An Editing-Site-Specific PCR Method for Detection and Quantification of CAO1-Edited Rice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Primers and TaqMan Probes
2.3. DNA Extraction
2.4. Preparation of Blinded Samples
2.5. Real-Time PCR
2.6. Droplet Digital PCR
2.7. Estimation of Genome-Edited Ingredient Content
3. Results and Discussion
3.1. Design of an Editing-Site-Specific PCR Method
3.2. Specificity of the Editing-Site-Specific PCR Method
3.3. Sensitivity of the Editing-Site-Specific PCR Method
3.4. Quantification of Blinded Samples by qPCR
3.5. Quantification of Blinded Samples by ddPCR
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Zhang, Y.; Ma, X.; Xie, X.; Liu, Y.G. CRISPR/Cas9-Based Genome Editing in Plants. Prog. Mol. Biol. Transl. Sci. 2017, 149, 133–150. [Google Scholar] [CrossRef]
- Songstad, D.D.; Petolino, J.F.; Voytas, D.F.; Reichert, N.A. Genome Editing of Plants. Crit. Rev. Plant Sci. 2017, 36, 1–23. [Google Scholar] [CrossRef] [Green Version]
- Belhaj, K.; Chaparro-Garcia, A.; Kamoun, S.; Nekrasov, V. Plant genome editing made easy: Targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods 2013, 9, 39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hua, K.; Zhang, J.; Botella, J.R.; Ma, C.; Kong, F.; Liu, B.; Zhu, J.K. Perspectives on the Application of Genome-Editing Technologies in Crop Breeding. Mol. Plant 2019, 12, 1047–1059. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piatek, A.A.; Lenaghan, S.C.; Neal Stewart, C., Jr. Advanced editing of the nuclear and plastid genomes in plants. Plant Sci. 2018, 273, 42–49. [Google Scholar] [CrossRef]
- Ansari, W.A.; Chandanshive, S.U.; Bhatt, V.; Nadaf, A.B.; Vats, S.; Katara, J.L.; Deshmukh, R. Genome Editing in Cereals: Approaches, Applications and Challenges. Int. J. Mol. Sci. 2020, 21, 4040. [Google Scholar] [CrossRef] [PubMed]
- Hilscher, J.; Burstmayr, H.; Stoger, E. Targeted modification of plant genomes for precision crop breeding. Biotechnol. J. 2017, 12, 1600173. [Google Scholar] [CrossRef]
- Ito, Y.; Nishizawa-Yokoi, A.; Endo, M.; Mikami, M.; Toki, S. CRISPR/Cas9-mediated mutagenesis of the RIN locus that regulates tomato fruit ripening. Biochem. Biophys. Res. Commun. 2015, 467, 76–82. [Google Scholar] [CrossRef]
- Wang, Y.; Cheng, X.; Shan, Q.; Zhang, Y.; Liu, J.; Gao, C.; Qiu, J.L. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat. Biotechnol. 2014, 32, 947–951. [Google Scholar] [CrossRef]
- Li, T.; Liu, B.; Spalding, M.H.; Weeks, D.P.; Yang, B. High-efficiency TALEN-based gene editing produces disease-resistant rice. Nat. Biotechnol. 2012, 30, 390–392. [Google Scholar] [CrossRef]
- Chhalliyil, P.; Ilves, H.; Kazakov, S.A.; Howard, S.J.; Johnston, B.H.; Fagan, J.A. Real-Time Quantitative PCR Method Specific for Detection and Quantification of the First Commercialized Genome-Edited Plant. Foods 2020, 9, 1245. [Google Scholar] [CrossRef]
- Branthôme, F.X. Japan: Breeders Launch Genome Edited Tomato. Available online: http://www.tomatonews.com/en/japan-breeders-launch-genome-edited-tomato_2_1236.html (accessed on 29 January 2021).
- Van de Wiel, C.C.M.; Schaart, J.G.; Lotz, L.A.P.; Smulders, M.J.M. New traits in crops produced by genome editing techniques based on deletions. Plant Biotechnol. Rep. 2017, 11, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Friedrichs, S.; Takasu, Y.; Kearns, P.; Dagallier, B.; Oshima, R.; Schofield, J.; Moreddu, C. Policy Considerations Regarding Genome Editing. Trends Biotechnol. 2019, 37, 1029–1032. [Google Scholar] [CrossRef] [PubMed]
- Friedrichs, S.; Takasu, Y.; Kearns, P.; Dagallier, B.; Moreddu, C. An overview of regulatory approaches to genome editing in agriculture. Biotech. Res. Innov. 2019, 3, 208–220. [Google Scholar] [CrossRef]
- Schmidt, S.M.; Belisle, M.; Frommer, W.B. The evolving landscape around genome editing in agriculture: Many countries have exempted or move to exempt forms of genome editing from GMO regulation of crop plants. EMBO Rep. 2020, 21, e50680. [Google Scholar] [CrossRef] [PubMed]
- Fritsche, S.; Poovaiah, C.; MacRae, E.; Thorlby, G.A. New Zealand Perspective on the Application and Regulation of Gene Editing. Front Plant Sci. 2018, 9, 1323. [Google Scholar] [CrossRef]
- Zhang, D.; Hussain, A.; Manghwar, H.; Xie, K.; Xie, S.; Zhao, S.; Ding, F. Genome editing with the CRISPR-Cas system: An art, ethics and global regulatory perspective. Plant Biotechnol. J. 2020, 18, 1651–1669. [Google Scholar] [CrossRef]
- Lomov, N.A.; Viushkov, V.S.; Petrenko, A.P.; Syrkina, M.S.; Rubtsov, M.A. Methods of Evaluating the Efficiency of CRISPR/Cas Genome Editing. Mol. Biol. 2019, 53, 982–997. [Google Scholar] [CrossRef]
- Li, B.; Ren, N.; Yang, L.; Liu, J.; Huang, Q. A qPCR method for genome editing efficiency determination and single-cell clone screening in human cells. Sci. Rep. 2019, 9, 18877. [Google Scholar] [CrossRef] [Green Version]
- Hua, Y.; Wang, C.; Huang, J.; Wang, K. A simple and efficient method for CRISPR/Cas9-induced mutant screening. J. Genet. Genom. 2017, 44, 207–213. [Google Scholar] [CrossRef]
- Fujita, T.; Yuno, M.; Kitaura, F.; Fujii, H. Detection of genome-edited cells by oligoribonucleotide interference-PCR. DNA Res. 2018, 25, 395–407. [Google Scholar] [CrossRef] [Green Version]
- Li, R.; Ba, Y.; Song, Y.; Cui, J.J.; Zhang, X.J.; Zhang, D.B.; Yang, L.T. Rapid and sensitive screening and identification of CRISPR/Cas9 edited rice plants using quantitative real-time PCR coupled with high resolution melting analysis. Food Control 2020, 112, 107088. [Google Scholar] [CrossRef]
- Mock, U.; Hauber, I.; Fehse, B. Digital PCR to assess gene-editing frequencies (GEF-dPCR) mediated by designer nucleases. Nat. Protoc. 2016, 11, 598–615. [Google Scholar] [CrossRef] [PubMed]
- Peng, C.; Zheng, M.; Ding, L.; Chen, X.; Wang, X.; Feng, X.; Xu, J. Accurate Detection and Evaluation of the Gene-Editing Frequency in Plants Using Droplet Digital PCR. Front. Plant Sci. 2020, 11, 610790. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Yang, S.; Zhang, D.; Zhong, Z.; Tang, X.; Deng, K.; Zhang, Y. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism. Plant Cell Rep. 2016, 35, 1545–1554. [Google Scholar] [CrossRef] [PubMed]
- Ribarits, A.; Eckerstorfer, M.; Simon, S.; Stepanek, W. Genome-Edited Plants: Opportunities and Challenges for an Anticipatory Detection and Identification Framework. Foods 2021, 10, 430. [Google Scholar] [CrossRef] [PubMed]
- Duensing, N.; Sprink, T.; Parrott, W.A.; Fedorova, M.; Lema, M.A.; Wolt, J.D.; Bartsch, D. Novel Features and Considerations for ERA and Regulation of Crops Produced by Genome Editing. Front. Bioeng. Biotechnol. 2018, 6, 79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Wu, Y.; Li, X.; Wang, Y.; Zhang, L.; Li, Y.; Wu, G. Developing a matrix reference material for screening of transgenic rice. Anal. Bioanal. Chem. 2015, 407, 9153–9163. [Google Scholar] [CrossRef]
- Li, J.; Li, L.; Zhang, L.; Zhang, X.; Li, X.; Zhai, S.; Wu, Y. Development of a certified genomic DNA reference material for detection and quantification of genetically modified rice KMD. Anal. Bioanal. Chem. 2020, 412, 7007–7016. [Google Scholar] [CrossRef]
- Li, J.; Zhang, L.; Li, L.; Li, X.; Zhang, X.; Zhai, S.; Wu, Y. Development of Genomic DNA Certified Reference Materials for Genetically Modified Rice Kefeng 6. ACS Omega 2020, 5, 21602–21609. [Google Scholar] [CrossRef] [PubMed]
- European Commission. Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing. 2015. Available online: https://gmo-crl.jrc.ec.europa.eu/doc/MPR%20Report%20Application%2020_10_2015.pdf (accessed on 19 October 2020).
