Next Article in Journal
Prospect of Mesenchymal Stem-Cell-Conditioned Medium in the Treatment of Acute Pancreatitis: A Systematic Review
Next Article in Special Issue
Targeting FGFR Pathways in Gastrointestinal Cancers: New Frontiers of Treatment
Previous Article in Journal
Plumbagin: A Promising In Vivo Antiparasitic Candidate against Schistosoma mansoni and In Silico Pharmacokinetic Properties (ADMET)
Previous Article in Special Issue
CT-Based Radiomics to Predict KRAS Mutation in CRC Patients Using a Machine Learning Algorithm: A Retrospective Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study

1
Laboratory of Human Genetics, Genetic Resources Institute of Ministry of Science and Education, Baku AZ1106, Azerbaijan
2
Department of Surgery, Azerbaijan Medical University, Baku AZ1022, Azerbaijan
3
Department of Surgery, Scientific Center of Surgery, Baku AZ1122, Azerbaijan
4
Laboratory of Molecular and Cellular Biochemistry, Institute of Biophysics of Ministry of Science and Education, Baku AZ1141, Azerbaijan
5
Bioinformatics Lab, Institute of Molecular Biology and Biotechnologies of Ministry of Science and Education, Baku AZ1141, Azerbaijan
6
Integrative Biology Lab, Institute of Biophysics of Ministry of Science and Education, Baku AZ1141, Azerbaijan
7
Department of Surgery, Universitätsmedizin Mannheim, Medical Faculty Mannheim, Heidelberg University, 68167 Mannheim, Germany
*
Author to whom correspondence should be addressed.
Biomedicines 2023, 11(9), 2341; https://doi.org/10.3390/biomedicines11092341
Submission received: 13 June 2023 / Revised: 15 August 2023 / Accepted: 17 August 2023 / Published: 23 August 2023
(This article belongs to the Special Issue Genetic Research on Colorectal Cancer)

Abstract

The principal aim of the current study was to investigate the relationship between miR-149 T>C (rs2292832) and miR-196a2 C>T (rs11614913) small non-coding RNA polymorphisms and the risk of developing CRC in the Azerbaijani population. The study included 120 patients diagnosed with CRC and 125 healthy individuals. Peripheral blood samples were collected from all the subjects in EDTA tubes and DNA extraction was performed by salting out. Polymorphisms were determined using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. While comparing without gender distinction no statistical correlation was found between the heterozygous TC (OR = 0.66; 95% CI = 0.37–1.15; p = 0.142), mutant CC (OR = 1.23; 95% CI = 0.62–2.45; p = 0.550), and mutant C (OR = 1.03; 95% CI = 0.72–1.49; p = 0.859) alleles of the miR-149 gene and the CT (OR = 1.23; 95% CI = 0.69–2.20; p = 0.485), mutant TT (OR = 1.29; 95% CI = 0.67–2.47; p = 0.452), and mutant T (OR = 1.17; 95% CI = 0.82–1.67; p = 0.388) alleles of the miR-196a2 gene and the risk of CRC. However, among women, miR-149 TC (OR = 0.43; 95% CI = 0.19–1.01; p = 0.048) correlated with a reduced risk of CRC, whereas miR-196a2 CT (OR = 2.77; 95% CI = 1.13–6.79; p = 0.025) correlated with an increased risk of CRC. Our findings indicated that miR-149 T>C (rs2292832) might play a protective role in the development of CRC in female patients, whereas the miR-196a2 (rs11614913) polymorphism is associated with an increased risk of CRC in women in the Azerbaijani population, highlighting the importance of gender dimorphism in cancer etiology.

1. Introduction

Colorectal cancer (CRC) stands as one of the prevalent forms of cancer and poses a significant global health concern. It is a multifactorial disease observed in both men and women. The number of new cases including mortality has increased in recent years [1,2]. Depending on the socio-economic development of the countries, it is estimated that the total number of deaths from rectal and colon cancer will increase substantially by 2035 [3,4]. It has been determined that the risk of morbidity and mortality is significantly reduced in countries where invasive and noninvasive screening programs are carried out [5,6]. Chromosome instability (CIN, 80–85% of all CRC cases), microsatellite instability (MSI) including mismatch repair genes (MMR), and CpG island methylator phenotype (CIMP), which provides silencing of oncogenes and tumor suppressor genes by hypermethylation, constitute the molecular basis of the disease [7]. Besides DNA promoter methylation, other epigenetic modifications like non-coding RNAs and histone modifications have also been associated with various disorders including CRC [8]. Short (~20–25 nt) single-stranded microRNAs (miRNAs), a type of non-coding RNA, regulate gene expression at the post-transcriptional level by binding (either degrading them or reducing their expression) to the 3′ untranslated region (3′UTR) of mRNA [9,10]. Although miRNAs possess tumor suppressor and oncogene functions in various cancers and are important in carcinogenesis, they also contribute to different cellular biological processes such as cell growth, differentiation, and cell division [11]. Single-nucleotide polymorphisms (SNPs) in genes encoding miRNAs can adversely affect mature miRNA formation and interaction with target mRNAs, thereby affecting all stages of miRNA biogenesis [12]. In recent studies, SNPs associated with miRNAs in various diseases have been reported and recommended as candidate genetic biomarkers [13,14]. SNPs in miR-149 and miR-196a2 genes investigated in different countries and ethnic groups have been reported to be associated with colorectal cancer [15], lung cancer [16], breast cancer [17], hepatocellular carcinoma [18], gastric cancer [19], cardiovascular diseases [20], etc. Since the miR-149 and miR-196a2 gene polymorphisms have never been studied in CRC patients in our population, consistent data is unavailable. In this case–control study, we have investigated the relationship between miR-149 and miR-196a2 microRNA gene polymorphisms and subjects’ age, gender, clinicopathological parameters, smoking and alcohol use parameters, and CRC susceptibility for the first time in the Azerbaijani population.

