Next Article in Journal
Microbial Indicators and Possible Focal Points of Contamination during Production and Processing of Catfish
Next Article in Special Issue
Bioprotective Lactic Acid Bacteria and Lactic Acid as a Sustainable Strategy to Combat Escherichia coli O157:H7 in Meat
Previous Article in Journal
Bacterial Communities Related to Aroma Formation during Spontaneous Fermentation of ‘Cabernet Sauvignon’ Wine in Ningxia, China
Previous Article in Special Issue
Strategies for Nitrite Replacement in Fermented Sausages and Effect of High Pressure Processing against Salmonella spp. and Listeria innocua
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Taxonomical Identification and Safety Characterization of Lactobacillaceae from Mediterranean Natural Fermented Sausages

1
Department for Sustainable Food Process (DISTAS), Università Cattolica del Sacro Cuore, 26100 Cremona, Italy
2
Department of Agricultural and Food Sciences, University of Bologna, 40127 Bologna, Italy
3
University Department of Marine Studies, University of Split, Ruđera Boškovića 37, HR-21000 Split, Croatia
4
Interdepartmental Center for Industrial Agri-Food Research, University of Bologna, 47521 Cesena, Italy
*
Author to whom correspondence should be addressed.
Foods 2022, 11(18), 2776; https://doi.org/10.3390/foods11182776
Submission received: 15 July 2022 / Revised: 30 August 2022 / Accepted: 5 September 2022 / Published: 9 September 2022
(This article belongs to the Special Issue Safety of Processed Meat Products)

Abstract

Fermented meat products represent an important industrial sector in Europe, particularly in the Mediterranean Countries (MC), where the presence of numerous local productions, still obtained through spontaneous fermentation, is recognized as a formidable treasure chest of unexplored microbial biodiversity. Lactobacillaceae naturally occurring in fifteen spontaneously fermented sausages from MC (Italy, Spain, Croatia, and Slovenia) were isolated and taxonomically characterized using molecular techniques. Additionally, a safety assessment for the presence of antibiotic resistances and biogenic amine (BA) production was performed to determine their suitability as autochthonous starter cultures. Molecular typing, performed using REP-PCR, discriminated 151 strains belonging to Latilactobacillus sakei (59.6%), Latilactobacillus curvatus (26.5%) and Companilactobacillus alimentarius (13.9%). The minimum inhibitory concentrations (MICs) of eight different antibiotics revealed a high resistance to streptomycin (27%), tetracycline (16%), followed by gentamycin (14%) and kanamycin (13%). Interestingly, the results showed a geographical distribution of resistant biotypes. tetM/tetS or ermB genes were identified in only six strains. The amino-biogenic potential of the strains was assessed, confirming the absence of this trait among L. sakei, while a high number of producer strains was found among L. curvatus. On the 151 analyzed strains, 45 demonstrated safety traits for their future use as starter food cultures. These results open the way to further studies on the technological properties of these promising autochthonous strains, strongly linked to the Mediterranean environment.

1. Introduction

The curing of meats can be considered one of the most ancient methods for preserving perishable raw materials and the origin of this approach dates back several centuries [1,2]. Among cured meats, dry sausage preparation combines the use of curing salts with a fermentation step that involves several microorganisms including lactic acid bacteria (LAB), staphylococci, micrococci and fungi [3,4]. Early studies concerning the complex dynamics of this microbial process were published about 60 years ago [5,6] and lead to establish criteria f or the selection of starter cultures to be used for driving meat fermentation [7,8]. Nowadays, the use of starter cultures is common in industrial products, and they are mainly constituted of LAB and coagulase negative cocci (CNC). Among LAB, the strains mainly selected belong to the species Latilactobacillus sakei, Latilactobacillus curvatus, Lactiplantibacillus plantarum, Pediococcus pentosaceus and Pediococcus acidilactici [9]. However, as observed by [2], the use of starters may result in the loss of microbial biodiversity and, therefore, of the peculiar characteristics (impoverishment of sensory features), if compared to artisanal sausages obtained with spontaneous fermentation. On the other hand, selected cultures are able to guarantee the constant quality, safety and longer shelf-life [2,10]. The search for new and tailor-made cultures able to impart specific and traditional attributes to fermented sausages represents an important approach to overcome the negative aspects and preserving the authenticity and recognisability of artisanal products. In this perspective, the presence of numerous local products still obtained through spontaneous fermentation is a formidable source of unexplored microbial biodiversity of a given terroir which could be exploited for isolating new starter candidates [11,12,13].
The most peculiar traits of LAB strains in meat fermentation are undoubtedly their abilities to rapidly decrease the pH and to colonize the environment throughout the complete production process [14]. A low pH limits the growth of undesirable species (pathogens and spoilers) and favours texture and water loss by approaching the isoelectric point of meat proteins [15]. However, further technological characteristics are requested for their use as meat starter cultures. These features can represent an important trait for starter selection also in the frame of NaCl reduction, which characterizes the new market trends considering nutritional needs and consumer demands [16]. Generally, LAB starters are selected in order to improve safety and reduce hygienic and toxicological risks in food [2,17], but they have to be firstly safe, so that their use as starter cultures for fermentation requires a safety assessment. Biogenic amines (BA) are toxic products deriving from amino acid decarboxylation that accumulate in sausages during fermentation and ripening [18]. Many bacterial species may contribute to their production in fermented foods, including LAB. For this reason, the absence of specific decarboxylases is a prerequisite for LAB used as starter cultures, mainly because their performances could affect BA accumulation during ripening [19,20]. The presence of genetic clusters containing the necessary genes for BA production have been deeply studied, especially for the most dangerous BA, i.e., tyramine and histamine [21,22]. The conditions of BA accumulation define the so called aminobiogenic potential, that can be tested both genetically and phenotypically [23]. Another relevant safety aspect is the presence of antibiotic resistance genes in mobile genetic elements, such as plasmids and transposons. In fact, these elements can be transferred to other species, including pathogenic bacteria, during food manufacture or during the passage through the gastrointestinal tract [24]. This poses an additional risk due to the nature of consumption of ready-to-eat fermented products and their potential to become strong antibiotic resistance reservoirs [25]. Particularly, the presence of tetracycline and erythromycin resistant lactobacilli, studied applying EFSA (European Food Safety Authority (EFSA) 2012) cut-off limits, has been well documented in fermented dry sausages produced in northern Italy [26,27].
The aim of this study was the isolation, characterization and safety assessment of autochthonous Lactobacillaceae from 15 Mediterranean spontaneously fermented sausages, collected from four different MC (Italy, Spain, Croatia, and Slovenia) and previously characterized for their characteristics and bacterial biodiversity [28]. This investigation had the purpose to widen the previously studied microbiota composition, in order to understand the ecology of these natural fermented meats and to know which LAB species are the most abundant. In addition, the work was aimed to study the presence and the type of strain antimicrobial resistances and aminobiogenic potential. With this aim, more than 900 isolates have been genotyped using fingerprint analysis for the differentiation of the strains, which have been further taxonomically identified and characterized for their safety features. This knowledge will be the starting point to further determine strains suitability to be used in foods from one side as potential autochthonous starter cultures, studying their technological properties, and secondary, as protective food cultures against pathogenic and spoiling agents, assessing their antimicrobial potential.

2. Materials and Methods

2.1. Sausage Samples and Lactobacillaceae Isolation

A sampling of 15 natural-fermented sausages, produced without any starters addition, was collected at the end of ripening from four different MC and particularly: three sausages were obtained from Italy (IM1, IM2, IAL), two from Slovenia (SN, SWO), seven from Spain (ESA, ESB, ESE, ESO, ECB, ECE, ECO) and three from Croatia (HNS, HS, HZK).
Times and ripening conditions were heterogeneous and only for the three Slovenian domestic samples, smoking was used (14 days). These samples were previously characterized for their chemical-physical features and their microbial profile [28].
For cultivation-dependent analysis, sausages were processed as previously described by Barbieri et al. [28]: Man-Rogosa-Sharpe (MRS) agar medium (Oxoid, Milan, Italy) was employed for presumptive LAB counts and their isolation at 30 °C for 48 h in anaerobic conditions achieved using Anaerocult A (Merck, Darmstadt, Germany) in anaerobic jars. Grown colonies on MRS agar plates were randomly selected, picked with a sterile loop, and streaked onto new MRS plates in duplicate. Isolates were collected from plates containing from 20 to 50 colonies. A minimum of 22 to a maximum of 70 isolates for each sample was considered. The pure cultures obtained were observed for morphological characteristics and tested by means of catalase test, Gram test, growth at 15 °C and 45 °C, as well as for their homo or heterolactic fermentation. For further analyses, the isolates were stored at −20 °C in MRS broth containing 20% glycerol (Carlo Erba, Milan, Italy).

2.2. DNA Extraction and REP-PCR Analysis

All isolates were cultured in 10 mL of MRS broth (GranuCult®, Darmstadt, Germany), incubated at 30 °C overnight. From these fresh pure cultures, isolates were streaked in MRS agar and incubated in anaerobic conditions for 48 h. Single colonies were selected from the agar plates to perform DNA extraction using the fast microLYSIS®-Plus DNA extraction kit (Microzone, Labogen, Stourbridge, UK) following the manufacturer’s instructions; 20 µL of DNA was obtained and used for the molecular analysis. The rep-PCR (Repetitive element (or extragenic) palindromic-Polymerase Chain Reaction) using oligonucleotide primer (GTG) 5 (5′–GTGGTGGTGGTGGTG–3′), was chosen for fingerprint analysis of isolates [29]. The amplified products were electrophoresed in a 2.5% agarose gel. The study was performed analysing the fingerprint profile for each group of isolates from the different sausage types. The selected biotypes were grown in 10 mL of MRS broth and incubated overnight at 30 °C under anaerobic conditions. Cells were collected by centrifugation (3200× g, 15 min) and frozen at −20 °C in MRS + glycerol 20% solution.

2.3. Genotyping Identification of Isolates

16S rRNA gene sequencing was done on all biotypes with different rep-PCR profiles using specific primers and PCR reaction designed by [30]. After amplification and before sequencing, the PCR products were purified using ExoSAP-IT™ (Applied Biosystems™, Thermo Fisher Scientific, Leicestershire, UK) according to the protocol provided by the manufacturer. The DNA was sequenced by a commercial facility (Eurofins Genomics, Italy) and the obtained sequences were analysed using the Ribosomal Database Project tools (http://rdp.cme.msu.edu/, accessed on 1 Febraury 2021) and assigned to the species with the highest percentage of identity. Species-specific PCR reactions for the identification of Latilactobacillus sakei and Latilactobacillus curvatus were performed on those isolates that were not correctly assigned to species level (identity ≤ 98.7% [31]). PCR products were separated by electrophoresis in a 1% agarose gel and visualized by Sybr-Safe staining.
The relative frequency of intra-species biotypes for each MC salami sample has been calculated using Microsoft Excel 2016, Version 2207.

2.4. Antibiotic Susceptibility Testing

EFSA Guidance [32] was followed for antibiotic resistance determination of the selected strains and minimal inhibitory concentration (MIC) testing. Resistances to Ampicillin (Amp), Chloramphenicol (Chl), Clindamycin (Cli), Erythromycin (Ery), Gentamicin (Gen), Tetracycline (Tet), Kanamycin (Kan) and Streptomycin (Str) were determined by using micro dilution technique in the recommended LSM medium (Iso-Sensitest™ broth 90% [Thermo Fisher Scientific, Leicestershire, UK], MRS broth 10%) [33]. Bacterial growth was measured after 48 h of incubation at 28 °C for Latilactobacillus sakei and 37 °C for Latilactobacillus curvatus, under anaerobic conditions.
Relative abundance of resistant biotypes for each species and antibiotics tested were calculated using Microsoft Excel 2016, Version 2207 (Microsoft Corporation, Redmond, WA, USA).

2.5. PCR-Based Screening of Resistance Genes

The presence of Tetracycline and Erythromycin resistance genes was screened by standard PCR with specific primers reported in Table 1. Genes coding for ribosomal protection proteins conferring Tetracycline resistance were targeted with specific primers for tet (W) [34], tet (M) [35] and tet (S) [36]. Tetracycline efflux pump gene, tet (L) was also searched using gene-specific primers [37]. The presence of Erythromycin resistance genes was tested using specific primers for ermA, ermB [38] and ermC [39]. PCR products were separated by electrophoresis on a 1% agarose gel and visualized by Sybr-Safe staining.

2.6. Biogenic Amines (BAs) Production

To test the aminobiogenic potential of the strains, overnight cultures on MRS were inoculated to a concentration of 6 log CFU/mL in Bover-Cid and Holzapfel broth, supplemented with the BA precursors (histidine, tyrosine, ornithine or lysine) and incubated at 30 °C. The ability to produce BAs was assessed with the method proposed by Bover-Cid and Holzapfel (1999) and BA production confirmation was performed thought HPLC according to the method reported by [28].

