Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. Genotyping
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Akimoto, N.; Ugai, T.; Zhong, R.; Hamada, T.; Fujiyoshi, K.; Giannakis, M.; Wu, K.; Cao, Y.; Ng, K.; Ogino, S. Rising incidence of early-onset colorectal cancer—A call to action. Nat. Rev. Clin. Oncol. 2021, 18, 230–243. [Google Scholar] [CrossRef]
- Mármol, I.; Sánchez-de-Diego, C.; Pradilla Dieste, A.; Cerrada, E.; Rodriguez Yoldi, M.J. Colorectal carcinoma: A general overview and future perspectives in colorectal cancer. Int. J. Mol. Sci. 2017, 18, 197. [Google Scholar] [CrossRef]
- Dekker, E.; Tanis, P.J.; Vleugels, J.L.; Kasi, P.M.; Wallace, M. Pure-AMC. Lancet 2019, 394, 1467–1480. [Google Scholar] [CrossRef]
- Sawicki, T.; Ruszkowska, M.; Danielewicz, A.; Niedźwiedzka, E.; Arłukowicz, T.; Przybyłowicz, K.E. A review of colorectal cancer in terms of epidemiology, risk factors, development, symptoms and diagnosis. Cancers 2021, 13, 2025. [Google Scholar] [CrossRef]
- Kanth, P.; Inadomi, J.M. Screening and prevention of colorectal cancer. BMJ 2021, 374. [Google Scholar] [CrossRef]
- Segnan, N.; Dekker, E.; Doria-Rose, V.P.; Senore, C.; Rabeneck, L.; Lansdorp-Vogelaar, I.; Perin, D.M.P.; Coupé, V.M.; Portillo, I.; McCarthy, S. Comparing Colorectal Cancer Screening Outcomes in the International Cancer Screening Network: A Consortium Proposal. Gastroenterology 2022, 162, 668–674. [Google Scholar] [CrossRef]
- Dienstmann, R.; Vermeulen, L.; Guinney, J.; Kopetz, S.; Tejpar, S.; Tabernero, J. Consensus molecular subtypes and the evolution of precision medicine in colorectal cancer. Nat. Rev. Cancer 2017, 17, 79–92. [Google Scholar] [CrossRef]
- Jung, G.; Hernández-Illán, E.; Moreira, L.; Balaguer, F.; Goel, A. Epigenetics of colorectal cancer: Biomarker and therapeutic potential. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 111–130. [Google Scholar] [CrossRef]
- Goel, A.; Boland, C.R. Epigenetics of colorectal cancer. Gastroenterology 2012, 143, 1442–1460.e1. [Google Scholar] [CrossRef]
- Sun, Z.; Shi, K.; Yang, S.; Liu, J.; Zhou, Q.; Wang, G.; Song, J.; Li, Z.; Zhang, Z.; Yuan, W. Effect of exosomal miRNA on cancer biology and clinical applications. Mol. Cancer 2018, 17, 1–19. [Google Scholar] [CrossRef]
- Dutta, A.; Lee, Y. MicroRNAs in cancer. Annu. Rev. Pathol. 2009, 4, 199–227. [Google Scholar]
- SiamiGorji, S.; Jorjani, I.; Tahamtan, A.; Moradi, A. Effects of microRNAs polymorphism in cancer progression. Med. J. Islamic Republic Iran 2020, 34, 3. [Google Scholar] [CrossRef]
- Backes, C.; Meese, E.; Keller, A. Specific miRNA disease biomarkers in blood, serum and plasma: Challenges and prospects. Mol. Diagn. Ther. 2016, 20, 509–518. [Google Scholar] [CrossRef] [PubMed]
- Hayes, J.; Peruzzi, P.P.; Lawler, S. MicroRNAs in cancer: Biomarkers, functions and therapy. Trends Mol. Med. 2014, 20, 460–469. [Google Scholar] [CrossRef] [PubMed]
- Du, W.; Ma, X.-L.; Zhao, C.; Liu, T.; Du, Y.-L.; Kong, W.-Q.; Wei, B.-L.; Yu, J.-Y.; Li, Y.-Y.; Huang, J.-W. Associations of single nucleotide polymorphisms in miR-146a, miR-196a, miR-149 and miR-499 with colorectal cancer susceptibility. Asian Pac. J. Cancer Prev. 2014, 15, 1047–1055. [Google Scholar] [CrossRef]
- Vinci, S.; Gelmini, S.; Pratesi, N.; Conti, S.; Malentacchi, F.; Simi, L.; Pazzagli, M.; Orlando, C. Genetic variants in miR-146a, miR-149, miR-196a2, miR-499 and their influence on relative expression in lung cancers. Clin. Chem. Lab. Med. (CCLM) 2011, 49, 2073–2080. [Google Scholar] [CrossRef]
- Bodal, V.K.; Sangwan, S.; Bal, M.S.; Kaur, M.; Sharma, S.; Kaur, B. Association between microrna 146a and microrna 196a2 genes polymorphism and breast cancer risk in North Indian women. Asian Pac. J. Cancer Prev. APJCP 2017, 18, 2345. [Google Scholar]
- Zheng, L.; Zhuang, C.; Zhao, J.; Ming, L. Functional miR-146a, miR-149, miR-196a2 and miR-499 polymorphisms and the susceptibility to hepatocellular carcinoma: An updated meta-analysis. Clin. Res. Hepatol. Gastroenterol. 2017, 41, 664–676. [Google Scholar] [CrossRef]
- Zhang, L.; Liu, Q.; Wang, F. Association between miR-149 gene rs2292832 polymorphism and risk of gastric cancer. Arch. Med. Res. 2018, 49, 270–277. [Google Scholar] [CrossRef]
- Zhu, L.; Chu, H.; Gu, D.; Ma, L.; Shi, D.; Zhong, D.; Tong, N.; Zhang, Z.; Wang, M. A functional polymorphism in miRNA-196a2 is associated with colorectal cancer risk in a Chinese population. DNA Cell Biol. 2012, 31, 350–354. [Google Scholar] [CrossRef]
- Bray, C.; Bell, L.N.; Liang, H.; Collins, D.; Yale, S.H. Colorectal cancer screening. WMJ 2017, 116, 27–33. [Google Scholar]
- Hrovatin, K.; Kunej, T. Classification of miRNA-related sequence variations. Epigenomics 2018, 10, 463–481. [Google Scholar] [CrossRef] [PubMed]
- Hezova, R.; Kovarikova, A.; Bienertova-Vasku, J.; Sachlova, M.; Redova, M.; Vasku, A.; Svoboda, M.; Radova, L.; Kiss, I.; Vyzula, R. Evaluation of SNPs in miR-196-a2, miR-27a and miR-146a as risk factors of colorectal cancer. World J. Gastroenterol. WJG 2012, 18, 2827. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Liu, Y.-f.; Gan, Y. Lack of association between miR-149 C> T polymorphism and cancer susceptibility: A meta-analysis based on 4677 cases and 4830 controls. Mol. Biol. Rep. 2012, 39, 8749–8753. [Google Scholar] [CrossRef] [PubMed]
- Kupcinskas, J.; Bruzaite, I.; Juzenas, S.; Gyvyte, U.; Jonaitis, L.; Kiudelis, G.; Skieceviciene, J.; Leja, M.; Pauzas, H.; Tamelis, A. Lack of association between miR-27a, miR-146a, miR-196a-2, miR-492 and miR-608 gene polymorphisms and colorectal cancer. Sci. Rep. 2014, 4, 5993. [Google Scholar] [CrossRef]
- Dikaiakos, P.; Gazouli, M.; Rizos, S.; Zografos, G.; Theodoropoulos, G.E. Evaluation of genetic variants in miRNAs in patients with colorectal cancer. Cancer Biomark. 2015, 15, 157–162. [Google Scholar] [CrossRef]
- Feng, Y.; Duan, F.; Song, C.; Zhao, X.; Dai, L.; Cui, S. Systematic evaluation of cancer risk associated with rs2292832 in miR-149 and rs895819 in miR-27a: A comprehensive and updated meta-analysis. Oncotarget 2016, 7, 22368. [Google Scholar] [CrossRef] [PubMed]
- Ranjbar, R.; Chaleshi, V.; Aghdaei, H.A.; Morovvati, S. Investigating the association between miR-608 rs4919510 and miR-149 rs2292832 with Colorectal Cancer in Iranian Population. Microrna 2018, 7, 100–106. [Google Scholar] [CrossRef]
- Soltanian, A.R.; Hosseini, B.; Mahjub, H.; Bahreini, F.; Ehsan, N.M.; Ghaffari, M.E. Association between rs11614913 polymorphism of the MiR-196-a2 gene and colorectal cancer in the presence of departure from hardy-weinberg equilibrium. Cell J. (Yakhteh) 2021, 23, 313. [Google Scholar]
- Xu, L.; Tang, W. Associations of polymorphisms in mir-196a2, mir-146a and mir-149 with colorectal cancer risk: A meta-analysis. Pathol. Oncol. Res. 2016, 22, 261–267. [Google Scholar] [CrossRef]
- Choupani, J.; Nariman-Saleh-Fam, Z.; Saadatian, Z.; Ouladsahebmadarek, E.; Masotti, A.; Bastami, M. Association of mir-196a-2 rs11614913 and mir-149 rs2292832 polymorphisms with risk of cancer: An updated meta-analysis. Front. Genet. 2019, 10, 186. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Li, Y.; Zhu, L.J.; Zhou, R.M.; Jin, W.; Guo, X.Q.; Wang, C.M.; Chen, Z.F.; Liu, W. A functional polymorphism rs11614913 in microRNA-196a2 is associated with an increased risk of colorectal cancer although not with tumor stage and grade. Biomed. Rep. 2013, 1, 737–742. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Sun, L.Y.; Chen, L.L.; Zheng, H.Q.; Zhang, Q.F. A variant in microRNA-196a2 is not associated with susceptibility to and progression of colorectal cancer in Chinese. Intern. Med. J. 2012, 42, e115–e119. [Google Scholar] [CrossRef] [PubMed]
- Clocchiatti, A.; Cora, E.; Zhang, Y.; Dotto, G.P. Sexual dimorphism in cancer. Nat. Rev. Cancer 2016, 16, 330–339. [Google Scholar] [CrossRef] [PubMed]
- Favoriti, P.; Carbone, G.; Greco, M.; Pirozzi, F.; Pirozzi, R.E.M.; Corcione, F. Worldwide burden of colorectal cancer: A review. Updates Surg. 2016, 68, 7–11. [Google Scholar] [CrossRef]
- Yang, Y.; Wang, G.; He, J.; Ren, S.; Wu, F.; Zhang, J.; Wang, F. Gender differences in colorectal cancer survival: A meta-analysis. Int. J. Cancer 2017, 141, 1942–1949. [Google Scholar] [CrossRef]
- Schmuck, R.; Gerken, M.; Teegen, E.-M.; Krebs, I.; Klinkhammer-Schalke, M.; Aigner, F.; Pratschke, J.; Rau, B.; Benz, S. Gender comparison of clinical, histopathological, therapeutic and outcome factors in 185,967 colon cancer patients. Langenbeck’s Arch. Surg. 2020, 405, 71–80. [Google Scholar] [CrossRef]
- Li, L.; Liu, T.; Li, Z.; Zhang, L.; Zhang, Z. The miR-149 rs2292832 T/C polymorphism may decrease digestive cancer susceptibility: An updated meta-analysis. Int. J. Clin. Exp. Med. 2015, 8, 15351. [Google Scholar] [PubMed]
- Zhang, M.W.; Jin, M.J.; Yu, Y.X.; Zhang, S.C.; Liu, B.; Jiang, X.; Pan, Y.F.; Li, Q.L.; Ma, X.Y.; Chen, K. Associations of lifestyle-related factors, hsa-miR-149 and hsa-miR-605 gene polymorphisms with gastrointestinal cancer risk. Mol. Carcinog. 2012, 51, E21–E31. [Google Scholar] [CrossRef]
- He, B.; Pan, Y.; Xu, Y.; Deng, Q.; Sun, H.; Gao, T.; Wang, S. Associations of polymorphisms in microRNAs with female breast cancer risk in Chinese population. Tumor Biol. 2015, 36, 4575–4582. [Google Scholar] [CrossRef]
- Chen, K.; Yan, Z.; Dong, X.; Liang, Y.; Yao, Y.; Zhang, S.; Liu, W.; Li, C.; Yao, Y.; Shi, L. Genetic Polymorphisms in microRNA Genes Targeting PI3K/Akt Signal Pathway Modulate Cervical Cancer Susceptibility in a Chinese Population. Front. Genet. 2022, 13, 856505. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Ma, Y.-L.; Zhang, P.; Yang, J.-J.; Chen, H.-Q.; Liu, Z.-H.; Peng, J.-Y.; Zhou, Y.-K.; Qin, H.-L. A genetic variant in microRNA-196a2 is associated with increased cancer risk: A meta-analysis. Mol. Biol. Rep. 2012, 39, 269–275. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Zheng, L.; Liu, S.; Yin, J.; Wang, L.; Wang, X.; Shi, Y.; Shao, A.; Tang, W.; Ding, G. MiR-196a2 rs11614913 T> C polymorphism and risk of esophageal cancer in a Chinese population. Hum. Immunol. 2013, 74, 1199–1205. [Google Scholar] [CrossRef] [PubMed]
Polymorphisms | Sequence of Primers | PCR Products | Restriction Enzymes | Restriction Fragments |
---|---|---|---|---|
miR-149 T>C (rs2292832) | F: TGTCTTCACTCCCGTGCTTGTCC R: TGAGGCCCGAAACACCCGTA | 254 bp | PvuII | T allele: 254 bp C allele: 196 bp + 60 bp |
miR-196a2 C>T (rs11614913) | F: CCCCTTCCCTTCTCCTCCAGATA R: CGAAAACCGACTGATGTAACTCCG | 149 bp | MspI | C allele: 149 bp T allele: 125 bp |
Characteristics | Patients N = 120 (%) | Controls N = 125 (%) | p-Values |
---|---|---|---|
Gender | |||
Male | 68 (56.7%) | 55 (44%) | 0.259 |
Female | 52 (43.3%) | 70 (56%) | |
Age | |||
Age interval | 35–84 | 32–82 | 0.152 |
Mean | 63 ± 10.1 | 60.9 ± 11.5 | |
Histological Grade | |||
G1 | 14 (11.7%) | ||
G2 | 68 (56.7%) | ||
G3 | 33 (27.5%) | ||
G4 | 5 (4.2%) | ||
Tumor Stage | |||
T1 | 14 (11.7%) | ||
T2 | 19 (15.8%) | ||
T3 | 76 (63.3%) | ||
T4 | 11 (9.2%) | ||
Smoking Status | |||
Smokers | 35 (29.2%) | 58 (46.4%) | 0.554 |
Non-Smokers | 77 (64.2%) | 61 (48.8%) | |
Unknown | 8 (6.6%) | 6 (4.8%) | |
Alcohol consumption | |||
Yes | 32 (26.7%) | 41 (32.8%) | 0.612 |
No | 80 (66.7%) | 79 (63.2%) | |
Unknown | 8 (6.6%) | 5 (4%) |
miR-149 T>C | Cases N = 120 (%) | Controls N = 125 (%) | OR (95% CI) | p-Values |
---|---|---|---|---|
Genotype | ||||
TT | 53 (44.2) | 49 (39.2) | 1 | - |
TC | 39 (32.5) | 55 (44) | 0.66 (0.37–1.15) | 0.142 |
CC | 28 (23.3) | 21 (16.8) | 1.23 (0.62–2.45) | 0.55 |
Dominant model | ||||
TT | 53 (44.2) | 49 (39.2) | 1 | - |
TC+CC | 67 (55.8) | 76 (60.8) | 1.23 (0.74–2.04) | 0.43 |
Recessive model | ||||
TT+TC | 92 (76.7) | 104 (83.2) | 1 | - |
CC | 28 (23.3) | 21 (16.8) | 0.66 (0.35–1.25) | 0.201 |
Allele | ||||
T | 145 (60.4) | 153 (61.2) | 1 | - |
C | 95 (39.6) | 97 (38.8) | 1.03 (0.72–1.49) | 0.859 |
miR-196a2 C>T | Cases | Controls | OR (95% CI) | p-Values |
N = 120 (%) | N = 125 (%) | |||
Genotype | ||||
CC | 39 (32.5) | 47 (37.6) | 1 | - |
CT | 49 (40.8) | 48 (38.4) | 1.23 (0.69–2.20) | 0.485 |
TT | 32 (26.7) | 30 (24) | 1.29 (0.67–2.47) | 0.452 |
Dominant model | ||||
CC | 39 (32.5) | 47 (37.6) | 1 | - |
CT+TT | 81 (67.5) | 78 (62.4) | 1.25 (0.74–2.12) | 0.403 |
Recessive model | ||||
CC+CT | 88 (73.3) | 95 (76) | 1 | - |
TT | 32 (26.7) | 30 (24) | 1.52 (0.65–2.05) | 0.631 |
Allele | ||||
C | 127 (52.9) | 142 (56.8) | 1 | - |
T | 113 (47.1) | 108 (43.2) | 1.17 (0.82–1.67) | 0.388 |
Genotypes | Cases N = 68 (%) | Controls N = 55 (%) | OR (95% CI) | p-Values |
---|---|---|---|---|
Males | ||||
TT | 30 (44.1) | 25 (45.5) | 1 | - |
TC | 25 (36.8) | 21 (38.2) | 0.99 (0.45–2.18) | 0.984 |
CC | 13 (19.1) | 9 (16.3) | 1.20 (0.44–3.28) | 0.717 |
N = 52 (%) | N = 70 (%) | |||
Females | ||||
TT | 23 (44.2) | 24 (34.3) | 1 | - |
TC | 14 (26.9) | 34 (48.6) | 0.43 (0.19–1.01) | 0.048 |
CC | 15 (28.9) | 12 (17.1) | 1.30 (0.50–3.37) | 0.583 |
Age | Cases | Controls | ||
N = 48 (%) | N = 50 (%) | |||
≤60 | ||||
TT | 12 (25) | 8 (16) | 1 | - |
TC | 14 (29.2) | 24 (48) | 0.39 (0.13–1.18) | 0.092 |
CC | 22 (45.8) | 18 (36) | 0.82 (0.27–2.42) | 0.713 |
Cases | Controls | |||
N = 72 (%) | N = 75 (%) | |||
>60 | ||||
TT | 16 (22.2) | 13 (17.4) | 1 | 1 |
TC | 25 (34.7) | 31 (41.3) | 0.66 (0.27–1.61) | 0.357 |
CC | 31 (43.1) | 31 (41.3) | 0.81 (0.34–1.97) | 0.645 |
Genotypes | Cases, N = 68 (%) | Controls, N = 55 (%) | OR (95% CI) | p-Values |
---|---|---|---|---|
Males | ||||
CC | 28 (41.2) | 19 (34.5) | 1 | - |
CT | 24 (35.3) | 25 (45.5) | 0.65 (0.29–1.46) | 0.298 |
TT | 16 (23.5) | 11 (20) | 0.99 (0.38–2.56) | 0.979 |
Cases, N = 52 (%) | Controls, N = 70 (%) | |||
Females | ||||
CC | 11 (21.1) | 28 (40) | 1 | - |
CT | 25 (48.1) | 23 (32.9) | 2.77 (1.13–6.79) | 0.025 |
TT | 16 (30.8) | 19 (27.1) | 2.14 (0.82–5.62) | 0.118 |
Age | Cases, N = 47 (%) | Controls, N = 80 (%) | ||
≤60 | ||||
CC | 15 (31.9) | 27 (33.7) | 1 | - |
CT | 21 (44.7) | 32 (40) | 1.18 (0.51–2.73) | 0.697 |
TT | 11 (23.4) | 21 (26.3) | 0.94 (0.36–2.47) | 0.905 |
Cases, N = 73 (%) | Controls, N= 45 (%) | |||
>60 | ||||
CC | 24 (32.8) | 20 (44.4) | 1 | - |
CT | 28 (38.4) | 16 (35.6) | 1.46 (0.62–3.43) | 0.386 |
TT | 21 (28.8) | 9 (20) | 1.94 (0.73–5.19) | 0.181 |
miR-149 T>C Genotypes | Smokers N = 35 (%) | Non-Smokers N = 77 (%) | OR (95% CI) | p-Values |
---|---|---|---|---|
TT | 14 (40) | 36 (46.8) | 1 | - |
TC | 11 (31.4) | 24 (31.2) | 1.18 (0.46–3.03) | 0.733 |
CC | 10 (28.6) | 17 (22) | 1.51 (0.56–4.10) | 0.414 |
Alcohol drinkers N = 32 (%) | Non-drinkers N = 80 (%) | |||
TT | 18 (56.3) | 32 (40) | 1 | - |
TC | 8 (25) | 27 (33.8) | 0.53 (0.19–1.40) | 0.196 |
CC | 6 (18.7) | 21 (26.2) | 0.51 (0.17–1.48) | 0.213 |
miR-196a2 C>T Genotypes | Smokers N = 35 (%) | Non-smokers N = 77 (%) | ||
CC | 15 (42.8) | 23 (29.8) | 1 | - |
CT | 10 (28.6) | 33 (42.9) | 0.47 (0.18–1.22) | 0.115 |
TT | 10 (28.6) | 21 (27.3) | 0.73 (0.27–1.98) | 0.535 |
Alcohol drinkers N = 32 (%) | Non-drinkers N = 80 (%) | |||
CC | 14 (43.8) | 24 (30) | 1 | - |
CT | 8 (25) | 35 (43.8) | 0.39 (0.14–1.08) | 0.066 |
TT | 10 (31.3) | 21 (26.3) | 0.82 (0.30–2.22) | 0.691 |
TT | TC | CC | p Values | |
---|---|---|---|---|
N (%) | N (%) | N (%) | ||
Tumor grade | ||||
G1 | 7 (50) | 4 (28.6) | 3 (21.4) | 0.998 |
G2 | 29 (42.6) | 23 (33.8) | 16 (23.6) | |
G3 | 15 (45.5) | 10 (30.3) | 8 (24.2) | |
G4 | 2 (40) | 2 (40) | 1 (20) | |
Tumor stage | ||||
T1 | 4 (28.6) | 4 (28.6) | 6 (42.8) | 0.179 |
T2 | 11 (57.9) | 5 (26.3) | 3 (15.8) | |
T3 | 32 (42.1) | 29 (38.2) | 15 (19.7) | |
T4 | 6 (54.5) | 1 (9.1) | 4 (36.4) |
CC | CT | TT | p Values | |
---|---|---|---|---|
N (%) | N (%) | N (%) | ||
Tumor grade | ||||
G1 | 2 (14.2) | 9 (64.3) | 3 (21.5) | 0.149 |
G2 | 28 (41.2) | 29 (42.7) | 11 (16.1) | |
G3 | 12 (36.4) | 13 (39.4) | 8 (24.2) | |
G4 | 1 (20) | 1 (20) | 3 (60) | |
Tumor stage | ||||
T1 | 6 (42.8) | 4 (28.6) | 4 (28.6) | 0.034 |
T2 | 2 (10.5) | 7 (36.8) | 10 (52.7) | |
T3 | 36 (47.4) | 27 (35.5) | 13 (17.1) | |
T4 | 4 (36.3) | 3 (27.2) | 4 (36.4) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bayramov, B.; Bayramov, N.; Aslanov, H.; Karimova, N.; Gasimov, K.; Shahmuradov, I.; Reißfelder, C.; Yagublu, V. Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study. Biomedicines 2023, 11, 2341. https://doi.org/10.3390/biomedicines11092341
Bayramov B, Bayramov N, Aslanov H, Karimova N, Gasimov K, Shahmuradov I, Reißfelder C, Yagublu V. Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study. Biomedicines. 2023; 11(9):2341. https://doi.org/10.3390/biomedicines11092341
Chicago/Turabian StyleBayramov, Bayram, Nuru Bayramov, Hazi Aslanov, Nigar Karimova, Karim Gasimov, Ilham Shahmuradov, Christoph Reißfelder, and Vugar Yagublu. 2023. "Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study" Biomedicines 11, no. 9: 2341. https://doi.org/10.3390/biomedicines11092341
APA StyleBayramov, B., Bayramov, N., Aslanov, H., Karimova, N., Gasimov, K., Shahmuradov, I., Reißfelder, C., & Yagublu, V. (2023). Association of miR-149 T>C and miR-196a2 C>T Polymorphisms with Colorectal Cancer Susceptibility: A Case-Control Study. Biomedicines, 11(9), 2341. https://doi.org/10.3390/biomedicines11092341