2. Materials and Methods

2.1. Subjects

The study included 120 patients diagnosed with CRC at the Scientific Surgery Center of Azerbaijan and the Educational-Surgical Clinic of Azerbaijan Medical University during the period 2018–2021. The study protocol was approved by the Ethics Committee of Genetic Resources Institute and written informed consent was obtained from each patient. Sporadic colorectal cancer cases were included in this study and a history of inflammatory bowel diseases and hereditary colon cancer syndromes were excluded. The histopathology data of the tumors (tumor grade and stage) were specified in the pathology report. We included 125 healthy individuals without a family history of cancer who applied for a routine colonoscopy. After obtaining their consent, additional information such as age, smoking status, and alcohol consumption from both patients and controls were recorded. Peripheral venous blood was collected from each individual in a tube with EDTA for genomic DNA extraction. DNA extraction was carried out using the salting out technique in the Laboratory of Human Genetics of the Genetic Resources Institute, and DNA samples were stored at −20 °C until they were used in the next step. Quantitative and qualitative parameters of DNA were measured in NanoDrop™ 2000/2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

2.2. Genotyping

Genotypes of miR-149 T>C (rs2292832) and miR-196a2 C>T (rs11614913) genes were determined on agarose gel using PCR-RFLP method. PCR reactions of the studied genes in a volume of 25 µL contained the following components: 2.5 µL 10×PCR buffer, 2.5 µL MgCl2 (50 mM), 0.25 µL dNTP mixture (20 mM), 0.5 µL (10 pmol/µL) from each of the forward and reverse primers, 0.25 µL (5 U/µL) Tag polymerase (Solis BioDyne, Tartu, Estonia), 2 µL genomic DNA (50 ng/µL) and 16.5 µL distilled water (dH2O). Amplification conditions for PCR reactions (Applied Biosystems, Waltham, CA, USA) involved initial denaturation at 95 °C for 5 min, 35 cycles at 95 °C for 30 s, annealing for miR-149 T>C gene at 61 °C for 45 s, annealing for miR-196a2 C>T gene at 59 °C for 45 s and 2 min at 72 °C, followed by 5 min final elongation at 72 °C.
After electrophoresis of PCR products in 1.5% agarose gel, amplicons were purified according to the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) protocol. Subsequently, PvuII (New England Biolabs, Massachusetts, USA) for miR-149 T>C and MspI (New England Biolabs, Ipswich, MA, USA) restriction enzymes for miR-196a2 C>T polymorphism were used to determine genotypes.
Restriction fragments were visualized on 2% agarose gel stained with Ethidium Bromide under UV gel documentation system (Figure 1 and Figure 2. The miR-149 T>C genotypes were observed using agarose gel electrophoresis. The TT genotype appeared as a single band at 254 bp, indicating a homozygous uncut pattern. The TC genotype appeared as three bands at 254 bp, 196 bp, and 60 bp, representing a heterozygous pattern. The CC genotype appeared as two bands at 196 bp and 60 bp, indicating homozygous mutant genotypes. The different genotypes of miR-196a2 C>T were observed using agarose gel electrophoresis. The homozygous CC genotype appeared as a single band at 149 bp, the heterozygous CT genotype appeared as two bands at 149 bp and 125 bp, and the homozygous mutant TT genotype appeared as a single band at 125 bp. The sequence of primers, amplicon size, and restriction enzymes and fragments used in the study are listed in Table 1.
An amount of 10% of all the samples were randomly selected for validation purposes. The obtained results were genotyped repeatedly.

2.3. Statistical Analysis

The biostatistical analysis of the results was performed using the SPSS package (ver. 22, SPSS, Chicago, IL, USA). The association between the parameters was evaluated by Pearson’s chi-square test (χ2) and Fisher’s exact test. Fisher’s exact test for contingency tables more than 2 × 2 was performed with Social Science Statistics (http://www.socscistatistics.com/tests/chisquare2/Default2.aspx; accessed on 10 October 2022). A binary logistic regression was carried out to calculate the odds ratios (ORs) with 95% confidence intervals (CIs). All the statistical tests were two-sided; the significance level was taken p < 0.05.