3. Results and Discussion

3.1. Strain Genotyping and Identification of Biotypes

The spontaneously fermented sausages used as a source for the selection of new LAB strains were produced according to traditional local recipes and varied with regards to the ingredients, the presence of additives, the casing, the fat, and the ripening conditions as described by [28].
A total of 914 microorganisms, grown on MRS agar medium and presumptive classified as LAB based on Gram staining and catalase test results, were isolated from 15 natural-fermented sausages from MC: 173 isolates from Italian sausages, 140 from Slovenian sausages, 444 from Spanish sausages and 157 from Croatian sausages, respectively. To achieve taxonomical identification at the strain level, (GTG)5-rep-PCR fingerprinting technique was applied on DNA extracted from the all the isolated samples. Representative profiles for each sausage were selected and subjected to partial 16S rRNA gene sequencing and species-specific PCR for L. sakei and L. curvatus. In Table 2 the total number of isolates and biotypes per each type of MC sausage are reported.
Based on the data described in Table 2, a total of 151 biotypes were detected. The fingerprint analysis showed a higher variability in the electrophoretic profiles of the samples from Spanish and Croatian sausages. From 69 and 70 isolates of the Spanish Salchichones ESB and ESO, 11 and 19 different biotypes have been respectively differentiated, while out of 48 and 69 isolates from the Spanish Chorizo ECB and ECE, 16 and 22 biotypes have been highlighted. Regarding Croatian samples, the richest in LAB biodiversity was the Salami HZK, with 21 biotypes out of 53 isolates. Differently, Italian and Slovenian sausages were characterized by a lower biodiversity, with only two identified biotypes among 48 isolates from Italian Salame IM2, 5 biotypes among 70 isolates from the Slovenian traditional smoked salami SN and 6 biotypes among 70 isolates from the Slovenian traditional smoked salami SWO.
Secondarily, the 151 strains that showed unique rep-PCR profiles, were identified by 16S rRNA gene sequencing. Isolates that failed to be assigned to any species (level of identity ≤ 98.7%), were identified using species-specific PCR for the identification of L. sakei and L. curvatus. The combined molecular approach allowed to identify three dominant species: L. sakei, L. curvatus and C. alimentarius; particularly, 90 strains were assigned to L. sakei, 40 strains to L. curvatus and 21 strains to C. alimentarius. As frequently stated by previous works [40,41], natural meat fermentation is dominated by coagulase-negative cocci (CNC) and LAB, whose most commonly species are represented by L. sakei, L. curvatus and L. plantarum. Considering the results of the combined methodology to assess the taxonomic identity of the 150 Lactobacillaceae biotypes, L. sakei resulted to be the dominant species in the IM1 (100%), IM2 (100%), IAL (75%), SN (100%), SWO (100%), ESB (91%), ESE (62.5%), ESA (82%), HZK (81%), HS (100%), HNS (64%) sausages. L. curvatus prevailed in the ECE (63.7%) sausages, while the ESO sausages presented an equal presence of L. sakei and L. curvatus (47% each). C. alimentarius dominated in the ECB (87.5%) and in the ECO (57%) sausages.
These data confirmed the outcome obtained through metagenomics analysis on the same samples [28], where L. sakei was the dominant species among LAB, especially in IM2, IAL, and SN samples, followed by members of the L. sakei group in lower amounts. This dominance is highlighted also by the relative frequency of the L. sakei biotypes that were found in higher percentage particularly in the Italian and Slovenian sausages, followed by Croatian ones; a higher species biodiversity was instead typical of Spanish samples, where the species distribution among biotypes is more balanced for the three described LAB (Figure 1 and Supplementary Material Table S1).
During the ripening process of natural fermented sausages, LAB species diversity is limited and L. sakei is one of the main adapted species to the restrictive conditions generally present in the dry meat environment, due to the species excellent adaptation, competitiveness and assertiveness in the meat matrix [12,42]. The samples of the study were processed at the end of the maturation period when low availability of sugars was still supposed to be present in the sausages and free amino acids were probably used by L. sakei to grow and survive in these conditions. This species is highly adapted to this ecological niche, due to its metabolic pathways, including the arginine deiminase pathway and the utilization of nucleosides [12,43,44].
The Spanish sausages surprisingly showed a high percentage of biotypes belonging to the C. alimentarius species; sample ECB showed, for example, 95% C. alimentarius biotypes. C. alimentarius species was also previously highlighted through amplicon sequencing and metagenomic analysis in these Mediterranean sausage samples [28]. In fact, also in this preliminary work, high quantities of the members of C. alimentarius, C. heilongjiangensis and C. versmoldensis were present in many Spanish sausages, in particular ESE and ECB (55.3 and 45.0% of the total ASVs, respectively). This species has been reported as a regional peculiarity in the literature [45,46], but its presence was described also as minoritarian in some traditional fermented salami of Southern Italy, such as Naples-type salami [47]. In addition, the Spanish sausages, if compared to the other MC fermented meats, had a higher strain biodiversity in terms of different identified biotypes. The technological parameters, together with the ingredients, the fermentation process and ripening conditions could strongly influence the survival and adaptation of different bacterial populations to a peculiar environment.

3.2. Safety Assessment of Isolated Strains

Starter strains to be used as food cultures have to comply with safety criteria such as the absence of antibiotic resistance genes and the incapacity to produce biogenic amines [48,49]. In this context, the two main occurring species L. sakei and L. curvatus (90 and 39 isolates, respectively) were tested for their safety features in order to prove their safe use as food cultures. Particularly, their antimicrobial resistance profile was tested by micro dilution technique and the aminobiogenic potential through HPLC analysis. C. alimentarius strains were not analysed for the characterization, since this species is not considered among the possible adequate starter cultures in meat productions.

Antibiotic Resistance Assessment

Cut off values established by EFSA [32], were used as reference to search for the presence of resistant biotypes isolated from the 15 artisanal fermented sausages. A unimodal distribution of the MICs values, divided per species, is reported in Table 3 for all the analysed samples.
Considering L. sakei, the most representative isolated species, 45 strains out of 90, showed resistance to at least one antibiotic. A total of 28 strains presented only 1 resistance, while a discrete number of multidrug resistant strains have been found; particularly, 11 strains showed 2 resistances, 5 strains carried 3 resistances and 1 strain, the ECE-5 isolated from a Spanish sausage, presented 5 resistances (data not shown). For what concerns the antibiotic classes, these results demonstrated that there is a limited susceptibility to aminoglycosides, especially for Streptomycin, with 25 resistant strains, followed by Tetracycline, with 15 resistant strains, Gentamycin, with 13 resistant strains, and by Kanamycin, with 11 resistant strains. The genotypic analysis on L. sakei showed the presence of two genes coding for Tetracycline resistance: tetS and tetM. TetS gene was detected in the strains HNS-7, HNS-3 and ESB-57, while tetM gene was found in HNS-3, ECO-19 and ESB-57. No resistant strains were detected for Erythromycin and Ampicillin. In the case of L. curvatus, 20 out of the 40 strains were recognised as resistant. Especially, 12 strains showed one resistance, only one strain presented 2 resistances, 6 strains carried 3 resistances and 1 strain, the HZK-49 isolated from a Croatian sausage showed 5 resistances. In this case, the results showed that susceptibility to aminoglycosides is the lowest; particularly, 11 strains presented resistance to Streptomycin, followed by Gentamycin, with 5 resistant strains, and by the Kanamycin, with 3 resistant strains. In addition, 7 isolates were resistant to Tetracycline, 4 isolates were resistant to Chloramphenicol, 3 strains were resistant to Clindamycin and 2 strains were resistant to Ampicillin. Furthermore, the genotypic analysis presented the gene ermB coding for Erythromycin resistance in L. curvatus strains ESO-52 and HZK-49; the results confirmed the output obtained with the micro dilution method.
Comparing the two LAB dominant species for antibiotic resistance, Streptomycin resulted to be the most spread resistance both in L. sakei and L. curvatus isolates (Figure 2), followed by Tetracycline. Differently from L. curvatus strains, L. sakei isolates harboured no resistances to Ampicillin and Erythromycin.
The occurrence of strains characterized by MICs higher than EFSA breakpoints was found to be superior in the ones isolated from the Spanish and the Croatian sausage samples, showing a geographical distribution of resistant biotypes. In fact, the highest values for Gentamycin was 64 µg/mL (ESA and ESE sausages); for Kanamycin was 256 µg/mL (ESA, HZK, HS sausages); for Streptomycin was 256 µg/mL (ESO, ECE, ESE, HZK, HNS sausages); for Tetracycline was 64 µg/mL (ESB, ECO, ESO, ECE, HZK and HNS sausages); for Erythromycin was 2 µg/mL (ESO, HZK sausages); for Clindamycin was 8 µg/mL (HS sausage); for Chloramphenicol was 8 µg/mL (ECE and HZK sausages); for Ampicillin was 8 µg/mL (ESO and HNS sausages). Among the antibiotics, Streptomycin, Tetracycline, Gentamycin and Kanamycin resistances were the most detected: 27% of the strains were resistant to Streptomycin, 16% to Tetracycline, 14% to Gentamycin and 10% to Kanamycin. A lower number of strains were found to be resistant to other antimicrobials, in particular: 3% to Clindamycin, 3% to Chloramphenicol, 1.5% to Erythromycin and 1.5% to Ampicillin. Fermented sausages from Italy (IM1, IM2 and IAL), Slovenian sausages SN and SWO and the Spanish CB sausages showed to be colonized by susceptible lactobacilli, with no resistances to the antibiotics tested in the study.

3.3. Biogenic Amines (BAs) Production

Aminobiogenic potential results demonstrated high variability among the strains based on their species and source of isolation. No BA producers were detected among the L. sakei strains, while a high number of L. curvatus (26 out of 40 strains) accumulated these compounds. As already evidenced for antibiotic resistance, also the decarboxylase activity was strongly linked to the geographic origin of the isolates. The highest number of BA producing strains have been isolated from Spanish products, indicating an effect of raw materials, environmental conditions, and processes in exerting a selective pressure on microbial communities and their metabolisms (Table 4).
Among the 40 L. curvatus strains, 26 were decarboxylase-positive and namely 19 produced tyramine, 10 putrescine and 1 histamine, while 4 strains were able to accumulate both tyramine and putrescine (Table 4). Seven out of 26 aminobiogenic strains presented one or more antibiotic resistances, showing different traits that are related to their safety features. Apart from enterococci, L. curvatus is considered the main tyramine producer among LAB in fermented sausages [20,50], while L. sakei is usually described as non-aminobiogenic. The decarboxylase potential has been demonstrated to be strain dependent [51]. Moreover, Ladero et al. (2015) described the capability of L. curvatus strains to produce both tyramine and putrescine. The latter is mainly accumulated in LAB though agmatine deiminase (AgDI) pathway, rather than ornithine decarboxylase (ODC), common in Gram negative bacteria [52].
The spontaneously fermented sausages used as source of isolation of L. curvatus strains presented a BA concentration ranging from about 100 mg/kg to more than 1000 mg/kg, including tyramine, putrescine and cadaverine. Interestingly, in the samples where L. curvatus CE-27 has been found, histamine was present at a concentration of 170 mg/kg [28].

4. Conclusions

Fermented sausages are produced all over Europe, with a wide diversity of manufacturing techniques and organoleptic properties between different countries and even between different regions within the same country. The 15 naturally fermented MC sausages with peculiar characteristics in terms of manufacturing and ripening conditions [28], demonstrated to be a good source of interesting autochthonous Lactobacillaceae to be studied for their potential technological applications in the food industry. At species level, the identified biotypes did not show a consistent biodiversity, with only L. sakei, dominating over the rest of the species (59.6% of isolates), L. curvatus present in lower proportion (26.5%) and few isolates identified as C. alimentarius (13.9%). Anyway, results obtained are in accordance with those described in previous studies on similar types of fermented sausages [53,54,55,56]. A more consistent biodiversity could be described in terms of strain ecology, with the Spanish sausages being the richest for the number of biotypes, while Italian and Slovenian samples showed only a low percentage of strains, belonging the majority to L. sakei species.
The evaluation of the safety profile of these Mediterranean products resulted in a high incidence of L. sakei (50%) and L. curvatus (45%) resistant to antibiotics; in addition, the safety assessment allowed to define a geographical clustering of resistant biotypes: strains isolated from Italian and Slovenian natural fermented sausages showed no incidence of antibiotic resistance and a negligible production of BA; on the contrary, the highest number of antibiotic-resistant isolates were detected in Spanish and Croatian salami, with a high prevalence of MDR (Multi Drug Resistant) bacteria; in particular, Streptomycin, Tetracycline, Gentamycin and Kanamycin resistances were the most observed. We found one L. sakei and one L. curvatus, which carried five resistances to antibiotics, respectively in the ECE and HZK sausages. This aspect arises a global concern linked to the safety of ready-to-eat fermented meat products; the previous large use of antibiotics in the pig production chain has led to a change in the pig microbiome and consequently in the diffusion of antibiotic resistant genes (ARG) in the meat environment [57]. The application of good manufacturing practices in the pork industry can help to control antibiotic resistant pathogen or spoilage species, but when are technological species, such as LAB, to harbor resistant genes, this can represent a difficult risk to be monitored for the consumer safety.
Finally, amino biogenic potential seemed to be species-related; in fact, no BA producers were detected among the L. sakei analysed strains, while a high number of producer strains was found among L. curvatus. After the safety assessment, a total of 45 Lactobacillaceae strains (44 L. sakei and 1 L. curvatus respectively) were classified to be safe, having no resistances and amino biogenic capacity. L. sakei demonstrated to be the most abundant species present in naturally fermented MC sausages but also the species with the best safety traits. These results could be the starting point for improved knowledge regarding the study of the technological attributes and bioprotective activity of these strains. The main aim will be to select natural starters with added value to be employed in the fresh and fermented meat productions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/foods11182776/s1, Table S1. List of strains used in this study with respective origin, MIC, ATB PCR detection and biogenic amines prediction.

