Glucose, Insulin and Oxygen Modulate Expression of Serotonin-Regulating Genes in Human First-Trimester Trophoblast Cell Line ACH-3P
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Glucose and Insulin Treatments
2.3. RNA Extraction and Gene Expression Analysis
2.4. Analysis of SERT Methylation by Bisulfite Pyrosequencing
2.5. Statistics
3. Results
3.1. Effect of Glucose on the Expression of Serotonin-Regulating Genes
3.2. Effect of Insulin on the Expression of Serotonin-Regulating Genes
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Appendix B
Gene Symbol | Gene Name | Primer Sequence (5′–3′) | Amplicon (bp) | Source |
---|---|---|---|---|
SERT/ SLC6A4 | serotonin transporter | f: AGATCCTGAGACGCATTGCT r: AACAGAGCGAAACTCCGAAA | 504 | [33] |
TPH1 | tryptophan hydroxylase 1 | f: TGCAAAGGAGAAGATGAGAGAATTTAC r: CTGGTTATGCTCTTGGTGTCTTTC | 114 | [33] |
MAOA | monoamine oxidase A | f: GAGCGGCTACATGGAAGGG r: TCACCTTCCCGAGACCATTTA | 77 | [31] |
YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | f: CCGTTACTTGGCTGAGGTTG r: AGTTAAGGGCCAGACCCAGT | 143 | [32] |
ACTB | actin beta | f: TCCCTGGAGAAGAGCTACG r: GTAGTTTCGTGG ATGCCACA | 131 | [34] |
CK7 | cytokeratin 7 | f: CCGTGCGCTCTGCCTATGGGG r: GCTCCAGAAACCGCACCTTGTCGAT | 192 | [35] |
Region | Primer Sequence (5′–3′) | Amplicon (bp) | Source |
---|---|---|---|
promoter | f *: GGTTTTTAGGAGAGTAGGGAGTATATAGTT r: AAAAATCCTAACTTTCCTACTCTTTAACTT s: AAACTACACAAAAAAACAAAT | 203 | [60] |
intron 1 | f: GGGGAGGGGGATAGAAT r *: ACAACACTTTACTCAAAACCCTCTTTA s: GGGGAGGGGGATAGAAT | 273 | / |
Intron 1 | f: TTTTAAAGAGGGTTTTGAGTAAAGTG r *: TTTATATCAACCAAAACTCTCCCTTTACAT s: GGGTTTTGAGTAAAGTGT | 150 | / |
CpG Site | Location | GRCh38 Coordinates | NG_011747.2 Coordinates |
---|---|---|---|
1 | promoter | 30236157 | 4780 |
2 | promoter | 30236142 | 4795 |
3 | promoter | 30236126 | 4811 |
4 | promoter | 30236121 | 4816 |
5 | promoter | 30236102 | 4835 |
6 | promoter | 30236091 | 4846 |
7 | promoter | 30236089 | 4848 |
8 | promoter | 30236084 | 4853 |
9 | promoter | 30236072 | 4865 |
10 | intron 1 | 30235532 | 5405 |
11 | intron 1 | 30235527 | 5410 |
12 | intron 1 | 30235519 | 5418 |
13 | intron 1 | 30235512 | 5425 |
14 | intron 1 | 30235504 | 5433 |
15 | intron 1 | 30235490 | 5447 |
16 | intron 1 | 30235482 | 5455 |
17 | intron 1 | 30235475 | 5462 |
18 | intron 1 | 30235472 | 5465 |
19 | intron 1 | 30235457 | 5480 |
20 | intron 1 | 30235272 | 5665 |
21 | intron 1 | 30235247 | 5690 |
22 | intron 1 | 30235203 | 5734 |
23 | intron 1 | 30235201 | 5736 |
References
- Berger, M.; Gray, J.A.; Roth, B.L. The Expanded Biology of Serotonin. Annu. Rev. Med. 2009, 60, 355–366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Galen, K.A.; Ter Horst, K.W.; Serlie, M.J. Serotonin, Food Intake, and Obesity. Obes. Rev. Off. J. Int. Assoc. Study Obes. 2021, 22, e13210. [Google Scholar] [CrossRef]
- Kim, H.; Toyofuku, Y.; Lynn, F.C.; Chak, E.; Uchida, T.; Mizukami, H.; Fujitani, Y.; Kawamori, R.; Miyatsuka, T.; Kosaka, Y.; et al. Serotonin Regulates Pancreatic β-Cell Mass during Pregnancy. Nat. Med. 2010, 16, 804–808. [Google Scholar] [CrossRef] [PubMed]
- Ohara-Imaizumi, M.; Kim, H.; Yoshida, M.; Fujiwara, T.; Aoyagi, K.; Toyofuku, Y.; Nakamichi, Y.; Nishiwaki, C.; Okamura, T.; Uchida, T.; et al. Serotonin Regulates Glucose-Stimulated Insulin Secretion from Pancreatic β Cells during Pregnancy. Proc. Natl. Acad. Sci. USA 2013, 110, 19420–19425. [Google Scholar] [CrossRef] [Green Version]
- McIntyre, H.D.; Catalano, P.; Zhang, C.; Desoye, G.; Mathiesen, E.R.; Damm, P. Gestational Diabetes Mellitus. Nat. Rev. Dis. Primer 2019, 5, 47. [Google Scholar] [CrossRef]
- Metzger, B.E.; Gabbe, S.G.; Persson, B.; Lowe, L.P.; Dyer, A.R.; Oats, J.J.N.; Buchanan, T.A. International Association of Diabetes and Pregnancy Study Groups Recommendations on the Diagnosis and Classification of Hyperglycemia in Pregnancy: Response to Weinert. Diabetes Care 2010, 33, e98. [Google Scholar] [CrossRef] [Green Version]
- Bandres-Meriz, J.; Dieberger, A.M.; Hoch, D.; Pöchlauer, C.; Bachbauer, M.; Glasner, A.; Niedrist, T.; van Poppel, M.N.M.; Desoye, G. Maternal Obesity Affects the Glucose-Insulin Axis During the First Trimester of Human Pregnancy. Front. Endocrinol. 2020, 11, 566673. [Google Scholar] [CrossRef] [PubMed]
- Fröhlich, J.D.; Huppertz, B.; Abuja, P.M.; König, J.; Desoye, G. Oxygen Modulates the Response of First-Trimester Trophoblasts to Hyperglycemia. Am. J. Pathol. 2012, 180, 153–164. [Google Scholar] [CrossRef]
- O’Tierney-Ginn, P.; Presley, L.; Myers, S.; Catalano, P. Placental Growth Response to Maternal Insulin in Early Pregnancy. J. Clin. Endocrinol. Metab. 2015, 100, 159–165. [Google Scholar] [CrossRef] [Green Version]
- Li, H.-P.; Chen, X.; Li, M.-Q. Gestational Diabetes Induces Chronic Hypoxia Stress and Excessive Inflammatory Response in Murine Placenta. Int. J. Clin. Exp. Pathol. 2013, 6, 650–659. [Google Scholar]
- Fernandez-Twinn, D.S.; Gascoin, G.; Musial, B.; Carr, S.; Duque-Guimaraes, D.; Blackmore, H.L.; Alfaradhi, M.Z.; Loche, E.; Sferruzzi-Perri, A.N.; Fowden, A.L.; et al. Exercise Rescues Obese Mothers’ Insulin Sensitivity, Placental Hypoxia and Male Offspring Insulin Sensitivity. Sci. Rep. 2017, 7, 44650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burton, G.J.; Fowden, A.L. The Placenta: A Multifaceted, Transient Organ. Philos. Trans. R. Soc. B Biol. Sci. 2015, 370, 20140066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodesch, F.; Simon, P.; Donner, C.; Jauniaux, E. Oxygen Measurements in Endometrial and Trophoblastic Tissues during Early Pregnancy. Obstet. Gynecol. 1992, 80, 283–285. [Google Scholar] [PubMed]
- Jauniaux, E.; Watson, A.L.; Hempstock, J.; Bao, Y.-P.; Skepper, J.N.; Burton, G.J. Onset of Maternal Arterial Blood Flow and Placental Oxidative Stress: A Possible Factor in Human Early Pregnancy Failure. Am. J. Pathol. 2000, 157, 2111–2122. [Google Scholar] [CrossRef]
- Genbacev, O.; Joslin, R.; Damsky, C.H.; Polliotti, B.M.; Fisher, S.J. Hypoxia Alters Early Gestation Human Cytotrophoblast Differentiation/Invasion in Vitro and Models the Placental Defects That Occur in Preeclampsia. J. Clin. Investig. 1996, 97, 540–550. [Google Scholar] [CrossRef]
- Desoye, G. The Human Placenta in Diabetes and Obesity: Friend or Foe? The 2017 Norbert Freinkel Award Lecture. Diabetes Care 2018, 41, 1362–1369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Desoye, G.; Wells, J.C.K. Pregnancies in Diabetes and Obesity: The Capacity-Load Model of Placental Adaptation. Diabetes 2021, 70, 823–830. [Google Scholar] [CrossRef]
- Perić, M.; Bečeheli, I.; Čičin-Šain, L.; Desoye, G.; Štefulj, J. Serotonin System in the Human Placenta—The Knowns and Unknowns. Front. Endocrinol. 2022, 13, 1061317. [Google Scholar] [CrossRef]
- Oufkir, T.; Arseneault, M.; Sanderson, J.T.; Vaillancourt, C. The 5-HT2A Serotonin Receptor Enhances Cell Viability, Affects Cell Cycle Progression and Activates MEK–ERK1/2 and JAK2–STAT3 Signalling Pathways in Human Choriocarcinoma Cell Lines. Placenta 2010, 31, 439–447. [Google Scholar] [CrossRef]
- Bertrand, C.; St-Louis, J. Reactivities to Serotonin and Histamine in Umbilical and Placental Vessels during the Third Trimester after Normotensive Pregnancies and Pregnancies Complicated by Preeclampsia. Am. J. Obstet. Gynecol. 1999, 180, 650–659. [Google Scholar] [CrossRef]
- Klempan, T.; Hudon-Thibeault, A.-A.; Oufkir, T.; Vaillancourt, C.; Sanderson, J.T. Stimulation of Serotonergic 5-HT2A Receptor Signaling Increases Placental Aromatase (CYP19) Activity and Expression in BeWo and JEG-3 Human Choriocarcinoma Cells. Placenta 2011, 32, 651–656. [Google Scholar] [CrossRef]
- Bonnin, A.; Levitt, P. Fetal, Maternal and Placental Sources of Serotonin and New Implications for Developmental Programming of the Brain. Neuroscience 2011, 197, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Côté, F.; Fligny, C.; Bayard, E.; Launay, J.-M.; Gershon, M.D.; Mallet, J.; Vodjdani, G. Maternal Serotonin Is Crucial for Murine Embryonic Development. Proc. Natl. Acad. Sci. USA 2007, 104, 329–334. [Google Scholar] [CrossRef] [Green Version]
- Mao, J.; Kinkade, J.A.; Bivens, N.J.; Roberts, R.M.; Rosenfeld, C.S. Placental Changes in the Serotonin Transporter (Slc6a4) Knockout Mouse Suggest a Role for Serotonin in Controlling Nutrient Acquisition. Placenta 2021, 115, 158–168. [Google Scholar] [CrossRef] [PubMed]
- Rosenfeld, C.S. Placental Serotonin Signaling, Pregnancy Outcomes, and Regulation of Fetal Brain Development†. Biol. Reprod. 2020, 102, 532–538. [Google Scholar] [CrossRef] [PubMed]
- Hiden, U.; Wadsack, C.; Prutsch, N.; Gauster, M.; Weiss, U.; Frank, H.-G.; Schmitz, U.; Fast-Hirsch, C.; Hengstschläger, M.; Pötgens, A.; et al. The First Trimester Human Trophoblast Cell Line ACH-3P: A Novel Tool to Study Autocrine/Paracrine Regulatory Loops of Human Trophoblast Subpopulations—TNF-α Stimulates MMP15 Expression. BMC Dev. Biol. 2007, 7, 137. [Google Scholar] [CrossRef] [Green Version]
- Tandl, V.; Hoch, D.; Bandres-Meriz, J.; Nikodijevic, S.; Desoye, G.; Majali-Martinez, A. Different Regulation of IRE1α and EIF2α Pathways by Oxygen and Insulin in ACH-3P Trophoblast Model. Reproduction 2021, 162, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Easton, Z.J.W.; Luo, X.; Li, L.; Regnault, T.R.H. The Impact of Hyperglycemia upon BeWo Trophoblast Cell Metabolic Function: A Multi-OMICS and Functional Metabolic Analysis. PLoS ONE 2023, 18, e0283118. [Google Scholar] [CrossRef]
- Wang, Z.; Wang, D.; Chen, J.; Long, T.; Zhong, C.; Li, Y. Effects of Glucose and Osmotic Pressure on the Proliferation and Cell Cycle of Human Chorionic Trophoblast Cells. Open Life Sci. 2022, 17, 1418–1428. [Google Scholar] [CrossRef]
- Song, S.H.; McIntyre, S.S.; Shah, H.; Veldhuis, J.D.; Hayes, P.C.; Butler, P.C. Direct Measurement of Pulsatile Insulin Secretion from the Portal Vein in Human Subjects. J. Clin. Endocrinol. Metab. 2000, 85, 4491–4499. [Google Scholar] [CrossRef]
- Sun, Y.; Zhang, J.; Yuan, Y.; Yu, X.; Shen, Y.; Xu, Q. Study of a Possible Role of the Monoamine Oxidase A (MAOA) Gene in Paranoid Schizophrenia among a Chinese Population. Am. J. Med. Genet. Part B Neuropsychiatr. Genet. Off. Publ. Int. Soc. Psychiatr. Genet. 2012, 159B, 104–111. [Google Scholar] [CrossRef] [PubMed]
- Baumann, M.; Körner, M.; Huang, X.; Wenger, F.; Surbek, D.; Albrecht, C. Placental ABCA1 and ABCG1 Expression in Gestational Disease: Pre-Eclampsia Affects ABCA1 Levels in Syncytiotrophoblasts. Placenta 2013, 34, 1079–1086. [Google Scholar] [CrossRef] [PubMed]
- Van Lelyveld, N.; Ter Linde, J.; Schipper, M.E.I.; Samsom, M. Regional Differences in Expression of TPH-1, SERT, 5-HT3 and 5-HT4 Receptors in the Human Stomach and Duodenum. Neurogastroenterol. Motil. 2007, 19, 342–348. [Google Scholar] [CrossRef]
- Métayé, T.; Menet, E.; Guilhot, J.; Kraimps, J.-L. Expression and Activity of g Protein-Coupled Receptor Kinases in Differentiated Thyroid Carcinoma. J. Clin. Endocrinol. Metab. 2002, 87, 3279–3286. [Google Scholar] [CrossRef] [PubMed]
- Barrett, H.L.; Kubala, M.H.; Romero, K.S.; Denny, K.J.; Woodruff, T.M.; McIntyre, H.D.; Callaway, L.K.; Nitert, M.D. Placental Lipases in Pregnancies Complicated by Gestational Diabetes Mellitus (GDM). PLoS ONE 2014, 9, e104826. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. MiRDeepFinder: A MiRNA Analysis Tool for Deep Sequencing of Plant Small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef]
- Blazevic, S.; Horvaticek, M.; Kesic, M.; Zill, P.; Hranilovic, D.; Ivanisevic, M.; Desoye, G.; Stefulj, J. Epigenetic Adaptation of the Placental Serotonin Transporter Gene (SLC6A4) to Gestational Diabetes Mellitus. PLoS ONE 2017, 12, e0179934. [Google Scholar] [CrossRef] [Green Version]
- Motulsky, H.J.; Brown, R.E. Detecting Outliers When Fitting Data with Nonlinear Regression—A New Method Based on Robust Nonlinear Regression and the False Discovery Rate. BMC Bioinform. 2006, 7, 123. [Google Scholar] [CrossRef] [Green Version]
- Gonçalves, P.; Araújo, J.R.; Martel, F. The Effect of High Glucose on SERT, the Human Plasmalemmal Serotonin Transporter. Nutr. Neurosci. 2008, 11, 244–250. [Google Scholar] [CrossRef]
- Li, Y.; Hadden, C.; Singh, P.; Mercado, C.P.; Murphy, P.; Dajani, N.K.; Lowery, C.L.; Roberts, D.J.; Maroteaux, L.; Kilic, F. GDM-Associated Insulin Deficiency Hinders the Dissociation of SERT from ERp44 and down-Regulates Placental 5-HT Uptake. Proc. Natl. Acad. Sci. USA 2014, 111, E5697–E5705. [Google Scholar] [CrossRef] [Green Version]
- Gorczyca, L.; Du, J.; Bircsak, K.M.; Wen, X.; Vetrano, A.M.; Aleksunes, L.M. Low Oxygen Tension Differentially Regulates the Expression of Placental Solute Carriers and ABC Transporters. FEBS Lett. 2021, 595, 811–827. [Google Scholar] [CrossRef] [PubMed]
- Eddahibi, S.; Fabre, V.; Boni, C.; Martres, M.P.; Raffestin, B.; Hamon, M.; Adnot, S. Induction of Serotonin Transporter by Hypoxia in Pulmonary Vascular Smooth Muscle Cells. Circ. Res. 1999, 84, 329–336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bengel, D.; Heils, A.; Petri, S.; Seemann, M.; Glatz, K.; Andrews, A.; Murphy, D.L.; Lesch, K.P. Gene Structure and 5’-Flanking Regulatory Region of the Murine Serotonin Transporter. Brain Res. Mol. Brain Res. 1997, 44, 286–292. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Deng, R.; Yang, X.; Xu, W.; Liu, Y.; Li, F.; Zhang, J.; Tang, H.; Ji, X.; Bi, Y.; et al. Glucose Potentiates β-Cell Function by Inducing Tph1 Expression in Rat Islets. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2017, 31, 5342–5355. [Google Scholar] [CrossRef] [Green Version]
- Ciuclan, L.; Hussey, M.J.; Burton, V.; Good, R.; Duggan, N.; Beach, S.; Jones, P.; Fox, R.; Clay, I.; Bonneau, O.; et al. Imatinib Attenuates Hypoxia-Induced Pulmonary Arterial Hypertension Pathology via Reduction in 5-Hydroxytryptamine through Inhibition of Tryptophan Hydroxylase 1 Expression. Am. J. Respir. Crit. Care Med. 2013, 187, 78–89. [Google Scholar] [CrossRef]
- Lascu, A.; Ionică, L.N.; Buriman, D.G.; Merce, A.P.; Deaconu, L.; Borza, C.; Crețu, O.M.; Sturza, A.; Muntean, D.M.; Feier, H.B. Metformin and Empagliflozin Modulate Monoamine Oxidase-Related Oxidative Stress and Improve Vascular Function in Human Mammary Arteries. Mol. Cell. Biochem. 2022. [Google Scholar] [CrossRef]
- Sivasubramaniam, S.D.; Finch, C.C.; Billett, M.A.; Baker, P.N.; Billett, E.E. Monoamine Oxidase Expression and Activity in Human Placentae from Pre-Eclamptic and Normotensive Pregnancies. Placenta 2002, 23, 163–171. [Google Scholar] [CrossRef]
- Carrasco, G.; Cruz, M.A.; Dominguez, A.; Gallardo, V.; Miguel, P.; González, C. The Expression and Activity of Monoamine Oxidase A, but Not of the Serotonin Transporter, Is Decreased in Human Placenta from Pre-Eclamptic Pregnancies. Life Sci. 2000, 67, 2961–2969. [Google Scholar] [CrossRef]
- Balkovetz, D.F.; Tiruppathi, C.; Leibach, F.H.; Mahesh, V.B.; Ganapathy, V. Evidence for an Imipramine-Sensitive Serotonin Transporter in Human Placental Brush-Border Membranes. J. Biol. Chem. 1989, 264, 2195–2198. [Google Scholar] [CrossRef]
- Karahoda, R.; Horackova, H.; Kastner, P.; