The Potential Role of Probiotics in Protection against Influenza a Virus Infection in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Animals and Treatment
2.3. Change in Weight
2.4. Lung Histopathology
2.5. Virus Loading, MxA, and Immune Indicators Measurement
2.6. Blood Cell Analysis
2.7. Gut Microbial Profiling
2.8. Change in SCFA Metabolism
2.9. Statistical Analysis
3. Results
3.1. Probiotic Mixture Suppressed the Loss of Body Weight
3.2. Probiotic Mixture Improved the Pathological Features of Lung
3.3. Probiotic Strains Regulated Systemic Immune Responses
3.4. Probiotic Strains Affected the Antiviral Signaling Pathway
3.5. Probiotic Strains Altered the Gut Microbial Composition
3.5.1. Changes in the Phylum Level
3.5.2. Clustering Analysis at the Genus Level
3.6. Probiotic Strains Affected SCFA Production and the Correlation with Disease Indicators
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lee, S.; Ishitsuka, A.; Noguchi, M.; Hirohama, M.; Fujiyasu, Y.; Petric, P.P.; Schwemmle, M.; Staeheli, P.; Nagata, K.; Kawaguchi, A. Influenza restriction factor MxA functions as inflammasome sensor in the respiratory epithelium. Sci. Immunol. 2019, 4, eaau4643. [Google Scholar] [CrossRef]
- Moser, M.R.; Bender, T.R.; Margolis, H.S.; Noble, G.R.; Kendal, A.P.; Ritter, D.G. An outbreak of influenza aboard a commercial airliner. Am. J. Epidemiol. 1979, 110, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Weis, W.; Brown, J.H.; Cusack, S.; Paulson, J.C.; Skehel, J.J.; Wiley, D.C. Structure of the influenza virus haemagglutinin complexed with its receptor, sialic acid. Nature 1988, 333, 426–431. [Google Scholar] [CrossRef]
- Dang, A.T.; Marsland, B.J. Microbes, metabolites, and the gut-lung axis. Mucosal Immunol. 2019, 12, 843–850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, Y.; Wen, Q.; Yao, F.; Xu, D.; Huang, Y.; Wang, J. Gut-lung axis: The microbial contributions and clinical implications. Crit. Rev. Microbiol. 2017, 43, 81–95. [Google Scholar] [CrossRef] [PubMed]
- Reid, G.; Abrahamsson, T.; Bailey, M.; Bindels, L.B.; Bubnov, R.; Ganguli, K.; Martoni, C.; O’Neill, C.; Savignac, H.M.; Stanton, C.; et al. How do probiotics and prebiotics function at distant sites? Benef. Microbes 2017, 8, 521–533. [Google Scholar] [CrossRef]
- Shahbazi, R.; Yasavoli-Sharahi, H.; Alsadi, N.; Ismail, N.; Matar, C. Probiotics in treatment of viral respiratory infections and neuroinflammatory disorders. Molecules 2020, 25, 4891. [Google Scholar] [CrossRef] [PubMed]
- Prakash, A.; Sundar, S.V.; Zhu, Y.G.; Tran, A.; Lee, J.W.; Lowell, C.; Hellman, J. Lung ischemia-reperfusion is a sterile inflammatory process influenced by commensal microbiota in mice. Shock 2015, 44, 272–279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsay, T.B.; Yang, M.C.; Chen, P.H.; Hsu, C.M.; Chen, L.W. Gut flora enhance bacterial clearance in lung through toll-like receptors 4. J. Biomed. Sci. 2011, 18, 68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gu, S.; Chen, Y.; Wu, Z.; Chen, Y.; Gao, H.; Lv, L.; Guo, F.; Zhang, X.; Luo, R.; Huang, C.; et al. Alterations of the gut microbiota in patients with COVID-19 or H1N1 influenza. Clin. Infect. Dis. 2020, 71, 2669–2678. [Google Scholar] [CrossRef] [PubMed]
- Fan, Z.; Yang, B.; Ross, R.P.; Stanton, C.; Zhao, J.; Zhang, H.; Chen, W. The prophylactic effects of different Lactobacilli on collagen-induced arthritis in rats. Food Funct. 2020, 11, 3681–3694. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, K.; Yamada, T.; Ogura, H.; Mohri, T.; Kiguchi, T.; Fujimi, S.; Asahara, T.; Yamada, T.; Ojima, M.; Ikeda, M.; et al. Synbiotics modulate gut microbiota and reduce enteritis and ventilator-associated pneumonia in patients with sepsis: A randomized controlled trial. Crit. Care 2018, 22, 239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blumberg, R.; Powrie, F. Microbiota, disease, and back to health: A metastable journey. Sci. Transl. Med. 2012, 4, 137rv137. [Google Scholar] [CrossRef] [Green Version]
- Smith, P.M.; Howitt, M.R.; Panikov, N.; Michaud, M.; Gallini, C.A.; Bohlooly, Y.M.; Glickman, J.N.; Garrett, W.S. The microbial metabolites, short-chain fatty acids, regulate colonic Treg cell homeostasis. Science 2013, 341, 569–573. [Google Scholar] [CrossRef] [Green Version]
- Tan, J.; McKenzie, C.; Potamitis, M.; Thorburn, A.N.; Mackay, C.R.; Macia, L. Chapter Three—The Role of Short-Chain Fatty Acids in Health and Disease. In Advances in Immunology; Alt, F.W., Ed.; Academic Press: Cambridge, MA, USA, 2014; Volume 121, pp. 91–119. [Google Scholar]
- Groeger, D.; Schiavi, E.; Grant, R.; Kurnik-Łucka, M.; Michalovich, D.; Williamson, R.; Beinke, S.; Kiely, B.; Akdis, C.A.; Hessel, E.M.; et al. Intranasal Bifidobacterium longum protects against viral-induced lung inflammation and injury in a murine model of lethal influenza infection. EBioMedicine 2020, 60, 102981. [Google Scholar] [CrossRef]
- Maeda, N.; Nakamura, R.; Hirose, Y.; Murosaki, S.; Yamamoto, Y.; Kase, T.; Yoshikai, Y. Oral administration of heat-killed Lactobacillus plantarum L-137 enhances protection against influenza virus infection by stimulation of type I interferon production in mice. Int. Immunopharmacol. 2009, 9, 1122–1125. [Google Scholar] [CrossRef]
- Iwabuchi, N.; Xiao, J.Z.; Yaeshima, T.; Iwatsuki, K. Oral administration of Bifidobacterium longum ameliorates influenza virus infection in mice. Biol. Pharm. Bull. 2011, 34, 1352–1355. [Google Scholar] [CrossRef] [Green Version]
- Mao, B.; Li, D.; Ai, C.; Zhao, J.; Zhang, H.; Chen, W. Lactulose differently modulates the composition of luminal and mucosal microbiota in C57BL/6J mice. J. Agric. Food Chem. 2016, 64, 6240. [Google Scholar] [CrossRef] [PubMed]
- Spacova, I.; Petrova, M.I.; Fremau, A.; Pollaris, L.; Vanoirbeek, J.; Ceuppens, J.L.; Seys, S.; Lebeer, S. Intranasal administration of probiotic Lactobacillus rhamnosus GG prevents birch pollen-induced allergic asthma in a murine model. Allergy 2019, 74, 100–110. [Google Scholar] [CrossRef]
- Jamalkandi, S.A.; Ahmadi, A.; Ahrari, I.; Salimian, J.; Karimi, M.; Ghanei, M. Oral and nasal probiotic administration for the prevention and alleviation of allergic diseases, asthma and chronic obstructive pulmonary disease. Nutr. Res. Rev. 2020, 1–16. [Google Scholar] [CrossRef]
- Navarro-López, V.; Ramírez-Boscá, A.; Ramón-Vidal, D.; Ruzafa-Costas, B.; Genovés-Martínez, S.; Chenoll-Cuadros, E.; Carrión-Gutiérrez, M.; Horga de la Parte, J.; Prieto-Merino, D.; Codoñer-Cortés, F.M. Effect of Oral administration of a mixture of probiotic strains on SCORAD index and use of topical steroids in young patients with moderate atopic dermatitis: A randomized clinical trial. JAMA Dermatol. 2018, 154, 37–43. [Google Scholar] [CrossRef]
- Roudsari, M.R.; Karimi, R.; Sohrabvandi, S.; Mortazavian, A.M. Health effects of probiotics on the skin. Crit. Rev. Food Sci. Nutr. 2015, 55, 1219–1240. [Google Scholar] [CrossRef]
- Lei, W.T.; Shih, P.C.; Liu, S.J.; Lin, C.Y.; Yeh, T.L. Effect of probiotics and prebiotics on immune response to influenza vaccination in adults: A systematic review and meta-analysis of randomized controlled trials. Nutrients 2017, 9, 1175. [Google Scholar] [CrossRef]
- Fonollá, J.; Gracián, C.; Maldonado-Lobón, J.A.; Romero, C.; Bédmar, A.; Carrillo, J.C.; Martín-Castro, C.; Cabrera, A.L.; García-Curiel, J.M.; Rodríguez, C.; et al. Effects of Lactobacillus coryniformis K8 CECT5711 on the immune response to influenza vaccination and the assessment of common respiratory symptoms in elderly subjects: A randomized controlled trial. Eur. J. Nutr. 2019, 58, 83–90. [Google Scholar] [CrossRef] [Green Version]
- Anand, S.; Mande, S.S. Diet, microbiota and gut-Lung connection. Front. Microbiol. 2018, 9, 2147. [Google Scholar] [CrossRef]
- To, E.E.; Erlich, J.; Liong, F.; Luong, R.; Liong, S.; Bozinovski, S.; Seow, H.J.; O’Leary, J.J.; Brooks, D.A.; Vlahos, R.; et al. Intranasal and epicutaneous administration of Toll-like receptor 7 (TLR7) agonists provides protection against influenza A virus-induced morbidity in mice. Sci. Rep. 2019, 9, 2366. [Google Scholar] [CrossRef] [Green Version]
- De Vrese, M.; Winkler, P.; Rautenberg, P.; Harder, T.; Noah, C.; Laue, C.; Ott, S.; Hampe, J.; Schreiber, S.; Heller, K.; et al. Effect of Lactobacillus gasseri PA 16/8, Bifidobacterium longum SP 07/3, B. bifidum MF 20/5 on common cold episodes: A double blind, randomized, controlled trial. Clin. Nutr. 2005, 24, 481–491. [Google Scholar] [CrossRef] [PubMed]
- de Vrese, M.; Winkler, P.; Rautenberg, P.; Harder, T.; Noah, C.; Laue, C.; Ott, S.; Hampe, J.; Schreiber, S.; Heller, K.; et al. Probiotic bacteria reduced duration and severity but not the incidence of common cold episodes in a double blind, randomized, controlled trial. Vaccine 2006, 24, 6670–6674. [Google Scholar] [CrossRef]
- Cronkite, D.A.; Strutt, T.M. The regulation of inflammation by innate and adaptive lymphocytes. J. Immunol. Res. 2018, 1467538. [Google Scholar] [CrossRef] [PubMed]
- Heath, W.R.; Carbone, F.R. The skin-resident and migratory immune system in steady state and memory: Innate lymphocytes, dendritic cells and T cells. Nat. Immunol. 2013, 14, 978–985. [Google Scholar] [CrossRef]
- Mantovani, A.; Cassatella, M.A.; Costantini, C.; Jaillon, S. Neutrophils in the activation and regulation of innate and adaptive immunity. Nat. Rev. Immunol. 2011, 11, 519–531. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 2011, 34, 637–650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goff, P.H.; Hayashi, T.; Martínez-Gil, L.; Corr, M.; Crain, B.; Yao, S.; Cottam, H.B.; Chan, M.; Ramos, I.; Eggink, D.; et al. Synthetic Toll-like receptor 4 (TLR4) and TLR7 ligands as influenza virus vaccine adjuvants induce rapid, sustained, and broadly protective responses. J. Virol. 2015, 89, 3221–3235. [Google Scholar] [CrossRef] [Green Version]
- Iwasaki, A.; Pillai, P.S. Innate immunity to influenza virus infection. Nat. Rev. Immunol. 2014, 14, 315–328. [Google Scholar] [CrossRef]
- Wu, S.; Jiang, Z.Y.; Sun, Y.F.; Yu, B.; Chen, J.; Dai, C.Q.; Wu, X.L.; Tang, X.L.; Chen, X.Y. Microbiota regulates the TLR7 signaling pathway against respiratory tract influenza A virus infection. Curr. Microbiol. 2013, 67, 414–422. [Google Scholar] [CrossRef]
- Pant, K.; Chandrasekaran, A.; Chang, C.J.; Vageesh, A.; Popkov, A.J.; Weinberg, J.B. Effects of tumor necrosis factor on viral replication and pulmonary inflammation during acute mouse adenovirus type 1 respiratory infection. Virology 2020, 547, 12–19. [Google Scholar] [CrossRef] [PubMed]
- Seo, S.H.; Webster, R.G. Tumor necrosis factor alpha exerts powerful anti-influenza virus effects in lung epithelial cells. J. Virol. 2002, 76, 1071–1076. [Google Scholar] [CrossRef] [Green Version]
- Biermer, M.; Puro, R.; Schneider, R.J. Tumor necrosis factor alpha inhibition of hepatitis B virus replication involves disruption of capsid Integrity through activation of NF-kappaB. J. Virol. 2003, 77, 4033–4042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Budden, K.F.; Gellatly, S.L.; Wood, D.L.; Cooper, M.A.; Morrison, M.; Hugenholtz, P.; Hansbro, P.M. Emerging pathogenic links between microbiota and the gut-lung axis. Nat. Rev. Microbiol. 2017, 15, 55–63. [Google Scholar] [CrossRef]
- Schirmer, M.; Garner, A.; Vlamakis, H.; Xavier, R.J. Microbial genes and pathways in inflammatory bowel disease. Nat. Rev. Microbiol. 2019, 17, 497–511. [Google Scholar] [CrossRef]
- Kolodziejczyk, A.A.; Zheng, D.; Shibolet, O.; Elinav, E. The role of the microbiome in NAFLD and NASH. EMBO Mol. Med. 2019, 11, e9302. [Google Scholar] [CrossRef] [PubMed]
- Yildiz, S.; Mazel-Sanchez, B.; Kandasamy, M.; Manicassamy, B.; Schmolke, M. Influenza A virus infection impacts systemic microbiota dynamics and causes quantitative enteric dysbiosis. Microbiome 2018, 6, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herp, S.; Brugiroux, S.; Garzetti, D.; Ring, D.; Jochum, L.M.; Beutler, M.; Eberl, C.; Hussain, S.; Walter, S.; Gerlach, R.G.; et al. Mucispirillum schaedleri antagonizes Salmonella virulence to protect mice against colitis. Cell Host Microbe 2019, 25, 681–694. [Google Scholar] [CrossRef] [PubMed]
- Tan, J.; McKenzie, C.; Potamitis, M.; Thorburn, A.N.; Mackay, C.R.; Macia, L. The role of short-chain fatty acids in health and disease. Adv. Immunol. 2014, 121, 91–119. [Google Scholar] [CrossRef]
- Sencio, V.; Barthelemy, A.; Tavares, L.P.; Machado, M.G.; Soulard, D.; Cuinat, C.; Queiroz-Junior, C.M.; Noordine, M.L.; Salomé-Desnoulez, S.; Deryuter, L.; et al. Gut dysbiosis during influenza contributes to pulmonary pneumococcal superinfection through altered short-chain fatty acid production. Cell Rep. 2020, 30, 934–2947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primers | Forward/Reverse | Sequence (5′ to 3′) |
---|---|---|
GAPDH | Forward | AGAGTGGGAGTTGCTGTTG |
Reverse | GCCTTCCGTGTTCCTACC | |
NP | Forward | GGCACCAAACGGTCTTACGA |
Reverse | TCACCTGATCAACTCCATTACCA | |
MxA | Forward | CCAACTGGAATCCTCCTGGAA |
Reverse | GCCGCACCTTCTCCTCATAG | |
TLR7 | Forward | GATCGTGGACTGCACAGACA |
Reverse | CAGATGGTTCAGCCTACGGA | |
MyD88 | Forward | ACTTGTTAGACCGTGAGGAT |
Reverse | CTCGGACTCCTGGTTCTG | |
TRAF6 | Forward | TCTGCTTGATGGCTTTACG |
Reverse | ACCGTCAGGGAAAGAATCT | |
TNF-α | Forward | GGGCTACAGGCTTGTCACTCG |
Reverse | ACTCCAGGCGGTGCCTATGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, W.; Fang, Z.; Liu, X.; Li, L.; Zhang, P.; Zhao, J.; Zhang, H.; Chen, W. The Potential Role of Probiotics in Protection against Influenza a Virus Infection in Mice. Foods 2021, 10, 902. https://doi.org/10.3390/foods10040902
Lu W, Fang Z, Liu X, Li L, Zhang P, Zhao J, Zhang H, Chen W. The Potential Role of Probiotics in Protection against Influenza a Virus Infection in Mice. Foods. 2021; 10(4):902. https://doi.org/10.3390/foods10040902
Chicago/Turabian StyleLu, Wenwei, Zhifeng Fang, Xinyang Liu, Lingzhi Li, Pinghu Zhang, Jianxin Zhao, Hao Zhang, and Wei Chen. 2021. "The Potential Role of Probiotics in Protection against Influenza a Virus Infection in Mice" Foods 10, no. 4: 902. https://doi.org/10.3390/foods10040902
APA StyleLu, W., Fang, Z., Liu, X., Li, L., Zhang, P., Zhao, J., Zhang, H., & Chen, W. (2021). The Potential Role of Probiotics in Protection against Influenza a Virus Infection in Mice. Foods, 10(4), 902. https://doi.org/10.3390/foods10040902