3. Results

This case–control study included 120 patients with CRC and 125 healthy individuals. Table 2 presents the demographic parameters of the patient and control groups. Of the cancer patients, 68 (56.7%) were males and 52 (43.3%) were females, whereas 55 (44%) of the control group were males and 70 (56%) were females. The age range of the patients was 35–84 and 32–82 in the control group, while the mean age was 63 ± 10.1 and 60.9 ± 11.5, respectively. According to the pathology reports, grades of tumors were evaluated as 11.7% for G1, 56.7% for G2, 27.5% for G3, and 4.2% for G4, respectively. On the other hand, tumor stages were determined as 11.7% for T1, 15.8% for T2, 63.3% for T3, and 9.2% for T4, respectively. There was a lack of association among patients’ tumor grade and stage and miR-149 and miR-196a2 polymorphisms. Age, gender, and smoking and alcohol consumption data of patients and controls were compared, and no statistical correlation was observed (p > 0.05).
Table 3 describes the genotype and allele frequencies for the single-nucleotide polymorphisms of the miR-149 T>C and miR-196a2 C>T genes. The wild-type TT genotype of the miR-149 gene was found in 44.2% and 39.2%, heterozygous TC in 32.5% and 44%, and homozygous mutant CC genotype in 23.3% and 16.8% of the patients and control groups, respectively. A statistical correlation was not observed between the risk of CRC and both heterozygous TC (OR = 0.66; 95% CI = 0.37–1.15; p = 0.142) and mutant CC (OR = 1.23; 95% CI = 0.62–2.45; p = 0.550) genotypes of the miR-149 gene. The frequency of the T allele was 60.4% in patients and 61.2% in healthy individuals. The mutant C allele was relatively higher in the patients (39.6%) as compared to the control group (38.8%). There were no statistically significant differences between the two groups in terms of mutant C (OR = 1.03; 95% CI = 0.72–1.49; p = 0.859) alleles. Furthermore, when the miR-196a2 C>T polymorphism was evaluated, the heterozygous CT (OR = 1.23; 95% CI = 0.69–2.20; p = 0.485) and homozygous mutant TT genotype (OR = 1.29; 95% CI = 0.67–2.47; p = 0.452) were found more frequently (40.8% and 26.7%) in the CRC patients as compared to the control group. The incidence of the C allele was 52.9% in the patients and 56.8% in the control group. Additionally, the mutant T allele was detected in 47.1% of the patients and in 43.2% of the control group. However, there was no statistically significant association between the miR-196a2 C>T polymorphism and CRC risk.
The polymorphisms miR-149 T>C and miR-196a2 C>T were compared in the subject groups according to gender and age (Table 4 and Table 5). The miR-149 TC genotype was higher in healthy men (38.2%) and the homozygous mutant CC was found more frequently in male patients (19.1%). In addition, no statistical correlation was observed between the miR-149 T>C polymorphism and the risk of CRC when the males in the study groups were compared (p > 0.05). Conversely, when female patients were compared with healthy women, a statistical association was found between the miR-149 TC genotype and reduced CRC risk (OR = 0.43; 95% CI = 0.19–1.01; p = 0.048). However, the miR-149 CC genotype was more frequent in female patients, but no statistical difference was found. Due to the comparison, the frequency of the mutant CC genotype was higher in patients under 60 years old compared to patients over 60 (45.8% and 43.1%). However, no statistical difference was observed between miR-149 genotypes and disease risk according to age.
Similarly, the distribution of the miR-196a2 C>T polymorphism by age and gender is presented in Table 4. Although the mutant TT genotype (23.5%) was predominant in male patients as compared to healthy men, it did not indicate statistical significance (OR = 0.99; 95% CI = 0.38–2.56; p = 0.979). Both heterozygous CT (48.1%) and homozygous mutant TT (30.8%) genotypes were more common in female patients than in healthy women. Particularly, the heterozygous CT genotype was associated with an increased risk of CRC (OR = 2.77; 95% CI = 1.13–6.79; p = 0.025). No statistical difference was observed when comparing miR-196a2 C>T polymorphism based on age in patients and control groups. However, CT and TT genotypes were more common in patients over 60 years old.
We calculated the distribution of genotypes with respect to the smoking and alcohol statuses of the patients (Table 6). Furthermore, both the heterozygous TC (31.4%) and mutant CC (28.6%) genotypes of the miR-149 gene were higher in smokers, while TC and CC genotypes were more common in non-drinkers. Similarly, the polymorphism of the miR-196a2 C>T gene was analyzed, wherein the heterozygous CT was higher in non-smokers (42.9%) and non-drinkers (43.8%), while mutant TT was more common in smokers (28.6%) and alcohol drinkers (31.3%). However, when the polymorphisms of both genes were compared between the subject groups, no statistical difference was observed (p > 0.05).
Table 7 presents the distribution of miR-149 T>C genotypes based on tumor stage and grade. The mutant CC genotype was found to be more prevalent among patients with tumor grade G3. When it comes to tumor stages, the TC genotype was more frequently observed in T3 cases, while the CC genotype was more prevalent in T1 cases. However, there were no significant statistical differences in genotype distribution concerning tumor grade and stages (p > 0.05).
Moreover, the heterozygote CT and mutant TT of miR-196a2 C>T was higher in tumor grades G1 and G4, respectively (Table 8). As for tumor stages, the CT and TT genotypes were more frequent in T2 stages. It is important to mention that the correlation between the distribution of genotypes and tumor stages was statistically significant (p < 0.05).

4. Discussion

The application of screening programs is important in clinical diagnosis for the early and timely detection of precancerous pathologies and malignant tumors. The recent widespread use of noninvasive molecular-based analyses has provided essential opportunities for early detection, diagnosis, metastasis, understanding of drug resistance mechanisms, and personalized medicine [21]. SNPs in the miRNA encoding sequence can directly affect the biogenesis of miRNA, thereby influencing the transcription of pri-miRNAs in the nucleus, the formation of mature miRNA, and the interaction of miRNAs with target mRNA [22]. In our study, we examined the relationship between the miR-149 T>C and miR-196a2 C>T gene polymorphisms, the most widely studied in miRNA genes, and CRC risk for the first time in the Azerbaijani population.
We found no statistical correlation between the genotype and allele frequency of the miR-149 rs2292832 and miR-196a2 rs11614913 and the risk of CRC while comparing without gender distinction. Similarly, Hezova et al. reported that miR-196-a2, miR-27a, and miR-146a gene polymorphisms were not associated with CRC risk in the Czech population [23]. A meta-analysis showed that lung, breast, and colorectal cancers were not associated with the miR-149 polymorphism in a large study group [24]. Furthermore, the gene polymorphism of miR-196a2 was not associated with CRC susceptibility in a meta-analysis of European studies [25]. The rs11614913 polymorphism of the miR-196a2 gene was not found to be associated with CRC in the Greek population either [26]. In the meta-analysis performed in China, no significant correlation was observed in the overall results for rs2292832 [27]. A study conducted in Iran showed that rs2292832 of the miR-149 gene and rs11614913 polymorphisms of the miR-196a2 gene were not associated with the risk of CRC [28,29].
Another meta-analysis found no association between the miR-146 and miR-149 polymorphisms and CRC, whereas SNP in the miR-196 gene was associated with CRC in the Asian population [30]. Moreover, Choupani et al. stated that the rs11614913 polymorphism of the miR-196a2 gene is associated with the risk of CRC only in Asia and not in the Caucasus. It has also been reported that rs2292832 of the miR-149 gene does not affect cancer in the general population, but the recessive model increases the risk of CRC [31]. However, in our study, there was no relationship between the dominant and recessive model and the risk of disease.
In this study, the tumor grade and stage were not associated with the miR-149 T>C polymorphism. Our results are in concordance with recent studies [15]. Concerning the miR-196a2 C>T polymorphism, no association was observed between tumor grade and the polymorphism. However, a statistically significant correlation was identified between the polymorphism and tumor stage. Likewise, Zhu and colleagues observed a significant association between the miR-196a2 C>T variant and the susceptibility of patients with advanced-stage tumors (Dukes C and D) [20].
In a study by Wang, the miR-196a2 rs11614913 polymorphism was not associated with the pathological parameters of the tumor [32]. However, there is a statistically significant relationship between the SNP and the stage of the tumor. In contrast, Chen et al. reported that either genotype or allele frequencies of the miR-196a2 gene do not contribute toward the risk of CRC, demonstrating no statistically significant relationship between miR-196a2 rs11614913 and tumor grade, stage, tumor invasion, and lymph node metastasis status [33].
However, when gender distinction is considered in our study, rs2292832 of miR-149 is associated with a lower risk of CRC among females and may play a protective role against developing CRC in women. Our work highlights the importance of sex dimorphism in cancer once more. There is a growing body of recent evidence supporting the notion of sexual dimorphism in cancer, which was introduced in 2016 [34] and is based on differences in tumor biology between tumors arising in males and females. It is well known that CRC incidence rates are clearly sexually dimorphic in every region of the world [35], with female incidences being lower than males. On the other hand, according to several retrospective studies, women with CRC have a higher survival rate than men [36]. For instance, women in a German cohort study of 185,967 patients had significantly higher survival rates than men [37]. Therefore, it is important to bring more insight into the genetic architecture of colon cancer by taking into account gender differences.
In order to clarify whether other studies showed similar results when gender is considered, we conducted a literature search. Ranjbar et al. found a significant relationship between the miR-149 rs2292832 polymorphism and gender/age in the Iranian population [28]. The meta-analysis investigating digestive system cancers found no relationship between the miR-149 rs2292832 T/C polymorphism and ethnicity and smoking, including sex [38]. Zhang et al. did not find a relationship between hsa-miR-605 (rs2043556) and hsa-miR-149 (rs2292832) SNPs in women with CRC and gastric cancer; however, researchers reported that these polymorphisms showed protective effects in men [39]. In addition, the rs2292832 polymorphism in miR-149 was found to be associated with a reduced cancer risk in other cancer diseases such as breast cancer [40] and cervical cancer [41].
Moreover, we found miR-196a2 heterozygous CT to be associated with a higher risk of CRC when comparing female patients with healthy subjects. In a study conducted in the Indian population, the rs11614913 CT genotype increased the risk of breast cancer in women [17]. Wang et al. reported that the miR-196a2 rs11614913 polymorphism was also associated with breast cancer susceptibility in women in Chinese and Indian populations [42]. In contrast, rs11614913 is associated with decreased risk of esophageal squamous cell carcinoma in female patients and patients who never smoke or drink [43].

