Ginsenoside Rf Enhances Exercise Endurance by Stimulating Myoblast Differentiation and Mitochondrial Biogenesis in C2C12 Myotubes and ICR Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals and Diet
2.3. Forced Swimming Endurance Test and Sample Collection
2.4. Cell Culture, Differentiation, and Sample Treatment
2.5. ATP Content Assay
2.6. Cell Counting Kit 8 (CCK8) Assay
2.7. Western Blotting
2.8. Mitotracker and Immunofluorescence Staining
2.9. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.10. Statistical Analysis
3. Results
3.1. G-Rf Enhances Forced Exercise Endurance of ICR Mice
3.2. G-Rf Stimulates Muscular ATP Production of C2C12 Myotubes
3.3. G-Rf Increases Differentiation of C2C12 Myoblasts
3.4. G-Rf Stimulates Mitochondrial Biogenesis in C2C12 Myotubes
3.5. G-Rf Improves Exercise Endurance by Activating the AMPK and p38 MAPK Signaling Pathways
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
References
- Papa, E.V.; Dong, X.; Hassan, M. Skeletal Muscle Function Deficits in the Elderly: Current Perspectives on Resistance Training. J. Nat. Sci. 2017, 3, e272. [Google Scholar] [PubMed]
- Yokoyama, S.; Asahara, H. The myogenic transcriptional network. Cell Mol. Life Sci. 2011, 68, 1843–1849. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hock, M.B.; Kralli, A. Transcriptional control of mitochondrial biogenesis and function. Annu. Rev. Physiol. 2009, 71, 177–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wagatsuma, A.; Sakuma, K. Mitochondria as a potential regulator of myogenesis. Sci. World J. 2013, 2013, 593267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fernandez-Marcos, P.J.; Auwerx, J. Regulation of PGC-1alpha, a nodal regulator of mitochondrial biogenesis. Am. J. Clin. Nutr. 2011, 93, 884S–890S. [Google Scholar] [CrossRef] [Green Version]
- Taherzadeh-Fard, E.; Saft, C.; Akkad, D.A.; Wieczorek, S.; Haghikia, A.; Chan, A.; Epplen, J.T.; Arning, L. PGC-1alpha downstream transcription factors NRF-1 and TFAM are genetic modifiers of Huntington disease. Mol. Neurodegener. 2011, 6, 32. [Google Scholar] [CrossRef] [Green Version]
- Jung, S.; Kim, K. Exercise-induced PGC-1alpha transcriptional factors in skeletal muscle. Integr. Med. Res. 2014, 3, 155–160. [Google Scholar] [CrossRef] [Green Version]
- Jung, J.; Lee, N.K.; Paik, H.D. Bioconversion, health benefits, and application of ginseng and red ginseng in dairy products. Food Sci. Biotechnol. 2017, 26, 1155–1168. [Google Scholar] [CrossRef]
- Ma, G.D.; Chiu, C.H.; Hsu, Y.J.; Hou, C.W.; Chen, Y.M.; Huang, C.C. Changbai Mountain Ginseng (Panax ginseng C.A. Mey) Extract Supplementation Improves Exercise Performance and Energy Utilization and Decreases Fatigue-Associated Parameters in Mice. Molecules 2017, 22, 237. [Google Scholar] [CrossRef]
- Shin, E.J.; Jo, S.; Choi, S.; Cho, C.W.; Lim, W.C.; Hong, H.D.; Lim, T.G.; Jang, Y.J.; Jang, M.; Byun, S.; et al. Red Ginseng Improves Exercise Endurance by Promoting Mitochondrial Biogenesis and Myoblast Differentiation. Molecules 2020, 25, 865. [Google Scholar] [CrossRef] [Green Version]
- Ru, W.; Wang, D.; Xu, Y.; He, X.; Sun, Y.E.; Qian, L.; Zhou, X.; Qin, Y. Chemical constituents and bioactivities of Panax ginseng (C. A. Mey.). Drug Discov. Ther. 2015, 9, 23–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, S.S.; Chen, Z.C. Evaluation of Antifatigue Effects of 20(S)-Ginsenoside Rg3 in Forced Swimming Mice. Indian J. Pharm. Sci. 2018, 80, 510–515. [Google Scholar] [CrossRef]
- Qi, B.; Zhang, L.; Zhang, Z.; Ouyang, J.; Huang, H. Effects of ginsenosides-Rb1 on exercise-induced oxidative stress in forced swimming mice. Pharmacogn. Mag. 2014, 10, 458–463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, K.T. Botanical characteristics, pharmacological effects and medicinal components of Korean Panax ginseng C A Meyer. Acta Pharmacol. Sin. 2008, 29, 1109–1118. [Google Scholar] [CrossRef] [Green Version]
- Theilen, N.T.; Kunkel, G.H.; Tyagi, S.C. The Role of Exercise and TFAM in Preventing Skeletal Muscle Atrophy. J. Cell Physiol. 2017, 232, 2348–2358. [Google Scholar] [CrossRef]
- Yang, Q.Y.; Lai, X.D.; Ouyang, J.; Yang, J.D. Effects of Ginsenoside Rg3 on fatigue resistance and SIRT1 in aged rats. Toxicology 2018, 409, 144–151. [Google Scholar] [CrossRef]
- Zhuang, C.L.; Mao, X.Y.; Liu, S.; Chen, W.Z.; Huang, D.D.; Zhang, C.J.; Chen, B.C.; Shen, X.; Yu, Z. Ginsenoside Rb1 improves postoperative fatigue syndrome by reducing skeletal muscle oxidative stress through activation of the PI3K/Akt/Nrf2 pathway in aged rats. Eur. J. Pharmacol. 2014, 740, 480–487. [Google Scholar] [CrossRef]
- So, S.H.; Lee, J.W.; Kim, Y.S.; Hyun, S.H.; Han, C.K. Red ginseng monograph. J. Ginseng Res. 2018, 42, 549–561. [Google Scholar] [CrossRef]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef] [Green Version]
- Baker, J.S.; McCormick, M.C.; Robergs, R.A. Interaction among Skeletal Muscle Metabolic Energy Systems during Intense Exercise. J. Nutr. Metab. 2010, 2010, 905612. [Google Scholar] [CrossRef] [Green Version]
- Han, S.E.; Kim, S.J.; Kim, Y.I.; Nam-Goong, I.S.; Jung, H.W.; Kim, E.S. Enhancing effects of anagliptin on myoblast differentiation and the expression of mitochondrial biogenetic factors in C2C12 mouse skeletal muscle cells. Clin. Exp. Pharmacol. Physiol. 2020, 47, 903–906. [Google Scholar] [CrossRef] [PubMed]
- Kou, G.; Li, Z.; Wu, C.; Liu, Y.; Hu, Y.; Guo, L.; Xu, X.; Zhou, Z. Citrus Tangeretin Improves Skeletal Muscle Mitochondrial Biogenesis via Activating the AMPK-PGC1-alpha Pathway In Vitro and In Vivo: A Possible Mechanism for Its Beneficial Effect on Physical Performance. J. Agric. Food Chem. 2018, 66, 11917–11925. [Google Scholar] [CrossRef] [PubMed]
- Nabeshima, Y.; Hanaoka, K.; Hayasaka, M.; Esumi, E.; Li, S.; Nonaka, I.; Nabeshima, Y. Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature 1993, 364, 532–535. [Google Scholar] [CrossRef] [PubMed]
- Toydemir, R.M.; Rutherford, A.; Whitby, F.G.; Jorde, L.B.; Carey, J.C.; Bamshad, M.J. Mutations in embryonic myosin heavy chain (MYH3) cause Freeman-Sheldon syndrome and Sheldon-Hall syndrome. Nat. Genet. 2006, 38, 561–565. [Google Scholar] [CrossRef]
- Lowey, S.; Waller, G.S.; Trybus, K.M. Function of skeletal muscle myosin heavy and light chain isoforms by an in vitro motility assay. J. Biol. Chem. 1993, 268, 20414–20418. [Google Scholar] [CrossRef]
- Barbieri, E.; Battistelli, M.; Casadei, L.; Vallorani, L.; Piccoli, G.; Guescini, M.; Gioacchini, A.M.; Polidori, E.; Zeppa, S.; Ceccaroli, P.; et al. Morphofunctional and Biochemical Approaches for Studying Mitochondrial Changes during Myoblasts Differentiation. J. Aging Res. 2011, 2011, 845379. [Google Scholar] [CrossRef] [Green Version]
- Islam, H.; Edgett, B.A.; Gurd, B.J. Coordination of mitochondrial biogenesis by PGC-1alpha in human skeletal muscle: A re-evaluation. Metabolism 2018, 79, 42–51. [Google Scholar] [CrossRef]
- Jager, S.; Handschin, C.; St-Pierre, J.; Spiegelman, B.M. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc. Natl. Acad. Sci. USA 2007, 104, 12017–12022. [Google Scholar] [CrossRef] [Green Version]





| Gene | Direction | Sequence (5′ to 3′) |
|---|---|---|
| PGC-1α | Forward | TATGGAGTGACATAGAGTGTGCT |
| Reverse | CCACTTCAATCCACCCAGAAAG | |
| NRF-1 | Forward | CCATCTATCCGAAGAGACAGC |
| Reverse | GGGTGAGATGGCAGAGTACAATC | |
| TFAM | Forward | GGAATGTGGAGCGTGCTAAAA |
| Reverse | GCTGGAAAAACACTTCGGAATA | |
| GAPDH | Forward | CATGGCCTTCCGTGTTCCTAC |
| Reverse | TCAGTGGGCCCTCAGATGC | |
| mtDNA | Forward | CGTTAGGTCAAGGTGTAGCC |
| Reverse | CCAGACACACTTTCCAGTATG | |
| β-Actin | Forward | GATTACTGCTCTGGCTCCTAGC |
| Reverse | GATTACTGCTCTGGCTCCTAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, W.-C.; Shin, E.J.; Lim, T.-G.; Choi, J.W.; Song, N.-E.; Hong, H.-D.; Cho, C.-W.; Rhee, Y.K. Ginsenoside Rf Enhances Exercise Endurance by Stimulating Myoblast Differentiation and Mitochondrial Biogenesis in C2C12 Myotubes and ICR Mice. Foods 2022, 11, 1709. https://doi.org/10.3390/foods11121709
Lim W-C, Shin EJ, Lim T-G, Choi JW, Song N-E, Hong H-D, Cho C-W, Rhee YK. Ginsenoside Rf Enhances Exercise Endurance by Stimulating Myoblast Differentiation and Mitochondrial Biogenesis in C2C12 Myotubes and ICR Mice. Foods. 2022; 11(12):1709. https://doi.org/10.3390/foods11121709
Chicago/Turabian StyleLim, Won-Chul, Eun Ju Shin, Tae-Gyu Lim, Jae Woong Choi, Nho-Eul Song, Hee-Do Hong, Chang-Won Cho, and Young Kyoung Rhee. 2022. "Ginsenoside Rf Enhances Exercise Endurance by Stimulating Myoblast Differentiation and Mitochondrial Biogenesis in C2C12 Myotubes and ICR Mice" Foods 11, no. 12: 1709. https://doi.org/10.3390/foods11121709
APA StyleLim, W.-C., Shin, E. J., Lim, T.-G., Choi, J. W., Song, N.-E., Hong, H.-D., Cho, C.-W., & Rhee, Y. K. (2022). Ginsenoside Rf Enhances Exercise Endurance by Stimulating Myoblast Differentiation and Mitochondrial Biogenesis in C2C12 Myotubes and ICR Mice. Foods, 11(12), 1709. https://doi.org/10.3390/foods11121709