Author Contributions

Conceptualization, D.B.; methodology, D.B., G.T., C.M., F.G. and V.Š.; software, G.M., M.V.B.D.; validation, D.B., G.T. and F.G.; formal analysis, G.M., F.B., M.V.B.D. and S.L.; investigation, D.B., G.M., F.B., M.V.B.D., S.L. and G.T.; resources, D.B., C.M., V.Š., F.G. and G.T.; data curation, D.B., G.M., C.M. and G.T.; writing—original draft preparation, D.B., G.M. and M.V.B.D.; writing—review and editing, D.B., G.M., M.V.B.D., C.M., F.G., V.Š. and G.T.; visualization, D.B., F.G., G.T. and C.M.; supervision, D.B., G.T. and F.G.; project administration, D.B., F.G. and G.T.; funding acquisition, D.B., F.G., V.Š.and G.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research is supported by the PRIMA programme under BioProMedFood (Project ID 1467; CUP:J34I19004820005). The PRIMA programme is supported by the European Union H2020.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Aquilanti, L.; Garofalo, C.; Osimani, A.; Clementi, F. Ecology of Lactic Acid Bacteria and Coagulase Negative Cocci in Fermented Dry Sausages Manufactured in Italy and Other Mediterranean Countries: An Overview. Int. Food Res. J. 2016, 23. Available online: http://www.ifrj.upm.edu.my/23%20(02)%202016/(1).pdf (accessed on 28 August 2022).
  2. Franciosa, I.; Alessandria, V.; Dolci, P.; Rantsiou, K.; Cocolin, L. Sausage fermentation and starter cultures in the era of molecular biology methods. Int. J. Food Microbiol. 2018, 279, 26–32. [Google Scholar] [CrossRef] [Scilit]
  3. Cocolin, L.; Dolci, P.; Rantsiou, K.; Urso, R.; Cantoni, C.; Comi, G. Lactic acid bacteria ecology of three traditional fermented sausages produced in the North of Italy as determined by molecular methods. Meat Sci. 2009, 82, 125–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Kumar, P.; Chatli, M.K.; Verma, A.K.; Mehta, N.; Malav, O.P.; Kumar, D.; Sharma, N. Quality, functionality, and shelf life of fermented meat and meat products: A review. Crit. Rev. Food Sci. Nutr. 2015, 57, 2844–2856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Niinivaara, F.P. Starter Cultures in the Processing of Meat by Fermentation and Dehydration. 1991, pp. 59–63. Available online: https://meatscience.org/docs/default-source/publications-resources/rmc/1991/starter-cultures-in-the-processing-of-meat-by-fermentation-and-dehydration.pdf?sfvrsn=2 (accessed on 28 August 2022).
  6. Comi, G.; Muzzin, A.; Corazzin, M.; Iacumin, L. Lactic Acid Bacteria: Variability Due to Different Pork Breeds, Breeding Systems and Fermented Sausage Production Technology. Foods 2020, 9, 338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Luecke, F.K. Microbiological Processes in the Manufacture of Dry Sausage and Raw Ham. Fleischwirtschaft 1986, 66, 1505–1509. [Google Scholar]
  8. Lücke, F.-K. Utilization of microbes to process and preserve meat. Meat Sci. 2000, 56, 105–115. [Google Scholar] [CrossRef] [Scilit]
  9. Cocconcelli, P.S.; Fontana, C. Bacteria. In Handbook of Fermented Meat and Poultry; Wiley: New York, NY, USA, 2014; pp. 117–128. [Google Scholar]
  10. Carballo, J. Sausages: Nutrition, Safety, Processing and Quality Improvement. Foods 2021, 10, 890. [Google Scholar] [CrossRef] [Scilit]
  11. Capozzi, V.; Spano, G. Food Microbial Biodiversity and “Microbes of Protected Origin”. Front. Microbiol. 2011, 2, 237. [Google Scholar] [CrossRef] [Scilit]
  12. Montanari, C.; Barbieri, F.; Magnani, M.; Grazia, L.; Gardini, F.; Tabanelli, G. Phenotypic Diversity of Lactobacillus sakei Strains. Front. Microbiol. 2018, 9, 2003. [Google Scholar] [CrossRef] [Scilit]
  13. Van Reckem, E.; Geeraerts, W.; Charmpi, C.; Van Der Veken, D.; De Vuyst, L.; Leroy, F. Exploring the Link between the Geographical Origin of European Fermented Foods and the Diversity of Their Bacterial Communities: The Case of Fermented Meats. Front. Microbiol. 2019, 10, 2302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Flores, M. Understanding the implications of current health trends on the aroma of wet and dry cured meat products. Meat Sci. 2018, 144, 53–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Ameer, A.; Seleshe, S.; Kim, B.-J.; Kang, A.S.N. Inoculation of Lactobacillus sakei on Quality Traits of Dry Fermented Sausages. Prev. Nutr. Food Sci. 2021, 26, 476–484. [Google Scholar] [CrossRef] [Scilit]
  16. Barat, J.M.; Toldrá, F. Reducing Salt in Processed Meat Products. Processed Meats: Improving Safety, Nutrition and Quality; Woodhead Publishing Limited: Sawston, UK. [CrossRef] [Scilit]
  17. Bover-Cid, S.; Holzapfel, W.H. Improved screening procedure for biogenic amine production by lactic acid bacteria. Int. J. Food Microbiol. 1999, 53, 33–41. [Google Scholar] [CrossRef] [Scilit]
  18. Suzzi, G. Biogenic amines in dry fermented sausages: A review. Int. J. Food Microbiol. 2003, 88, 41–54. [Google Scholar] [CrossRef] [Scilit]
  19. Pasini, F.; Soglia, F.; Petracci, M.; Caboni, M.F.; Marziali, S.; Montanari, C.; Gardini, F.; Grazia, L.; Tabanelli, G. Effect of Fermentation with Different Lactic Acid Bacteria Starter Cultures on Biogenic Amine Content and Ripening Patterns in Dry Fermented Sausages. Nutrients 2018, 10, 1497. [Google Scholar] [CrossRef] [Scilit]
  20. Barbieri, F.; Montanari, C.; Gardini, F.; Tabanelli, G. Biogenic Amine Production by Lactic Acid Bacteria: A Review. Foods 2019, 8, 17. [Google Scholar] [CrossRef] [Scilit]
  21. Landete, J.M.; Rivas, B.D.L.; Marcobal, A.; Muñoz, R. Updated Molecular Knowledge about Histamine Biosynthesis by Bacteria. Crit. Rev. Food Sci. Nutr. 2008, 48, 697–714. [Google Scholar] [CrossRef] [Scilit]
  22. Marcobal, A.; Sonnenburg, J.L. Human milk oligosaccharide consumption by intestinal microbiota. Clin Microbiol Infect 2012, 18, 12. [Google Scholar] [CrossRef] [Scilit]
  23. Dos Santos Cruxen, C.E.; Funck, G.D.; Haubert, L.; da Silva Dannenberg, G.; de Lima Marques, J.; Chaves, F.C.; da Silva, W.P.; Fiorentini, Â.M. Selection of native bacterial starter culture in the production of fermented meat sausages: Application potential, safety aspects, and emerging technologies. Food Res. Int. 2019, 122, 371–382. [Google Scholar] [CrossRef] [Scilit]
  24. Ammor, M.S.; Flórez, A.B.; Mayo, B. Antibiotic resistance in non-enterococcal lactic acid bacteria and bifidobacteria. Food Microbiol. 2007, 24, 559–570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Daza, M.V.B.; Milani, G.; Cortimiglia, C.; Pietta, E.; Bassi, D.; Cocconcelli, P.S. Genomic Insight of Enterococcus faecium UC7251, a Multi-Drug Resistance Strain from Ready-to-Eat Foods, Highlights the Risk of Antimicrobial Resistance in the Food Chain. Front. Microbiol. 2022, 13, 894241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Zonenschain, D.; Rebecchi, A.; Morelli, L. Erythromycin- and tetracycline-resistant lactobacilli in Italian fermented dry sausages. J. Appl. Microbiol. 2009, 107, 1559–1568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Fontana, C.; Patrone, V.; Lopez, C.M.; Morelli, L.; Rebecchi, A. Incidence of Tetracycline and Erythromycin Resistance in Meat-Associated Bacteria: Impact of Different Livestock Management Strategies. Microorganisms 2021, 9, 2111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Barbieri, F.; Tabanelli, G.; Montanari, C.; Dall’Osso, N.; Šimat, V.; Možina, S.S.; Baños, A.; Özogul, F.; Bassi, D.; Fontana, C.; et al. Mediterranean Spontaneously Fermented Sausages: Spotlight on Microbiological and Quality Features to Exploit Their Bacterial Biodiversity. Foods 2021, 10, 2691. [Google Scholar] [CrossRef] [Scilit]
  29. Gevers, D.; Huys, G.; Swings, J. Applicability of rep-PCR fingerprinting for identification of Lactobacillus species. FEMS Microbiol. Lett. 2001, 205, 31–36. [Google Scholar] [CrossRef] [Scilit]
  30. Klijn, N.; Weerkamp, A.H.; de Vos, W.M. Identification of mesophilic lactic acid bacteria by using polymerase chain reaction-amplified variable regions of 16S rRNA and specific DNA probes. Appl. Environ. Microbiol. 1991, 57, 3390–3393. [Google Scholar] [CrossRef] [Scilit]
  31. Chun, J.; Oren, A.; Ventosa, A.; Christensen, H.; Arahal, D.R.; Da Costa, M.S.; Rooney, A.P.; Yi, H.; Xu, X.-W.; De Meyer, S.; et al. Proposed minimal standards for the use of genome data for the taxonomy of prokaryotes. Int. J. Syst. Evol. Microbiol. 2018, 68, 461–466. [Google Scholar] [CrossRef] [Scilit]
  32. European Food Safety Authority (EFSA). EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP). Scientific Opinion Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA J. 2012, 10, 2740. [Google Scholar] [CrossRef] [Scilit]
  33. International Organization for Standardization. Milk and Milk Products: Determination of the Minimal Inhibitory Concentration (MIC) of Antibiotics Applicable to Bifidobacteria and Non-Enterococcal Lactic Acid Bacteria; International Organization for Standardization: Geneva, Switzerland; International Dairy Federation: Brussels, Belgium.
  34. Villedieu, A.; Diaz-Torres, M.L.; Hunt, N.; McNab, R.; Spratt, D.A.; Wilson, M.; Mullany, P. Prevalence of Tetracycline Resistance Genes in Oral Bacteria. Antimicrob. Agents Chemother. 2003, 47, 1028–1036. [Google Scholar] [CrossRef] [Scilit]
  35. Olsvik, B.; Olsen, I.; Tenover, F.C. Detection of tet(M) and tet(Q) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease. Oral Microbiol. Immunol. 1995, 10, 87–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Guglielmetti, E.; Korhonen, J.M.; Heikkinen, J.; Morelli, L.; Von Wright, A. Transfer of plasmid-mediated resistance to tetracycline in pathogenic bacteria from fish and aquaculture environments. FEMS Microbiol Lett 2009, 293, 28–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Gevers, D.; Danielsen, M.; Huys, G.; Swings, J. Molecular Characterization of tet (M) Genes in Lactobacillus Isolates from Different Types of Fermented Dry Sausage. Appl. Environ. Microbiol. 2003, 69, 1270–1275. [Google Scholar] [CrossRef] [Scilit]
  38. Sutcliffe, J.; Grebe, T.; Tait-Kamradt, A.; Wondrack, L. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 1996, 40, 2562–2566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Jensen, L.B.; Frimodt-Møller, N.; Aarestrup, F.M. Presence of erm gene classes in Gram-positive bacteria of animal and human origin in Denmark. FEMS Microbiol. Lett. 1999, 170, 151–158. [Google Scholar] [CrossRef]
  40. Casaburi, A.; Di Martino, V.; Ferranti, P.; Picariello, L.; Villani, F. Technological properties and bacteriocins production by Lactobacillus curvatus 54M16 and its use as starter culture for fermented sausage manufacture. Food Control 2016, 59, 31–45. [Google Scholar] [CrossRef] [Scilit]
  41. Ruiz-Moyano, S.; Martín, A.; Benito, M.J.; Nevado, F.P.; de Guía Córdoba, M. Screening of lactic acid bacteria and bifidobacteria for potential probiotic use in Iberian dry fermented sausages. Meat Sci 2008, 80, 715–721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. McLeod, A.; Mosleth, E.F.; Rud, I.; Dos Santos, F.B.; Snipen, L.; Liland, K.H.; Axelsson, L. Effects of glucose availability in Lactobacillus sakei; metabolic change and regulation of the proteome and transcriptome. PLoS ONE 2017, 12, e0187542. [Google Scholar] [CrossRef] [Scilit]
  43. Widenmann, A.; Schiffer, C.; Ehrmann, M.; Vogel, R. Impact of different sugars and glycosyltransferases on the assertiveness of Latilactobacillus sakei in raw sausage fermentations. Int. J. Food Microbiol. 2022, 366, 109575. [Google Scholar] [CrossRef] [Scilit]
  44. Janßen, D.; Eisenbach, L.; Ehrmann, M.A.; Vogel, R.F. Assertiveness of Lactobacillus sakei and Lactobacillus curvatus in a fermented sausage model. Int. J. Food Microbiol. 2018, 285, 188–197. [Google Scholar] [CrossRef] [Scilit]
  45. Garciafontan, M.; Lorenzo, J.; Parada, A.; Franco, I.; Carballo, J. Microbiological characteristics of “androlla”, a Spanish traditional pork sausage. Food Microbiol. 2007, 24, 52–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Fontán, M.C.G.; Lorenzo, J.M.; Martínez, S.; Franco, I.; Carballo, J. Microbiological characteristics of Botillo, a Spanish traditional pork sausage. LWT 2007, 40, 1610–1622. [Google Scholar] [CrossRef] [Scilit]
  47. Coppola, S.; Mauriello, G.; Aponte, M.; Moschetti, G.; Villani, F. Microbial succession during ripening of Naples-type salami, a southern Italian fermented sausage. Meat Sci. 2000, 56, 321–329. [Google Scholar] [CrossRef] [Scilit]
  48. Ammor, M.S.; Mayo, B. Selection criteria for lactic acid bacteria to be used as functional starter cultures in dry sausage production: An update. Meat Sci. 2007, 76, 138–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Coton, M.; Lebreton, M.; Salas, M.L.; Garnier, L.; Navarri, M.; Pawtowski, A.; Le Blay, G.; Valence, F.; Coton, E.; Mounier, J. Biogenic amine and antibiotic resistance profiles determined for lactic acid bacteria and a propionibacterium prior to use as antifungal bioprotective cultures. Int. Dairy J. 2018, 85, 21–26. [Google Scholar] [CrossRef] [Scilit]
  50. Holck, A.; Axelsson, L.; McLeod, A.; Rode, T.M.; Heir, E. Health and Safety Considerations of Fermented Sausages. J. Food Qual. 2017, 2017, 9753894. [Google Scholar] [CrossRef] [Scilit]
  51. Freiding, S.; Gutsche, K.A.; Ehrmann, M.A.; Vogel, R.F. Genetic screening of Lactobacillus sakei and Lactobacillus curvatus strains for their peptidolytic system and amino acid metabolism, and comparison of their volatilomes in a model system. Syst. Appl. Microbiol. 2011, 34, 311–320. [Google Scholar] [CrossRef] [Scilit]
  52. Romano, A.; Trip, H.; Lonvaud-Funel, A.; Lolkema, J.S.; Lucas, P.M. Evidence of Two Functionally Distinct Ornithine Decarboxylation Systems in Lactic Acid Bacteria. Appl. Environ. Microbiol. 2012, 78, 1953–1961. [Google Scholar] [CrossRef] [Scilit]
  53. Parente, E.; Grieco, S.; Crudele, M. Phenotypic diversity of lactic acid bacteria isolated from fermented sausages produced in Basilicata (Southern Italy). J. Appl. Microbiol. 2001, 90, 943–952. [Google Scholar] [CrossRef] [Scilit]
  54. Samelis, J.; Maurogenakis, F.; Metaxopoulos, J. Characterisation of lactic acid bacteria isolated from naturally fermented Greek dry salami. Int. J. Food Microbiol. 1994, 23, 179–196. [Google Scholar] [CrossRef] [Scilit]
  55. Hugas, M.; Garriga, M.; Aymerich, T.; Monfort, J. Biochemical characterization of lactobacilli from dry fermented sausages. Int. J. Food Microbiol. 1993, 18, 107–113. [Google Scholar] [CrossRef] [Scilit]
  56. Santos, E.M.; González-Fernández, C.; Jaime, I.; Rovira, J. Comparative study of lactic acid bacteria house flora isolated in different varieties of ‘chorizo’. Int. J. Food Microbiol. 1998, 39, 123–128. [Google Scholar] [CrossRef] [Scilit]
  57. Monger, X.C.; Gilbert, A.-A.; Saucier, L.; Vincent, A.T. Antibiotic Resistance: From Pig to Meat. Antibiotics 2021, 10, 1209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Relative frequency of LAB biotypes, identified as L. sakei, L. curvatus and C. alimentarius, found in each MC fermented sausages.
Figure 1. Relative frequency of LAB biotypes, identified as L. sakei, L. curvatus and C. alimentarius, found in each MC fermented sausages.
Foods 11 02776 g001
Figure 2. Relative abundance of resistant biotypes for each species and antibiotics tested.
Figure 2. Relative abundance of resistant biotypes for each species and antibiotics tested.
Foods 11 02776 g002
Table 1. Primers for selected antibiotic resistance genes used in this study.
Table 1. Primers for selected antibiotic resistance genes used in this study.
Primers NameOligonucleotide Sequence (5′-3′)Expected Band (bp)Positive Control StrainReference