5. Conclusions

We investigated a possible association between the miR-149 gene T>C (rs2292832) and miR-196a2 gene C>T (rs11614913) polymorphisms and the risk of CRC in an Azerbaijani population. Our results have demonstrated that the miR-149 T>C (rs2292832) heterozygous TC genotype was associated with a lower risk of CRC among females and might play a protective role against the development of CRC in women. On the other hand, miR-196a2 heterozygous CT in our study has been shown to be associated with a higher risk of CRC in female patients.
This study is an attempt to provide preliminary evidence that pretreatment genotyping of miR-149 rs2292832 and miR-196a2 polymorphisms can help predict the development of CRC. The present study is the first to report miR-149 T>C and miR-196a2 C>T polymorphisms as risk factors for CRC in an Azerbaijani population. However, we should also note that our research has certain limitations. Firstly, we had only a small sample size of females included in our study, and so we may need to increase the sample size to clearly demonstrate the effect of heterozygous genotypes of both miR-149 T>C and miR-196a2 C>T polymorphisms on CRC risk. In addition, the participants were from only two centers, the Scientific Surgery Center of Azerbaijan and the Educational-Surgical Clinic of Azerbaijan Medical University. The extent to which the present findings can be applied broadly should be cautiously approached, as no validation study has been undertaken with a distinct Azerbaijani population or a population of a different ethnicity. Furthermore, in our study, we did not investigate how polymorphisms affect gene expression, and it is possible that these genes could be analyzed in detail using next-generation sequencing systems, and their effect on CRC risk could be demonstrated.
In conclusion, our findings suggest that miR-149 rs2292832 and miR-196a2 polymorphisms may have a role in the genetic etiology of CRC in women in the Azerbaijani population.

Author Contributions

Conceptualization—V.Y., B.B. and N.B.; Experimental design—B.B.; Supervision—H.A. and C.R.; Resources—H.A.; Materials—B.B. and N.K.; Data Collection and/or Processing—B.B. and H.A.; Analysis and/or Interpretation—V.Y., B.B., K.G. and I.S.; Writing Manuscript—B.B. and N.K.; Critical Review—V.Y. and H.A. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Science Development Foundation under the President of the Republic of Azerbaijan (Grant № EIF- ETL-2020-2(36)-16/14/3-M-14).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of Genetic Resources Institute of Ministry of Science and Education (protocol code 58-10/246 and date of approval 27 August 2018).

Informed Consent Statement

All measurements conducted in this investigation took place at the Scientific Surgery Center of Azerbaijan, the Educational-Surgical Clinic of Azerbaijan Medical University, and the Genetic Resources Institute. Prior to their involvement in the study, all subjects were provided with comprehensive information and gave their informed consent. Informed consent was obtained from all participants in the study. Patients were required to provide written informed consent for the publication of this article.

Data Availability Statement

All data used for the research are presented in the tables in this article.

Acknowledgments

We thank PAGEL (The Partnerships for the Health Sector in Developing Countries) Program of German Academic Exchange Service for supporting research cooperation between Azerbaijani and German scholars within this project.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Akimoto, N.; Ugai, T.; Zhong, R.; Hamada, T.; Fujiyoshi, K.; Giannakis, M.; Wu, K.; Cao, Y.; Ng, K.; Ogino, S. Rising incidence of early-onset colorectal cancer—A call to action. Nat. Rev. Clin. Oncol. 2021, 18, 230–243. [Google Scholar] [CrossRef] [Scilit]
  2. Mármol, I.; Sánchez-de-Diego, C.; Pradilla Dieste, A.; Cerrada, E.; Rodriguez Yoldi, M.J. Colorectal carcinoma: A general overview and future perspectives in colorectal cancer. Int. J. Mol. Sci. 2017, 18, 197. [Google Scholar] [CrossRef] [Scilit]
  3. Dekker, E.; Tanis, P.J.; Vleugels, J.L.; Kasi, P.M.; Wallace, M. Pure-AMC. Lancet 2019, 394, 1467–1480. [Google Scholar] [CrossRef] [Scilit]
  4. Sawicki, T.; Ruszkowska, M.; Danielewicz, A.; Niedźwiedzka, E.; Arłukowicz, T.; Przybyłowicz, K.E. A review of colorectal cancer in terms of epidemiology, risk factors, development, symptoms and diagnosis. Cancers 2021, 13, 2025. [Google Scholar] [CrossRef] [Scilit]
  5. Kanth, P.; Inadomi, J.M. Screening and prevention of colorectal cancer. BMJ 2021, 374. [Google Scholar] [CrossRef] [Scilit]
  6. Segnan, N.; Dekker, E.; Doria-Rose, V.P.; Senore, C.; Rabeneck, L.; Lansdorp-Vogelaar, I.; Perin, D.M.P.; Coupé, V.M.; Portillo, I.; McCarthy, S. Comparing Colorectal Cancer Screening Outcomes in the International Cancer Screening Network: A Consortium Proposal. Gastroenterology 2022, 162, 668–674. [Google Scholar] [CrossRef] [Scilit]
  7. Dienstmann, R.; Vermeulen, L.; Guinney, J.; Kopetz, S.; Tejpar, S.; Tabernero, J. Consensus molecular subtypes and the evolution of precision medicine in colorectal cancer. Nat. Rev. Cancer 2017, 17, 79–92. [Google Scholar] [CrossRef] [Scilit]
  8. Jung, G.; Hernández-Illán, E.; Moreira, L.; Balaguer, F.; Goel, A. Epigenetics of colorectal cancer: Biomarker and therapeutic potential. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 111–130. [Google Scholar] [CrossRef] [Scilit]
  9. Goel, A.; Boland, C.R. Epigenetics of colorectal cancer. Gastroenterology 2012, 143, 1442–1460.e1. [Google Scholar] [CrossRef] [Scilit]
  10. Sun, Z.; Shi, K.; Yang, S.; Liu, J.; Zhou, Q.; Wang, G.; Song, J.; Li, Z.; Zhang, Z.; Yuan, W. Effect of exosomal miRNA on cancer biology and clinical applications. Mol. Cancer 2018, 17, 1–19. [Google Scholar] [CrossRef] [Scilit]
  11. Dutta, A.; Lee, Y. MicroRNAs in cancer. Annu. Rev. Pathol. 2009, 4, 199–227. [Google Scholar]
  12. SiamiGorji, S.; Jorjani, I.; Tahamtan, A.; Moradi, A. Effects of microRNAs polymorphism in cancer progression. Med. J. Islamic Republic Iran 2020, 34, 3. [Google Scholar] [CrossRef] [Scilit]
  13. Backes, C.; Meese, E.; Keller, A. Specific miRNA disease biomarkers in blood, serum and plasma: Challenges and prospects. Mol. Diagn. Ther. 2016, 20, 509–518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Hayes, J.; Peruzzi, P.P.; Lawler, S. MicroRNAs in cancer: Biomarkers, functions and therapy. Trends Mol. Med. 2014, 20, 460–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Du, W.; Ma, X.-L.; Zhao, C.; Liu, T.; Du, Y.-L.; Kong, W.-Q.; Wei, B.-L.; Yu, J.-Y.; Li, Y.-Y.; Huang, J.-W. Associations of single nucleotide polymorphisms in miR-146a, miR-196a, miR-149 and miR-499 with colorectal cancer susceptibility. Asian Pac. J. Cancer Prev. 2014, 15, 1047–1055. [Google Scholar] [CrossRef] [Scilit]
  16. Vinci, S.; Gelmini, S.; Pratesi, N.; Conti, S.; Malentacchi, F.; Simi, L.; Pazzagli, M.; Orlando, C. Genetic variants in miR-146a, miR-149, miR-196a2, miR-499 and their influence on relative expression in lung cancers. Clin. Chem. Lab. Med. (CCLM) 2011, 49, 2073–2080. [Google Scholar] [CrossRef] [Scilit]
  17. Bodal, V.K.; Sangwan, S.; Bal, M.S.; Kaur, M.; Sharma, S.; Kaur, B. Association between microrna 146a and microrna 196a2 genes polymorphism and breast cancer risk in North Indian women. Asian Pac. J. Cancer Prev. APJCP 2017, 18, 2345. [Google Scholar]
  18. Zheng, L.; Zhuang, C.; Zhao, J.; Ming, L. Functional miR-146a, miR-149, miR-196a2 and miR-499 polymorphisms and the susceptibility to hepatocellular carcinoma: An updated meta-analysis. Clin. Res. Hepatol. Gastroenterol. 2017, 41, 664–676. [Google Scholar] [CrossRef] [Scilit]
  19. Zhang, L.; Liu, Q.; Wang, F. Association between miR-149 gene rs2292832 polymorphism and risk of gastric cancer. Arch. Med. Res. 2018, 49, 270–277. [Google Scholar] [CrossRef] [Scilit]
  20. Zhu, L.; Chu, H.; Gu, D.; Ma, L.; Shi, D.; Zhong, D.; Tong, N.; Zhang, Z.; Wang, M. A functional polymorphism in miRNA-196a2 is associated with colorectal cancer risk in a Chinese population. DNA Cell Biol. 2012, 31, 350–354. [Google Scholar] [CrossRef] [Scilit]
  21. Bray, C.; Bell, L.N.; Liang, H.; Collins, D.; Yale, S.H. Colorectal cancer screening. WMJ 2017, 116, 27–33. [Google Scholar]
  22. Hrovatin, K.; Kunej, T. Classification of miRNA-related sequence variations. Epigenomics 2018, 10, 463–481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Hezova, R.; Kovarikova, A.; Bienertova-Vasku, J.; Sachlova, M.; Redova, M.; Vasku, A.; Svoboda, M.; Radova, L.; Kiss, I.; Vyzula, R. Evaluation of SNPs in miR-196-a2, miR-27a and miR-146a as risk factors of colorectal cancer. World J. Gastroenterol. WJG 2012, 18, 2827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Zhang, J.; Liu, Y.-f.; Gan, Y. Lack of association between miR-149 C> T polymorphism and cancer susceptibility: A meta-analysis based on 4677 cases and 4830 controls. Mol. Biol. Rep. 2012, 39, 8749–8753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Kupcinskas, J.; Bruzaite, I.; Juzenas, S.; Gyvyte, U.; Jonaitis, L.; Kiudelis, G.; Skieceviciene, J.; Leja, M.; Pauzas, H.; Tamelis, A. Lack of association between miR-27a, miR-146a, miR-196a-2, miR-492 and miR-608 gene polymorphisms and colorectal cancer. Sci. Rep. 2014, 4, 5993. [Google Scholar] [CrossRef] [Scilit]
  26. Dikaiakos, P.; Gazouli, M.; Rizos, S.; Zografos, G.; Theodoropoulos, G.E. Evaluation of genetic variants in miRNAs in patients with colorectal cancer. Cancer Biomark. 2015, 15, 157–162. [Google Scholar] [CrossRef] [Scilit]
  27. Feng, Y.; Duan, F.; Song, C.; Zhao, X.; Dai, L.; Cui, S. Systematic evaluation of cancer risk associated with rs2292832 in miR-149 and rs895819 in miR-27a: A comprehensive and updated meta-analysis. Oncotarget 2016, 7, 22368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Ranjbar, R.; Chaleshi, V.; Aghdaei, H.A.; Morovvati, S. Investigating the association between miR-608 rs4919510 and miR-149 rs2292832 with Colorectal Cancer in Iranian Population. Microrna 2018, 7, 100–106. [Google Scholar] [CrossRef] [Scilit]
  29. Soltanian, A.R.; Hosseini, B.; Mahjub, H.; Bahreini, F.; Ehsan, N.M.; Ghaffari, M.E. Association between rs11614913 polymorphism of the MiR-196-a2 gene and colorectal cancer in the presence of departure from hardy-weinberg equilibrium. Cell J. (Yakhteh) 2021, 23, 313. [Google Scholar]
  30. Xu, L.; Tang, W. Associations of polymorphisms in mir-196a2, mir-146a and mir-149 with colorectal cancer risk: A meta-analysis. Pathol. Oncol. Res. 2016, 22, 261–267. [Google Scholar] [CrossRef] [Scilit]
  31. Choupani, J.; Nariman-Saleh-Fam, Z.; Saadatian, Z.; Ouladsahebmadarek, E.; Masotti, A.; Bastami, M. Association of mir-196a-2 rs11614913 and mir-149 rs2292832 polymorphisms with risk of cancer: An updated meta-analysis. Front. Genet. 2019, 10, 186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Wang, N.; Li, Y.; Zhu, L.J.; Zhou, R.M.; Jin, W.; Guo, X.Q.; Wang, C.M.; Chen, Z.F.; Liu, W. A functional polymorphism rs11614913 in microRNA-196a2 is associated with an increased risk of colorectal cancer although not with tumor stage and grade. Biomed. Rep. 2013, 1, 737–742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Chen, H.; Sun, L.Y.; Chen, L.L.; Zheng, H.Q.; Zhang, Q.F. A variant in microRNA-196a2 is not associated with susceptibility to and progression of colorectal cancer in Chinese. Intern. Med. J. 2012, 42, e115–e119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Clocchiatti, A.; Cora, E.; Zhang, Y.; Dotto, G.P. Sexual dimorphism in cancer. Nat. Rev. Cancer 2016, 16, 330–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Favoriti, P.; Carbone, G.; Greco, M.; Pirozzi, F.; Pirozzi, R.E.M.; Corcione, F. Worldwide burden of colorectal cancer: A review. Updates Surg. 2016, 68, 7–11. [Google Scholar] [CrossRef] [Scilit]
  36. Yang, Y.; Wang, G.; He, J.; Ren, S.; Wu, F.; Zhang, J.; Wang, F. Gender differences in colorectal cancer survival: A meta-analysis. Int. J. Cancer 2017, 141, 1942–1949. [Google Scholar] [CrossRef] [Scilit]
  37. Schmuck, R.; Gerken, M.; Teegen, E.-M.; Krebs, I.; Klinkhammer-Schalke, M.; Aigner, F.; Pratschke, J.; Rau, B.; Benz, S. Gender comparison of clinical, histopathological, therapeutic and outcome factors in 185,967 colon cancer patients. Langenbeck’s Arch. Surg. 2020, 405, 71–80. [Google Scholar] [CrossRef] [Scilit]
  38. Li, L.; Liu, T.; Li, Z.; Zhang, L.; Zhang, Z. The miR-149 rs2292832 T/C polymorphism may decrease digestive cancer susceptibility: An updated meta-analysis. Int. J. Clin. Exp. Med. 2015, 8, 15351. [Google Scholar] [PubMed]
  39. Zhang, M.W.; Jin, M.J.; Yu, Y.X.; Zhang, S.C.; Liu, B.; Jiang, X.; Pan, Y.F.; Li, Q.L.; Ma, X.Y.; Chen, K. Associations of lifestyle-related factors, hsa-miR-149 and hsa-miR-605 gene polymorphisms with gastrointestinal cancer risk. Mol. Carcinog. 2012, 51, E21–E31. [Google Scholar] [CrossRef] [Scilit]
  40. He, B.; Pan, Y.; Xu, Y.; Deng, Q.; Sun, H.; Gao, T.; Wang, S. Associations of polymorphisms in microRNAs with female breast cancer risk in Chinese population. Tumor Biol. 2015, 36, 4575–4582. [Google Scholar] [CrossRef] [Scilit]
  41. Chen, K.; Yan, Z.; Dong, X.; Liang, Y.; Yao, Y.; Zhang, S.; Liu, W.; Li, C.; Yao, Y.; Shi, L. Genetic Polymorphisms in microRNA Genes Targeting PI3K/Akt Signal Pathway Modulate Cervical Cancer Susceptibility in a Chinese Population. Front. Genet. 2022, 13, 856505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Wang, F.; Ma, Y.-L.; Zhang, P.; Yang, J.-J.; Chen, H.-Q.; Liu, Z.-H.; Peng, J.-Y.; Zhou, Y.-K.; Qin, H.-L. A genetic variant in microRNA-196a2 is associated with increased cancer risk: A meta-analysis. Mol. Biol. Rep. 2012, 39, 269–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Wei, J.; Zheng, L.; Liu, S.; Yin, J.; Wang, L.; Wang, X.; Shi, Y.; Shao, A.; Tang, W.; Ding, G. MiR-196a2 rs11614913 T> C polymorphism and risk of esophageal cancer in a Chinese population. Hum. Immunol. 2013, 74, 1199–1205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Genotypes of miR-149 gene polymorphism determined by PCR-RFLP methods in agarose gel. DNA Ladder (100 bp): Lane-1. Wild-type TT: Lane-3, 5, 7, 8, 9, 12. Heterozygous TC: Lane-2, 4, 11. Homozygous mutant CC: Lane-6, 10.
Figure 1. Genotypes of miR-149 gene polymorphism determined by PCR-RFLP methods in agarose gel. DNA Ladder (100 bp): Lane-1. Wild-type TT: Lane-3, 5, 7, 8, 9, 12. Heterozygous TC: Lane-2, 4, 11. Homozygous mutant CC: Lane-6, 10.
Biomedicines 11 02341 g001
Figure 2. Genotypes of miR-196a2 gene polymorphism determined by PCR-RFLP methods in agarose gel. DNA Ladder (100 bp): Lane-1. Wild-type CC: Lane-3, 5, 8. Heterozygous CT: Lane-6, 7, 9. Homozygous mutant TT: Lane-2, 4.
Figure 2. Genotypes of miR-196a2 gene polymorphism determined by PCR-RFLP methods in agarose gel. DNA Ladder (100 bp): Lane-1. Wild-type CC: Lane-3, 5, 8. Heterozygous CT: Lane-6, 7, 9. Homozygous mutant TT: Lane-2, 4.
Biomedicines 11 02341 g002
Table 1. MiRNA SNPs, specific primer sequences, and restriction enzymes.
Table 1. MiRNA SNPs, specific primer sequences, and restriction enzymes.
PolymorphismsSequence of PrimersPCR ProductsRestriction EnzymesRestriction
Fragments
miR-149 T>C (rs2292832)F: TGTCTTCACTCCCGTGCTTGTCC
R: TGAGGCCCGAAACACCCGTA
254 bpPvuIIT allele: 254 bp
C allele:
196 bp + 60 bp
miR-196a2 C>T (rs11614913)F: CCCCTTCCCTTCTCCTCCAGATA
R: CGAAAACCGACTGATGTAACTCCG
149 bpMspIC allele: 149 bp
T allele: 125 bp
Table 2. Demographic and clinical parameters related to cases and controls.
Table 2. Demographic and clinical parameters related to cases and controls.
CharacteristicsPatients N = 120 (%)Controls N = 125 (%)p-Values
Gender
Male68 (56.7%)55 (44%)0.259
Female52 (43.3%)70 (56%)
Age
Age interval35–8432–820.152
Mean63 ± 10.160.9 ± 11.5
Histological Grade
G114 (11.7%)
G268 (56.7%)
G333 (27.5%)
G45 (4.2%)
Tumor Stage
T114 (11.7%)
T219 (15.8%)
T376 (63.3%)
T411 (9.2%)
Smoking Status
Smokers35 (29.2%)58 (46.4%)0.554
Non-Smokers77 (64.2%)61 (48.8%)
Unknown8 (6.6%)6 (4.8%)
Alcohol consumption
Yes32 (26.7%)41 (32.8%)0.612
No80 (66.7%)79 (63.2%)
Unknown8 (6.6%)5 (4%)
Table 3. Distribution of genotypes and allele frequencies of miR-149 and miR-196a2 genes in study groups.
Table 3. Distribution of genotypes and allele frequencies of miR-149 and miR-196a2 genes in study groups.
miR-149 T>CCases N = 120 (%)Controls N = 125 (%)OR (95% CI)p-Values
Genotype
TT53 (44.2)49 (39.2)1-
TC39 (32.5)55 (44)0.66 (0.37–1.15)0.142
CC28 (23.3)21 (16.8)1.23 (0.62–2.45)0.55
Dominant model
TT53 (44.2)49 (39.2)1-
TC+CC67 (55.8)76 (60.8)1.23 (0.74–2.04)0.43
Recessive model
TT+TC92 (76.7)104 (83.2)1-
CC28 (23.3)21 (16.8)0.66 (0.35–1.25)0.201
Allele
T145 (60.4)153 (61.2)1-
C95 (39.6)97 (38.8)1.03 (0.72–1.49)0.859
miR-196a2 C>TCasesControlsOR (95% CI)p-Values
N = 120 (%)N = 125 (%)
Genotype
CC39 (32.5)47 (37.6)1-
CT49 (40.8)48 (38.4)1.23 (0.69–2.20)0.485
TT32 (26.7)30 (24)1.29 (0.67–2.47)0.452
Dominant model
CC39 (32.5)47 (37.6)1-
CT+TT81 (67.5)78 (62.4)1.25 (0.74–2.12)0.403
Recessive model
CC+CT88 (73.3)95 (76)1-
TT32 (26.7)30 (24)1.52 (0.65–2.05)0.631
Allele
C127 (52.9)142 (56.8)1-
T113 (47.1)108 (43.2)1.17 (0.82–1.67)0.388
Table 4. Distribution of miR-149 genotypes in terms of age and gender.
Table 4. Distribution of miR-149 genotypes in terms of age and gender.
GenotypesCases N = 68 (%)Controls N = 55 (%)OR (95% CI)p-Values
Males
TT30 (44.1)25 (45.5)1-
TC25 (36.8)21 (38.2)0.99 (0.45–2.18)0.984
CC13 (19.1)9 (16.3)1.20 (0.44–3.28)0.717
N = 52 (%)N = 70 (%)
Females
TT23 (44.2)24 (34.3)1-
TC14 (26.9)34 (48.6)0.43 (0.19–1.01) 0.048
CC15 (28.9)12 (17.1)1.30 (0.50–3.37)0.583
AgeCasesControls
N = 48 (%)N = 50 (%)
≤60
TT12 (25)8 (16)1-
TC14 (29.2)24 (48)0.39 (0.13–1.18)0.092
CC22 (45.8)18 (36)0.82 (0.27–2.42)0.713
CasesControls
N = 72 (%)N = 75 (%)
>60
TT16 (22.2)13 (17.4)11
TC25 (34.7)31 (41.3)0.66 (0.27–1.61)0.357
CC31 (43.1)31 (41.3)0.81 (0.34–1.97)0.645
Table 5. Distribution of miR-196a2 genotypes in terms of age and gender.
Table 5. Distribution of miR-196a2 genotypes in terms of age and gender.
GenotypesCases, N = 68 (%)Controls, N = 55 (%)OR (95% CI)p-Values
Males
CC28 (41.2)19 (34.5)1-
CT24 (35.3)25 (45.5)0.65 (0.29–1.46)0.298
TT16 (23.5)11 (20)0.99 (0.38–2.56)0.979
Cases, N = 52 (%)Controls, N = 70 (%)
Females
CC11 (21.1)28 (40)1-
CT25 (48.1)23 (32.9)2.77 (1.13–6.79)0.025
TT16 (30.8)19 (27.1)2.14 (0.82–5.62)0.118
AgeCases, N = 47 (%)Controls, N = 80 (%)
≤60
CC15 (31.9)27 (33.7)1-
CT21 (44.7)32 (40)1.18 (0.51–2.73)0.697
TT11 (23.4)21 (26.3)0.94 (0.36–2.47)0.905
Cases, N = 73 (%)Controls, N= 45 (%)
>60
CC24 (32.8)20 (44.4)1-
CT28 (38.4)16 (35.6)1.46 (0.62–3.43)0.386
TT21 (28.8)9 (20)1.94 (0.73–5.19)0.181
Table 6. Distribution of miR-149 and miR-196a2 genotypes in terms of smoking and alcohol use.
Table 6. Distribution of miR-149 and miR-196a2 genotypes in terms of smoking and alcohol use.
miR-149 T>C GenotypesSmokers
N = 35 (%)
Non-Smokers
N = 77 (%)
OR (95% CI)p-Values
TT14 (40)36 (46.8)1-
TC11 (31.4)24 (31.2)1.18 (0.46–3.03)0.733
CC10 (28.6)17 (22)1.51 (0.56–4.10)0.414
Alcohol drinkers
N = 32 (%)
Non-drinkers
N = 80 (%)
TT18 (56.3)32 (40)1-
TC8 (25)27 (33.8)0.53 (0.19–1.40)0.196
CC6 (18.7)21 (26.2)0.51 (0.17–1.48)0.213
miR-196a2 C>T
Genotypes
Smokers
N = 35 (%)
Non-smokers
N = 77 (%)
CC15 (42.8)23 (29.8)1-
CT10 (28.6)33 (42.9)0.47 (0.18–1.22)0.115
TT10 (28.6)21 (27.3)0.73 (0.27–1.98)0.535
Alcohol drinkers
N = 32 (%)
Non-drinkers
N = 80 (%)
CC14 (43.8)24 (30)1-
CT8 (25)35 (43.8)0.39 (0.14–1.08)0.066
TT10 (31.3)21 (26.3)0.82 (0.30–2.22)0.691
Table 7. Distribution of miR-149 T>C genotypes in tumor stages and grades.
Table 7. Distribution of miR-149 T>C genotypes in tumor stages and grades.
TTTCCCp Values
N (%)N (%)N (%)
Tumor grade
G17 (50)4 (28.6)3 (21.4)0.998
G229 (42.6)23 (33.8)16 (23.6)
G315 (45.5)10 (30.3)8 (24.2)
G42 (40)2 (40)1 (20)
Tumor stage
T14 (28.6)4 (28.6)6 (42.8)0.179
T211 (57.9)5 (26.3)3 (15.8)
T332 (42.1)29 (38.2)15 (19.7)
T46 (54.5)1 (9.1)4 (36.4)
Table 8. Distribution of miR-196a2 C>T genotypes in tumor stages and grades.
Table 8. Distribution of miR-196a2 C>T genotypes in tumor stages and grades.
CCCTTTp Values
N (%)N (%)N (%)
Tumor grade
G12 (14.2)9 (64.3)3 (21.5)0.149
G228 (41.2)29 (42.7)11 (16.1)
G312 (36.4)13 (39.4)8 (24.2)
G41 (20)1 (20)3 (60)
Tumor stage
T16 (42.8)4 (28.6)4 (28.6)0.034
T22 (10.5)7 (36.8)10 (52.7)
T336 (47.4)27 (35.5)13 (17.1)
T44 (36.3)3 (27.2)4 (36.4)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bayramov, B.; Bayramov, N.; Aslanov, H.; Karimova, N.; Gasimov, K.; Shahmuradov, I.; Reißfelder, C.; Yagublu, V. Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study. Biomedicines 2023, 11, 2341. https://doi.org/10.3390/biomedicines11092341

AMA Style

Bayramov B, Bayramov N, Aslanov H, Karimova N, Gasimov K, Shahmuradov I, Reißfelder C, Yagublu V. Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study. Biomedicines. 2023; 11(9):2341. https://doi.org/10.3390/biomedicines11092341

Chicago/Turabian Style

Bayramov, Bayram, Nuru Bayramov, Hazi Aslanov, Nigar Karimova, Karim Gasimov, Ilham Shahmuradov, Christoph Reißfelder, and Vugar Yagublu. 2023. "Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study" Biomedicines 11, no. 9: 2341. https://doi.org/10.3390/biomedicines11092341

APA Style

Bayramov, B., Bayramov, N., Aslanov, H., Karimova, N., Gasimov, K., Shahmuradov, I., Reißfelder, C., & Yagublu, V. (2023). Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study. Biomedicines, 11(9), 2341. https://doi.org/10.3390/biomedicines11092341

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop