan-Linares MC. Antioxidant and Immunomodulatory Properties of Chia Protein Hydrolysates in Primary Human Monocyte–Macrophage Plasticity. Foods. 2022; 11(5):623. https://doi.org/10.3390/foods11050623
Chicago/Turabian StyleVillanueva-Lazo, Alvaro, Sergio Montserrat-de la Paz, Elena Grao-Cruces, Justo Pedroche, Rocio Toscano, Francisco Millan, and Maria C. Millan-Linares. 2022. "Antioxidant and Immunomodulatory Properties of Chia Protein Hydrolysates in Primary Human Monocyte–Macrophage Plasticity" Foods 11, no. 5: 623. https://doi.org/10.3390/foods11050623
APA StyleVillanueva-Lazo, A., Montserrat-de la Paz, S., Grao-Cruces, E., Pedroche, J., Toscano, R., Millan, F., & Millan-Linares, M. C. (2022). Antioxidant and Immunomodulatory Properties of Chia Protein Hydrolysates in Primary Human Monocyte–Macrophage Plasticity. Foods, 11(5), 623. https://doi.org/10.3390/foods11050623
 
         
                                                

 
       