ermA1TCTAAAAAGCATGTAAAAGAA645E. faecium PE1[38]
ermA2CTTCGATAGTTTATTAATATTAGT
ermB1GAAAAGGTACTCAACCAAATA639/694E. faecium PE1[38]
ermB2AGTAACGGTACTTAAATTGTTTAC
ermC1ATCTTTGAAATCGGCTCAGG275/294L. reuteri 70[39]
ermC2CAAACCCGTATTCCACGATT
tetL1GTMGTTGCGCGCTATATTCC696E. faecium LMG 20927[29]
tetL2GTGAAMGRWAGCCCACCTAA
tetM1GAACTCGAACAAGAGGAAAGC740L. plantarum 146[35]
tetM2ATGGAAGCCCAGAAAGGAT
tetS1GGAGTACAGTCACAAACTCG335L. reuteri 541[36]
tetS2GGATATAAGGAGCAACTTTG
tetW1GAGAGCCTGCTATATGCCAGC168L. reuteri 534[34]
tetW2GGGCGTATCCACAATGTTAAC
Table 2. Type of sausages, number of isolates and biotypes from the four different production countries (Italy, Slovenia, Spain and Croatia).
Table 2. Type of sausages, number of isolates and biotypes from the four different production countries (Italy, Slovenia, Spain and Croatia).
Production
Country
Type of SausageSample NameNumber of
Isolates
Biotypes
ItalySalame Fabriano-producer 1 (Marche)IM1583
Salame Fabriano-producer 2 (Marche)IM2482
Salame Alfianello (Brescia), LombardyIAL674
SloveniaTraditional smoked salami with nitratesSN705
Traditional smoked salami without nitratesSWO706
SpainSalchichòn BérchulesESB6911
Chorizo BérchulesECB4816
Chorizo OlveraECO527
Salchichon OlveraESO7019
Chorizo EcijaECE6922
Salchichon EcijaESE698
Salchichon AlhendinESA6711
CroatiaSalami ZminjskaKlobasicaHZK5321
Traditional smoked salamiHS495
Traditional unsmoked salamiHNS5511
Total15 914151
Table 3. Unimodal distribution of MICs for L. sakei and L. curvatus isolated biotypes. The resistant strains for each antibiotic are highlighted (bold and italics).
Table 3. Unimodal distribution of MICs for L. sakei and L. curvatus isolated biotypes. The resistant strains for each antibiotic are highlighted (bold and italics).
Antibiotic aSpeciesMIC Value (µg mL−1)
<0.0160.0320.0630.1250.250.51248163264128256
GenL. sakei 114113327103
L. curvatus 132910105
KanL. sakei 151220202156
L. curvatus 13811773
StrL. sakei 1510101722223
L. curvatus 1 2377947
TetL. sakei 7592617561 14
L. curvatus 24399661
EryL. sakei41137171335
L. curvatus 3 715762
ClinL. sakei 6661922211
L. curvatus 203111 221
ChlorL. sakei 7210332972
L. curvatus 1442731
AmpL. sakei 7 29201240
L. curvatus 11511742
a Gen = Gentamycin; Kan = Kanamycin; Str = Streptomycin; Tet = Tetracycline; Ery = Erythromycin; Clin = Clindamycin; Chlor = Chloramphenicol; Amp = Ampicillin.
Table 4. BAs production by L. curvatus strains sorted by origin. *: the presence of (S) or (R) indicates an antibiotic-sensitive or antibiotic-resistant strain, respectively.
Table 4. BAs production by L. curvatus strains sorted by origin. *: the presence of (S) or (R) indicates an antibiotic-sensitive or antibiotic-resistant strain, respectively.
Countries of OriginL. Curvatus Aminobiogenic StrainsTyramineHistaminePutrescineCadaverine
ItalyL. curvatus IAL6 (S) *+
SpainL. curvatus ESB8 (S)+
L. curvatus ECB11 (S)+
L. curvatus ECB12 (S)+
L. curvatus ECO46 (S)+
L. curvatus ESO6 (R)
L. curvatus ESO13 (R)+
L. curvatus ESO14 (R)++
L. curvatus ESO16 (R)+
L. curvatus ESO19 (R)
L. curvatus ESO25 (R)
L. curvatus ESO52 (R)
L. curvatus ESO59 (S)++
L. curvatus ESO61 (R)+
L. curvatus ECE16 (R)++
L. curvatus ECE25 (R)
L. curvatus ECE27 (R)+
L. curvatus ECE32 (S)+
L. curvatus ECE35 (S)+
L. curvatus ECE37 (S)+
L. curvatus ECE40 (R)
L. curvatus ECE42 (S)+
L. curvatus ECE46 (S)++
L. curvatus ECE51 (S)+
L. curvatus ECE52 (S)+
L. curvatus ECE53 (R)
L. curvatus ECE54 (S)+
L. curvatus ECE57 (S)+
L. curvatus ESE3 (S)+
L. curvatus ESE19 (S)+
L. curvatus ESA38 (S)+
L. curvatus ESA53 (S)+
CroatiaL. curvatus HZK3 (R)+
L. curvatus HZK32 (R)
L. curvatus HZK43 (R)
L. curvatus HZK49 (R)
L. curvatus HNS1 (R)
L. curvatus HNS18 (R)
L. curvatus HNS20 (R)
L. curvatus HNS55 (S)
Total strains40191100
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Bassi, D.; Milani, G.; Belloso Daza, M.V.; Barbieri, F.; Montanari, C.; Lorenzini, S.; Šimat, V.; Gardini, F.; Tabanelli, G. Taxonomical Identification and Safety Characterization of Lactobacillaceae from Mediterranean Natural Fermented Sausages. Foods 2022, 11, 2776. https://doi.org/10.3390/foods11182776

AMA Style

Bassi D, Milani G, Belloso Daza MV, Barbieri F, Montanari C, Lorenzini S, Šimat V, Gardini F, Tabanelli G. Taxonomical Identification and Safety Characterization of Lactobacillaceae from Mediterranean Natural Fermented Sausages. Foods. 2022; 11(18):2776. https://doi.org/10.3390/foods11182776

Chicago/Turabian Style

Bassi, Daniela, Giovanni Milani, Mireya Viviana Belloso Daza, Federica Barbieri, Chiara Montanari, Silvia Lorenzini, Vida Šimat, Fausto Gardini, and Giulia Tabanelli. 2022. "Taxonomical Identification and Safety Characterization of Lactobacillaceae from Mediterranean Natural Fermented Sausages" Foods 11, no. 18: 2776. https://doi.org/10.3390/foods11182776

APA Style

Bassi, D., Milani, G., Belloso Daza, M. V., Barbieri, F., Montanari, C., Lorenzini, S., Šimat, V., Gardini, F., & Tabanelli, G. (2022). Taxonomical Identification and Safety Characterization of Lactobacillaceae from Mediterranean Natural Fermented Sausages. Foods, 11(18), 2776. https://doi.org/10.3390/foods11182776

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop