Computational and In Vitro Assessment of a Natural Triterpenoid Compound Gedunin against Breast Cancer via Caspase 3 and Janus Kinase/STAT Modulation
Abstract
1. Introduction
2. Results
2.1. Molecular Docking Results
2.2. Gedunin Impeded the Growth of MCF-7 and MDA-MB-231 Cells
2.3. Gedunin-Induced Nuclear Condensation and Fragmentation
2.4. Gedunin Treatment Elevated Caspase-3 Activity
2.5. Caspase-3 Inhibitor Alleviated Gedunin-Mediated Cytotoxicity
2.6. Gedunin-Instigated Intracellular ROS
2.7. NAC Pretreatment Abrogated Gedunin-Instigated Intracellular ROS
2.8. Gedunin Reduced JAK1/STAT3 Expression
2.9. Gedunin Regulated the Gene Expression of JAK1/STAT3-Associated Genes
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture Maintenance
4.3. Methods
4.3.1. In Silico Investigations
Retrieval of 3D Protein Structure
Retrieval of 3D Structure Ligands
Docking Complex Visualization
4.3.2. In Vitro Assessments
Cytotoxic Effects of Gedunin against Breast Cancer
Assessment of Nuclear Morphology
Evaluation of Gedunin-Induced ROS Production
Effects of ROS Inhibitor
Assessment of Caspase-3 Activation
Effects of Caspase-3 Inhibitor
Quantitative Real-Time PCR (qRT-PCR)
4.4. Statistical Inferences
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Global Cancer Observatory Factsheet on Cancers. Last Updated: December 2020. Available online: https://gco.iarc.fr/today/data/factsheets/cancers/20-Breast-fact-sheet.pdf (accessed on 8 August 2022).
- Waks, A.G.; Winer, E.P. Breast Cancer Treatment: A Review. JAMA 2019, 321, 288–300. [Google Scholar] [CrossRef] [PubMed]
- Pistilli, B.; Lohrisch, C.; Sheade, J.; Fleming, G.F. Personalizing Adjuvant Endocrine Therapy for Early-Stage Hormone Receptor-Positive Breast Cancer. Am. Soc. Clin. Oncol. Educ. Book 2022, 42, 60–72. [Google Scholar] [CrossRef] [PubMed]
- Shyam, M.M.; Moin, A.; Medishetti, R.; Rajendra, K.M.; Raichur, A.; Prashantha, K.B.R. Dual drug conjugate loaded nanoparticles for the treatment of cancer. Curr. Drug Deliv. 2015, 12, 782–794. [Google Scholar] [CrossRef]
- Baudino, T.A. Targeted Cancer Therapy: The Next Generation of Cancer Treatment. Curr. Drug Discov. Technol. 2015, 12, 3–20. [Google Scholar] [CrossRef]
- Ibraheem, A.; Stankowski-Drengler, T.J.; Gbolahan, O.B.; Engel, J.M.; Onitilo, A.A. Chemotherapy-induced cardiotoxicity in breast cancer patients. Breast Cancer Manag. 2016, 5, 31–41. [Google Scholar] [CrossRef]
- Kooti, W.; Servatyari, K.; Behzadifar, M.; Asadi-Samani, M.; Sadeghi, F.; Nouri, B.; Zare Marzouni, H. Effective Medicinal Plant in Cancer Treatment, Part 2: Review Study. J. Evid. Based Complement. Altern. Med. 2017, 22, 982–995. [Google Scholar] [CrossRef][Green Version]
- Jeon, H.J.; Kim, K.; Kim, C.; Kim, M.J.; Kim, T.O.; Lee, S.E. Molecular mechanisms of anti-melanogenic gedunin derived from neem tree (Azadirachta indica) using B16F10 mouse melanoma cells and early-stage zebrafish. Plants 2021, 10, 330. [Google Scholar] [CrossRef]
- Braga, T.M.; Rocha, L.; Chung, T.Y.; Oliveira, R.F.; Pinho, C.; Oliveira, A.I.; Morgado, J.; Cruz, A. Biological Activities of Gedunin-A Limonoid from the Meliaceae Family. Molecules 2020, 25, 493. [Google Scholar] [CrossRef][Green Version]
- Kapinova, A.; Kubatka, P.; Golubnitschaja, O.; Kello, M.; Zubor, P.; Solar, P.; Pec, M. Dietary phytochemicals in breast cancer research: Anticancer effects and potential utility for effective chemoprevention. Environ. Health Prev. Med. 2018, 23, 36. [Google Scholar] [CrossRef]
- Moin, A.; Wani, S.U.D.; Osmani, R.A.; Abu Lila, A.S.; Khafagy, E.S.; Arab, H.H.; Gangadharappa, H.V.; Allam, A.N. Formulation, characterization, and cellular toxicity assessment of tamoxifen-loaded silk fibroin nanoparticles in breast cancer. Drug Deliv. 2021, 28, 1626–1636. [Google Scholar] [CrossRef]
- Wylie, M.R.; Merrell, D.S. The Antimicrobial Potential of the Neem Tree Azadirachta indica. Front. Pharmacol. 2022, 13, 1535. [Google Scholar] [CrossRef] [PubMed]
- Aarthy, T.; Mulani, F.A.; Pandreka, A.; Kumar, A.; Nandikol, S.S.; Haldar, S.; Thulasiram, H.V. Tracing the biosynthetic origin of limonoids and their functional groups through stable isotope labeling and inhibition in neem tree (Azadirachta indica) cell suspension. BMC Plant Biol. 2018, 18, 230. [Google Scholar] [CrossRef] [PubMed]
- Gupta, A.; Ansari, S.; Gupta, S.; Narwani, M.; Gupta, M.; Singh, M. Therapeutics role of neem and its bioactive constituents in disease prevention and treatment. J. Pharmacogn. Phytochem. 2019, 8, 680–691. [Google Scholar]
- Tan, Q.G.; Luo, X.D. Meliaceous limonoids: Chemistry and biological activities. Chem. Rev. 2011, 111, 7437–7522. [Google Scholar] [CrossRef]
- Patwardhan, C.A.; Fauq, A.; Peterson, L.B.; Miller, C.; Blagg, B.S.; Chadli, A. Gedunin inactivates the co-chaperone p23 protein causing cancer cell death by apoptosis. J. Biol. Chem. 2013, 288, 7313–7325. [Google Scholar] [CrossRef][Green Version]
- Wehde, B.L.; Rädler, P.D.; Shrestha, H.; Johnson, S.J.; Triplett, A.A.; Wagner, K.U. Janus Kinase 1 Plays a Critical Role in Mammary Cancer Progression. Cell Rep. 2018, 25, 2192–2207.e5. [Google Scholar] [CrossRef][Green Version]
- Ma, J.H.; Qin, L.; Li, X. Role of STAT3 signaling pathway in breast cancer. Cell Commun. Signal. 2020, 18, 33. [Google Scholar] [CrossRef][Green Version]
- Aggarwal, V.; Tuli, H.S.; Varol, A.; Thakral, F.; Yerer, M.B.; Sak, K.; Varol, M.; Jain, A.; Khan, M.A.; Sethi, G. Role of Reactive Oxygen Species in Cancer Progression: Molecular Mechanisms and Recent Advancements. Biomolecules 2019, 9, 735. [Google Scholar] [CrossRef][Green Version]
- Bao, L.; Zhang, H.; Chan, L.S. The involvement of the JAK-STAT signaling pathway in chronic inflammatory skin disease atopic dermatitis. JAK-STAT 2013, 2, e24137. [Google Scholar] [CrossRef][Green Version]