- Cao, L.; Cui, X.; Hu, J.; Li, Z.; Choi, J.R.; Yang, Q.; Xu, F. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications. Biosens. Bioelectron. 2017, 90, 459–474. [Google Scholar] [CrossRef] [PubMed]
- Beer, N.R.; Hindson, B.J.; Wheeler, E.K.; Hall, S.B.; Rose, K.A.; Kennedy, I.M.; Colston, B.W. On-Chip, Real-Time, Single-Copy Polymerase Chain Reaction in Picoliter Droplets. Anal. Chem. 2007, 79, 8471–8475. [Google Scholar] [CrossRef] [Green Version]
- Bogožalec Košir, A.; Demsar, T.; Stebih, D.; Zel, J.; Milavec, M. Digital PCR as an effective tool for GMO quantification in complex matrices. Food Chem. 2019, 294, 73–78. [Google Scholar] [CrossRef] [PubMed]
- Cottenet, G.; Blancpain, C.; Chuah, P.F. Performance assessment of digital PCR for the quantification of GM-maize and GM-soya events. Anal. Bioanal. Chem. 2019, 411, 2461–2469. [Google Scholar] [CrossRef]
- Peng, C.; Wang, H.; Xu, X.; Wang, X.; Chen, X.; Wei, W.; Xu, J. High-throughput detection and screening of plants modified by gene editing using quantitative real-time polymerase chain reaction. Plant J. 2018, 95, 557–567. [Google Scholar] [CrossRef] [PubMed]
- Jacchia, S.; Kagkli, D.M.; Lievens, A.; Angers-Loustau, A.; Savini, C.; Emons, H.; Mazzara, M. Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 2018, 93, 191–200. [Google Scholar] [CrossRef] [PubMed]
- Weisheit, I.; Kroeger, J.A.; Malik, R.; Klimmt, J.; Crusius, D.; Dannert, A.; Paquet, D. Detection of Deleterious On-Target Effects after HDR-Mediated CRISPR Editing. Cell Rep. 2020, 31, 107689. [Google Scholar] [CrossRef]
- Findlay, S.D.; Vincent, K.M.; Berman, J.R.; Postovit, L.M. A Digital PCR-Based Method for Efficient and Highly Specific Screening of Genome Edited Cells. PLoS ONE 2016, 11, e0153901. [Google Scholar] [CrossRef] [PubMed]
Target | Name | Sequence (5→3′) | Amplicon Size (bp) |
---|---|---|---|
PLD gene | KVM159 | TGGTGAGCGTTTTGCAGTCT | 68 |
KVM160 | CTGATCCACTAGCAGGAGGTCC | ||
TM013 | TGTTGTGCTGCCAATGTGGCCTG a | ||
CAO1 gene | CAO1-F | CGGTGATGATGGAGCTGACT | 123–144 |
CAO1-R | GATATCGAACCGGACCACCT | ||
CAO1-w | CAO1-PW | TGCAATTGGAACCCTTGGCCC b | 142 |
CAO1-1 | CAO1-P1 | AAGAACTTGCCTTTTCCCCGG a | 125 |
CAO1-2 | CAO1-P2 | TTGGAACCCTTGGAACCCCG a | 144 |
CAO1-3 | CAO1-P3 | CCCTTGCCCGGGTCATC a | 140 |
CAO1-4 | CAO1-P4 | CAATTGGAACCCTTCCCCGG a | 140 |
CAO1-5 | CAO1-P5 | AGGCCTTGTTCCCATTGCAAA a | 123 |
CAO1-6 | CAO1-P6 | CCATGTCGATGACGTTCCAATTGC a | 130 |
CAO1-7 | CAO1-P7 | TTGGAACCCTTGGT * CCCCG a | 143 |
Sample | Theoretical (%) | Experimental (%) | Mean Experiment (%) | SD | RSD (%) | Bias (%) | ||
---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | ||||||
CAO1-2 | 5 | 5.74 | 4.99 | 5.23 | 5.32 | 0.39 | 7.25 | 6.42 |
2 | 2.29 | 2.00 | 1.73 | 2.01 | 0.28 | 13.78 | 0.37 | |
1 | 1.37 | 0.95 | 0.76 | 1.03 | 0.32 | 30.83 | 2.58 | |
CAO1-3 | 5 | 6.42 | 5.89 | 4.11 | 5.47 | 1.21 | 22.15 | 9.47 |
2 | 2.15 | 1.71 | 1.11 | 1.66 | 0.52 | 31.56 | −17.07 | |
1 | 0.93 | 0.82 | 0.14 | 0.63 | 0.43 | 68.25 | −37.20 | |
CAO1-4 | 5 | 5.31 | 5.13 | 4.07 | 4.84 | 0.67 | 13.84 | −3.22 |
2 | 2.02 | 1.69 | 0.96 | 1.56 | 0.54 | 34.88 | −22.08 | |
1 | 0.49 | 0.45 | 0.05 | 0.33 | 0.24 | 73.31 | −66.81 | |
CAO1-5 | 5 | 4.62 | 4.51 | 4.60 | 4.58 | 0.06 | 1.24 | −8.45 |
2 | 1.12 | 0.95 | 0.94 | 1.00 | 0.10 | 10.23 | −49.85 | |
1 | 0.22 | 0.21 | 0.22 | 0.22 | 0.005 | 2.11 | −78.23 | |
5 | 2.47 | 2.24 | 2.30 | 2.34 | 0.12 | 5.16 | −53.27 | |
CAO1-7 | 2 | 0.21 | 0.10 | 0.06 | 0.12 | 0.08 | 60.24 | −93.77 |
1 | 0.06 | 0.02 | 0.02 | 0.03 | 0.02 | 61.03 | −96.72 |
Sample | Expected Value (%) | Experimental Data (%) by Simplex ddPCR (Edited Type DNA Copy Number/PLD Gene Copy Number) | Experimental Data (%) by Duplex ddPCR (Edited Type DNA Copy Number/Sum of Edited Type and Wild Type DNA Copy Number) | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | Mean | SD | RSD (%) | Bias (%) | 1 | 2 | 3 | Mean | SD | RSD (%) | Bias (%) | ||
CAO1-2 | 5 | 4.91 | 4.66 | 4.67 | 4.75 | 0.14 | 2.99 | −5.06 | 4.78 | 4.75 | 4.90 | 4.81 | 0.08 | 1.63 | −3.79 |
2 | 1.93 | 1.78 | 1.64 | 1.78 | 0.15 | 8.25 | −10.95 | 2.04 | 1.98 | 1.94 | 1.99 | 0.05 | 2.37 | −0.63 | |
1 | 0.99 | 0.95 | 0.95 | 0.96 | 0.03 | 2.63 | −3.71 | 0.93 | 0.92 | 0.99 | 0.95 | 0.04 | 4.08 | −5.42 | |
0.1 | 0.15 | 0.1 | 0.04 | 0.1 | 0.06 | 55.66 | −0.6 | 0.09 | 0.09 | 0.10 | 0.09 | 0.01 | 9.18 | −6.37 | |
CAO1-3 | 5 | 5.1 | 4.87 | 4.88 | 4.95 | 0.13 | 2.55 | −1.01 | 5.22 | 5.12 | 4.84 | 5.06 | 0.20 | 3.91 | 1.15 |
2 | 2.12 | 2.03 | 1.85 | 2.00 | 0.13 | 6.65 | −0.04 | 2.15 | 2.10 | 2.13 | 2.13 | 0.02 | 1.08 | 6.43 | |
1 | 1.05 | 1.04 | 0.99 | 1.03 | 0.03 | 2.82 | 2.81 | 1.00 | 1.00 | 1.00 | 1.00 | 0.00 | 0.31 | −0.09 | |
0.1 | 0.1 | 0.09 | 0.09 | 0.09 | 0.01 | 6.43 | −10.06 | 0.10 | 0.10 | 0.11 | 0.10 | 0.00 | 4.64 | 0.21 | |
CAO1-4 | 5 | 4.51 | 4.43 | 4.31 | 4.41 | 0.1 | 2.29 | −11.71 | 5.04 | 5.16 | 5.19 | 5.13 | 0.08 | 1.57 | 2.54 |
2 | 1.99 | 1.9 | 1.72 | 1.87 | 0.14 | 7.4 | −6.6 | 2.17 | 1.87 | 2.02 | 2.02 | 0.15 | 7.48 | 1.00 | |
1 | 1.03 | 0.98 | 0.89 | 0.97 | 0.07 | 7.24 | −2.97 | 1.01 | 0.90 | 1.01 | 0.97 | 0.07 | 6.75 | −2.93 | |
0.1 | 0.1 | 0.08 | 0.08 | 0.08 | 0.01 | 12.3 | −16.66 | 0.10 | 0.09 | 0.09 | 0.09 | 0.01 | 6.03 | −9.69 | |
CAO1-5 | 5 | 4.74 | 4.86 | 4.84 | 4.81 | 0.06 | 1.28 | −3.72 | 5.02 | 4.77 | 5.03 | 4.94 | 0.14 | 2.93 | −1.17 |
2 | 1.92 | 1.92 | 1.81 | 1.88 | 0.07 | 3.56 | −5.84 | 2.01 | 1.95 | 1.99 | 1.98 | 0.03 | 1.66 | −0.85 | |
1 | 0.97 | 0.96 | 0.96 | 0.96 | 0.01 | 0.65 | −3.77 | 1.10 | 0.98 | 0.95 | 1.01 | 0.08 | 7.87 | 1.25 | |
0.1 | 0.12 | 0.1 | 0.12 | 0.11 | 0.01 | 10.32 | 13.86 | 0.09 | 0.11 | 0.10 | 0.10 | 0.01 | 10.10 | −0.21 | |
5 | 4.70 | 4.79 | 4.73 | 4.74 | 0.05 | 1.04 | −5.19 | 4.96 | 5.02 | 4.95 | 4.98 | 0.04 | 0.76 | −0.48 | |
CAO1-7 | 2 | 2.06 | 2.05 | 2.06 | 2.05 | 0.01 | 0.42 | 2.74 | 2.16 | 1.92 | 2.05 | 2.04 | 0.12 | 5.67 | 2.13 |
1 | 0.90 | 0.95 | 0.90 | 0.92 | 0.03 | 2.76 | −8.41 | 0.99 | 1.09 | 1.08 | 1.05 | 0.05 | 5.05 | 5.10 | |
0.1 | 0.10 | 0.09 | 0.09 | 0.10 | 0.01 | 5.46 | −4.19 | 0.11 | 0.10 | 0.10 | 0.11 | 0.01 | 7.45 | 5.19 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Li, J.; Zhao, S.; Yan, X.; Si, N.; Gao, H.; Li, Y.; Zhai, S.; Xiao, F.; Wu, G.; et al. An Editing-Site-Specific PCR Method for Detection and Quantification of CAO1-Edited Rice. Foods 2021, 10, 1209. https://doi.org/10.3390/foods10061209
Zhang H, Li J, Zhao S, Yan X, Si N, Gao H, Li Y, Zhai S, Xiao F, Wu G, et al. An Editing-Site-Specific PCR Method for Detection and Quantification of CAO1-Edited Rice. Foods. 2021; 10(6):1209. https://doi.org/10.3390/foods10061209
Chicago/Turabian StyleZhang, Hongwen, Jun Li, Shengbo Zhao, Xiaohong Yan, Nengwu Si, Hongfei Gao, Yunjing Li, Shanshan Zhai, Fang Xiao, Gang Wu, and et al. 2021. "An Editing-Site-Specific PCR Method for Detection and Quantification of CAO1-Edited Rice" Foods 10, no. 6: 1209. https://doi.org/10.3390/foods10061209