Comparison of the Effects of 5-Hydroxymethylfurfural in Milk Powder Matrix and Standard Water on Oxidative Stress System of Zebrafish
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Determination of the Degradation Characteristics of 5-HMF and FF over Time by HPLC
2.3. 5-HMF Exposure and Developmental Observations
2.4. Determination of Oxidation Parameters
2.5. ROS Assay
2.6. Gene Expression Analysis
2.7. Determination of 5-HMF Residues in Zebrafish Larvae
2.8. Statistical Analysis
3. Results
3.1. Determination of the Degradation Characteristics of 5-HMF and FF over Time by HPLC
3.2. The Determination of LD50 and Developmental Observations
3.3. Suitable Exposure Concentration of Milk Powder Matrix
3.4. Determination of Oxidation Parameters
3.5. ROS Assay
3.6. Gene Expression Analysis
3.7. Determination of 5-HMF Residues in Zebrafish Larvae
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Yang, S.; Zhang, Z.; Li, J.; Niu, Y.; Yu, L.L. Inhibition Mechanism of L-Cysteine on Maillard Reaction by Trapping 5-Hydroxymethylfurfural. Foods 2021, 10, 1391. [Google Scholar] [CrossRef] [PubMed]
- Capuano, E.; Ferrigno, A.; Acampa, I.; Serpen, A.; Acar, O.C.; Goekmen, V.; Fogliano, V. Effect of Flour Type on Maillard Reaction and Acrylamide Formation during Toasting of Bread Crisp Model Systems and Mitigation Strategies. Food Res. Int. 2009, 42, 1295–1302. [Google Scholar] [CrossRef]
- Lee, A.P.; Barbano, D.M.; Drake, M.A. The Influence of Ultra-Pasteurization by Indirect Heating Versus Direct Steam Injection on Skim and 2% Fat Milks. J. Dairy Sci. 2017, 100, 1688–1701. [Google Scholar] [CrossRef] [Green Version]
- EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids (CEF). Scientific Opinion on Flavouring Group Evaluation 13rev1: Furfuryl and Furan Derivatives with and without Additional Side-Chain Substituents and Heteroatoms from Chemical Group 14. EFSA J. 2010, 8, 1403. [Google Scholar] [CrossRef]
- Zhao, L.; Chen, J.; Su, J.; Li, L.; Hu, S.; Li, B.; Zhang, X.; Xu, Z.; Chen, T. In Vitro Antioxidant and Antiproliferative Activities of 5-Hydroxymethylfurfural. J. Agric. Food Chem. 2013, 61, 10604–10611. [Google Scholar] [CrossRef] [PubMed]
- Ge, Q.; Chen, L.; Yuan, Y.; Liu, L.; Feng, F.; Lv, P.; Ma, S.; Chen, K.; Yao, Q. Network Pharmacology-Based Dissection of the Anti-Diabetic Mechanism of Lobelia Chinensis. Front. Pharmacol. 2020, 11, 347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chow, P.H.; Kourghi, M.; Pei, J.V.; Nourmohammadi, S.; Yool, A.J. 5-Hydroxymethyl-Furfural and Structurally Related Compounds Block the Ion Conductance in Human Aquaporin-1 Channels and Slow Cancer Cell Migration and Invasion. Mol. Pharmacol. 2020, 98, 38–48. [Google Scholar] [CrossRef]
- Bauer-Marinovic, M.; Taugner, F.; Florian, S.; Glatt, H. Toxicity Studies with 5-Hydroxymethylfurfural and Its Metabolite 5-Sulphooxymethylfurfural in Wild-Type Mice and Transgenic Mice Expressing Human Sulphotransferases 1a1 and 1a2. Arch. Toxicol. 2012, 86, 701–711. [Google Scholar] [CrossRef]
- Durling, L.J.K.; Busk, L.; Hellman, B.E. Evaluation of the DNA Damaging Effect of the Heat-Induced Food Toxicant 5-Hydroxymethylfurfural (Hmf) in Various Cell Lines with Different Activities of Sulfotransferases. Food Chem. Toxicol. 2009, 47, 880–884. [Google Scholar] [CrossRef]
- Zhu, J.; Chen, L.; Dong, Y.; Li, J.; Liu, X. Spectroscopic and Molecular Modeling Methods to Investigate the Interaction between 5-Hydroxymethyl-2-Furfural and Calf Thymus DNA Using Ethidium Bromide as a Probe. Spectrochim. Acta Mol. Biomol. Spectrosc. 2014, 124, 78–83. [Google Scholar] [CrossRef]
- Cocchi, M.; Durante, C.; Lambertini, P.; Manzini, S.; Marchetti, A.; Sighinolfi, S.; Totaro, S. Evolution of 5-(Hydroxymethyl)Furfural and Furfural in the Production Chain of the Aged Vinegar Aceto Balsamico Tradizionale Di Modena. Food Chem. 2011, 124, 822–832. [Google Scholar] [CrossRef]
- Zhang, H.; Wei, L.; Liu, J.; Lin, S.; Yuan, Y. Detection of 5-Hydroxymethyl-2-Furfural Levels in Selected Chinese Foods by Ultra-High-Performance Liquid Chromatograph Analytical Method. Food Anal. Methods 2014, 7, 181–188. [Google Scholar] [CrossRef]
- González-Gómez, L.; Morante-Zarcero, S.; Pérez-Quintanilla, D.; Sierra, I. Simultaneous Determination of Furanic Compounds and Acrylamide in Insect-Based Foods by Hplc-Qqq-Ms/Ms Employing a Functionalized Mesostructured Silica as Sorbent in Solid-Phase Extraction. Foods 2021, 10, 1557. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Shi, X.; Tang, Y.; Xie, Y.; Du, Z. The Effects of Heat Treatment and Fermentation Processes on the Formation of Furfurals in Milk-Based Dairy Products Using a Quechers Technique Followed by Gas Chromatography Coupled with Triple Quadrupole Mass Spectrometry. Food Chem. 2020, 313, 125930. [Google Scholar] [CrossRef] [PubMed]
- Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxid. Med. Cell. Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef]
- Zhao, H.; Zhang, R.; Yan, X.; Fan, K. Superoxide Dismutase Nanozymes: An Emerging Star for Anti-Oxidation. J. Mater. Chem. B 2021, 9, 6939–6957. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhong, Z.; Wang, M.; Zhang, X. 5-Hydroxymethyl-2-Furaldehyde Induces Developmental Toxicology and Decreases Bone Mineralization in Zebrafish Larvae. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2022, 254, 109254. [Google Scholar] [CrossRef]
- Irie, N.; Kuratani, S. Comparative Transcriptome Analysis Reveals Vertebrate Phylotypic Period During Organogenesis. Nat. Commun. 2010, 2, 248. [Google Scholar] [CrossRef] [Green Version]
- Nishimura, Y.; Murakami, S.; Ashikawa, Y.; Sasagawa, S.; Umemoto, N.; Shimada, Y.; Tanaka, T. Zebrafish as a Systems Toxicology Model for Developmental Neurotoxicity Testing. Congenit. Anom. 2015, 55, 1–16. [Google Scholar] [CrossRef]
- Noyes, P.; Haggard, D.E.; Gonnerman, G.D.; Tanguay, R.L. Advanced Morphological—Behavioral Test Platform Reveals Neurodevelopmental Defects in Embryonic Zebrafish Exposed to Comprehensive Suite of Halogenated and Organophosphate Flame Retardants. Toxicol. Sci. 2015, 145, 177–195. [Google Scholar] [CrossRef] [Green Version]
- Glatt, H.; Schneider, H.; Liu, Y. V79-Hcyp2e1-Hsult1a1, a Cell Line for the Sensitive Detection of Genotoxic Effects Induced by Carbohydrate Pyrolysis Products and Other Food-Borne Chemicals. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2005, 580, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Boekel, M. Effect of Heating on Maillard Reactions in Milk. Food Chem. 1998, 62, 403–414. [Google Scholar] [CrossRef]
- Morales, F.J.; Jiménez-Pérez, S. Study of Hydroxymethylfurfural Formation from Acid Degradation of the Amadori Product in Milk-Resembling Systems. J. Agric. Food Chem. 1998, 46, 3885–3890. [Google Scholar] [CrossRef]
- Chávez-Servín, J.L.; Castellote, A.I.; López-Sabater, M.C. Analysis of Potential and Free Furfural Compounds in Milk-Based Formulae by High-Performance Liquid Chromatography: Evolution During Storage. J. Chromatogr. A 2005, 1076, 133–140. [Google Scholar] [CrossRef]
- Gong, M.; Zhou, Z.; Liu, S.; Zhu, S.; Li, G.; Zhong, F.; Mao, J. Formation Pathways and Precursors of Furfural During Zhenjiang Aromatic Vinegar Production. Food Chem. 2021, 354, 129503. [Google Scholar] [CrossRef] [PubMed]
- Shen, Z.; Ma, X.; Ali, M.M.; Liang, J.; Du, Z. Analysis of the Evolution of Potential and Free Furfural Compounds in the Production Chain of Infant Formula and Risk Assessment. Food Chem. 2021, 368, 130814. [Google Scholar] [CrossRef]
- Sies, H. Oxidative Stress: Oxidants and Antioxidants. Exp. Physiol. 1997, 82, 291–295. [Google Scholar] [CrossRef]
- Wang, C.; Liu, Z.; Hu, T.; Li, Y.; Liu, R.; Zhang, J.; He, H. Potential Neurotoxicity of 5-Hydroxymethylfurfural and Its Oligomers: Widespread Substances in Carbohydrate-Containing Foods. Food Funct. 2020, 11, 4216–4223. [Google Scholar] [CrossRef]
- Wang, M.; Zhao, F.; Peng, H.; Lou, C.; Li, Y.; Ding, X.; Yu, X.; Yang, G.; Xu, D.; Jiang, L.; et al. Investigation on the Morphological Protective Effect of 5-Hydroxymethylfurfural Extracted from Wine-Processed Fructus Corni on Human L02 Hepatocytes. J. Ethnopharmacol. 2010, 130, 424–428. [Google Scholar] [CrossRef]
- Konishi, T.; Kato, K.; Araki, T.; Shiraki, K.; Takagi, M.; Tamaru, Y. A New Class of Glutathione S-Transferase from the Hepatopancreas of the Red Sea Bream Pagrus Major. Biochem. J. 2005, 388, 299–307. [Google Scholar] [CrossRef] [Green Version]
- Tiedge, M.; Lortz, S.; Drinkgern, J.; Lenzen, S. Relation between Antioxidant Enzyme Gene Expression and Antioxidative Defense Status of Insulin-Producing Cells. Diabetes 1997, 46, 1733–1742. [Google Scholar] [CrossRef]
- Rival, S.G.; Boeriu, C.G.; Wichers, H.J. Caseins and Casein Hydrolysates. 2. Antioxidative Properties and Relevance to Lipoxygenase Inhibition. J. Agric. Food Chem. 2001, 49, 295–302. [Google Scholar] [CrossRef]
- Wang, C.; Zheng, L.; Su, G.; Zeng, X.A.; Sun, B.; Zhao, M. Evaluation and Exploration of Potentially Bioactive Peptides in Casein Hydrolysates against Liver Oxidative Damage in Stz/Hfd-Induced Diabetic Rats. J. Agric. Food Chem. 2020, 68, 2393–2405. [Google Scholar] [CrossRef] [PubMed]
- Zunquin, G.; Rouleau, V.; Bouhallab, S.; Bureau, F.; Theunynck, D.; Rousselot, P.; Arhan, P.; Bougle, D. Iron and Exercise Induced Alterations in Antioxidant Status. Protection by Dietary Milk Proteins. Free Radic. Res. 2006, 40, 535–542. [Google Scholar] [CrossRef] [PubMed]







| Gene | Forword Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| β-actin | TCTGGTGATGGTTGACCCA | GGTGAAGCTGTAGCCACGCT |
| sod | GTCCGCACTTCAACCCTCA | TCCTCATTGCCACCCTTCC |
| gpx1a | AGGCACAACAGTCAGGGATT | CAGGAACGCAAACAGAGGG |
| cat | CAAGGTCTGGTCCCATAAA | TGACTGGTAGTTGGAGGTAA |
| gstr | CGATAAGAAGGAGCACCAGA | GCCATTTCAGCAGGATTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hou, Y.; Zhang, X.; Liu, X.; Wu, Q.; Hou, J.; Su, P.; Guo, Q. Comparison of the Effects of 5-Hydroxymethylfurfural in Milk Powder Matrix and Standard Water on Oxidative Stress System of Zebrafish. Foods 2022, 11, 1814. https://doi.org/10.3390/foods11121814
Hou Y, Zhang X, Liu X, Wu Q, Hou J, Su P, Guo Q. Comparison of the Effects of 5-Hydroxymethylfurfural in Milk Powder Matrix and Standard Water on Oxidative Stress System of Zebrafish. Foods. 2022; 11(12):1814. https://doi.org/10.3390/foods11121814
Chicago/Turabian StyleHou, Yingyu, Xinyue Zhang, Xixia Liu, Qin Wu, Jianjun Hou, Ping Su, and Qian Guo. 2022. "Comparison of the Effects of 5-Hydroxymethylfurfural in Milk Powder Matrix and Standard Water on Oxidative Stress System of Zebrafish" Foods 11, no. 12: 1814. https://doi.org/10.3390/foods11121814
APA StyleHou, Y., Zhang, X., Liu, X., Wu, Q., Hou, J., Su, P., & Guo, Q. (2022). Comparison of the Effects of 5-Hydroxymethylfurfural in Milk Powder Matrix and Standard Water on Oxidative Stress System of Zebrafish. Foods, 11(12), 1814. https://doi.org/10.3390/foods11121814