- Yu, H.; Lee, H.; Herrmann, A.; Buettner, R.; Jove, R. Revisiting STAT3 signalling in cancer: New and unexpected biological functions. Nature reviews. Cancer 2014, 14, 736–746. [Google Scholar] [CrossRef]
- Ioannidou, E.; Moschetta, M.; Shah, S.; Parker, J.S.; Ozturk, M.A.; Pappas-Gogos, G.; Sheriff, M.; Rassy, E.; Boussios, S. Angiogenesis and Anti-Angiogenic Treatment in Prostate Cancer: Mechanisms of Action and Molecular Targets. Int. J. Mol. Sci. 2021, 22, 9926. [Google Scholar] [CrossRef] [PubMed]
- Thomas, S.J.; Snowden, J.A.; Zeidler, M.P.; Danson, S.J. The role of JAK/STAT signalling in the pathogenesis, prognosis and treatment of solid tumours. Br. J. Cancer 2015, 113, 365–371. [Google Scholar] [CrossRef][Green Version]
- Verma, N.K.; Davies, A.M.; Long, A.; Kelleher, D.; Volkov, Y. STAT3 knockdown by siRNA induces apoptosis in human cutaneous T-cell lymphoma line Hut78 via downregulation of Bcl-xL. Cell Mol. Biol. Lett. 2010, 15, 342–355. [Google Scholar] [CrossRef] [PubMed]
- Brooks, A.J.; Putoczki, T. JAK-STAT Signalling Pathway in Cancer. Cancers 2020, 12, 1971. [Google Scholar] [CrossRef] [PubMed]
- Hussain, T.; Bajpai, S.; Saeed, M.; Moin, A.; Alafnan, A.; Khan, M.; Kamal, M.A.; Ganash, M.; Ashraf, G.M. Potentiating effect of ethnomedicinal plants against proliferation on different cancer cell lines. Curr. Drug Metab. 2018, 19, 584–795. [Google Scholar] [CrossRef]
- Teiten, M.H.; Gaascht, F.; Dicato, M.; Diederich, M. Anticancer bioactivity of compounds from medicinal plants used in European medieval traditions. Biochem. Pharm. 2013, 86, 1239–1247. [Google Scholar] [CrossRef]
- Razak, N.A.; Abu, N.; Ho, W.Y.; Zamberi, N.R.; Tan, S.W.; Alitheen, N.B.; Long, K.; Yeap, S.K. Cytotoxicity of eupatorin in MCF-7 and MDA-MB-231 human breast cancer cells via cell cycle arrest, anti-angiogenesis and induction of apoptosis. Sci. Rep. 2019, 9, 1514. [Google Scholar] [CrossRef]
- Brentnall, M.; Rodriguez-Menocal, L.; De Guevara, R.L.; Cepero, E.; Boise, L.H. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 2013, 14, 32. [Google Scholar] [CrossRef][Green Version]
- Rah, B.; Rather, R.A.; Bhat, G.R.; Baba, A.B.; Mushtaq, I.; Farooq, M.; Yousuf, T.; Dar, S.B.; Parveen, S.; Hassan, R.; et al. JAK/STAT Signaling: Molecular Targets, Therapeutic Opportunities, and Limitations of Targeted Inhibitions in Solid Malignancies. Front. Pharmacol. 2022, 13, 821344. [Google Scholar] [CrossRef]
- Lall, R.K.; Syed, D.N.; Adhami, V.M.; Khan, M.I.; Mukhtar, H. Dietary polyphenols in prevention and treatment of prostate cancer. Int. J. Mol. Sci. 2015, 16, 3350–3376. [Google Scholar] [CrossRef]
- Bolomsky, A.; Vogler, M.; Köse, M.C.; Heckman, C.A.; Ehx, G.; Ludwig, H.; Caers, J. MCL-1 inhibitors, fast-lane development of a new class of anti-cancer agents. J. Hematol. Oncol. 2020, 13, 173. [Google Scholar] [CrossRef] [PubMed]
- Rana, M.S.; Ediriweera, M.K.; Rajagopalan, U.; Karunaratne, D.N.; Tennekoon, K.H.; Samarakoon, S.R. A new liposomal nanocarrier for co-delivery of gedunin and p-glycoprotein siRNA to target breast cancer stem cells. Nat. Prod. Res. 2022, 36, 6389–6392. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.K.; Ansari, I.A.; Khan, M.S.; Arif, J.M. Dietary phytochemicals as potent chemotherapeutic agents against breast cancer: Inhibition of NF-κB pathway via molecular interactions in rel homology domain of its precursor protein p105. Pharmacogn. Mag. 2013, 9, 51–57. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef][Green Version]
- Zev, S.; Raz, K.; Schwartz, R.; Tarabeh, R.; Gupta, P.K.; Major, D.T. Benchmarking the Ability of Common Docking Programs to Correctly Reproduce and Score Binding Modes in SARS-CoV-2 Protease Mpro. J. Chem. Inf. Model. 2021, 61, 2957–2966. [Google Scholar] [CrossRef]
- Lill, M.A.; Danielson, M.L. Computer-aided drug design platform using PyMOL. J. Comput. Aided Mol. Des. 2011, 25, 13–19. [Google Scholar] [CrossRef]
- Alafnan, A.; Alamri, A.; Alanazi, J.; Hussain, T. Farnesiferol C Exerts Antiproliferative Effects on Hepatocellular Carcinoma HepG2 Cells by Instigating ROS-Dependent Apoptotic Pathway. Pharmaceuticals 2022, 15, 1070. [Google Scholar] [CrossRef]
- Husain, I.; Bala, K.; Wani, A.; Makhdoomi, U.; Malik, F.; Sharma, A. Arginase purified from endophytic Pseudomonas aeruginosa IH2: Induce apoptosis through both cell cycle arrest and MMP loss in human leukemic HL-60 cells. Chem.-Biol. Interact. 2017, 274, 35–49. [Google Scholar] [CrossRef]
- Husain, I.; Sharma, A.; Kumar, S.; Malik, F. Purification and Characterization of Glutaminase Free Asparaginase from Enterobacter cloacae: In-Vitro Evaluation of Cytotoxic Potential against Human Myeloid Leukemia HL-60 Cells. PLoS ONE 2016, 11, e0148877. [Google Scholar] [CrossRef][Green Version]
- Ahmad, A.; Tiwari, R.K.; Almeleebia, T.M.; Al Fayi, M.S.; Alshahrani, M.Y.; Ahmad, I.; Abohassan, M.S.; Saeed, M.; Ansari, I.A. Swertia chirayita suppresses the growth of non-small cell lung cancer A549 cells and concomitantly induces apoptosis via downregulation of JAK1/STAT3 pathway. Saudi J. Biol. Sci. 2021, 28, 6279–6288. [Google Scholar] [CrossRef]
- Ahmad, A.; Ansari, I.A. Carvacrol Exhibits Chemopreventive Potential against Cervical Cancer Cells via Caspase-Dependent Apoptosis and Abrogation of Cell Cycle Progression. Anti-Cancer Agents Med. Chem. 2021, 21, 2224–2235. [Google Scholar] [CrossRef] [PubMed]
Compound | Binding Energy (Kcal/mol) | Hydrogen Bonds (Bond Length in Å) | Hydrophobic Interactions |
---|---|---|---|
JAK1–gedunin | −7.1 | Gln1098 engage in hydrogen bonding (bond lengths 3.20 and 2.81) | Gly1097, Thr1100, Leu1089, Phe1046, Met1085, Pro1044, Ser1043, and Val1045 |
JAK1–gemcitabine | −6.6 | Gln1098 (B), Asp1042 (A), His885 (A), Ser1043 (A), and Val1045 (A) engage in hydrogen bonding (bond lengths 2.93, 3.05, 2.80, 3.01, and 3.30). | Phe1046 (A), Arg1041 (A), and Phe1044 (A) |
STAT3–gedunin | −6.2 | Arg152 (A) and Asn265 (A) engage in hydrogen bond interactions (bond lengths 3.31, 2.93, and 2.59). | Thr268 (A), Glu272 (A), Pro356 (B), Pro356 (A), Gln357 (B), Gln357 (A), and Lys354 (A). |
STAT3–gemcitabine | −5.0 | Glu357 (B), and Gln448 (B) engage in hydrogen bond interactions (bond lengths 2.98, 3.01, and 3.25). | Tyr446 (A), Gln361 (A), Leu358 (B), Gln361 (B), His447 (B), and Tyr446 (B). |
Genes | Forward Primer | Reverse Primer | NCBI Gene Number |
---|---|---|---|
GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA | 2597 |
Bcl2 | ATCGCCCTGTGGATGACTGAGT | GCCAGGAGAAATCAAACAGAGGC | 596 |
BclXL | GCCACTTACCTGAATGACCACC | AACCAGCGGTTGAAGCGTTCCT | 598 |
Bax | TCAGGATGCGTCCACCAAGAAG | TGTGTCCACGGCGGCAATCATC | 581 |
Cyclin D1 | TGAACTACCTGGACCGCT | GCCTCTGGCATTTTGGAG | 595 |
c-myc | AGCGACTCTGAGGAGGAACAAG | GTGGCACCTCTTGAGGACCA | 26,292 |
p21Cip1 | AGGTGGACCTGGAGACTCTCAG | TCCTCTTGGAGAAGATCAGCCG | 5058 |
p53 | CCTCAGCATCTTATCCGAGTGG | TGGATGGTGGTACAGTCAGAGC | 7157 |
JAK1 | GAGACAGGTCTCCCACAAACAC | GTGGTAAGGACATCGCTTTTCCG | 3716 |
STAT3 | CTTTGAGACCGAGGTGTATCACC | GGTCAGCATGTTGTACCACAGG | 6774 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hussain, T.; Alanazi, M.; Alanazi, J.; Alharby, T.N.; Unnisa, A.; Awadelkareem, A.M.; Elkhalifa, A.O.; Algahtani, M.M.; Shahid, S.; Rizvi, S.M.D. Computational and In Vitro Assessment of a Natural Triterpenoid Compound Gedunin against Breast Cancer via Caspase 3 and Janus Kinase/STAT Modulation. Processes 2023, 11, 1452. https://doi.org/10.3390/pr11051452
Hussain T, Alanazi M, Alanazi J, Alharby TN, Unnisa A, Awadelkareem AM, Elkhalifa AO, Algahtani MM, Shahid S, Rizvi SMD. Computational and In Vitro Assessment of a Natural Triterpenoid Compound Gedunin against Breast Cancer via Caspase 3 and Janus Kinase/STAT Modulation. Processes. 2023; 11(5):1452. https://doi.org/10.3390/pr11051452
Chicago/Turabian StyleHussain, Talib, Muteb Alanazi, Jowaher Alanazi, Tareq Nafea Alharby, Aziz Unnisa, Amir Mahgoub Awadelkareem, AbdElmoneim O. Elkhalifa, Mohammad M. Algahtani, SMA Shahid, and Syed Mohd Danish Rizvi. 2023. "Computational and In Vitro Assessment of a Natural Triterpenoid Compound Gedunin against Breast Cancer via Caspase 3 and Janus Kinase/STAT Modulation" Processes 11, no. 5: 1452. https://doi.org/10.3390/pr11051452
APA StyleHussain, T., Alanazi, M., Alanazi, J., Alharby, T. N., Unnisa, A., Awadelkareem, A. M., Elkhalifa, A. O., Algahtani, M. M., Shahid, S., & Rizvi, S. M. D. (2023). Computational and In Vitro Assessment of a Natural Triterpenoid Compound Gedunin against Breast Cancer via Caspase 3 and Janus Kinase/STAT Modulation. Processes, 11(5), 1452. https://doi.org/10.3390/pr11051452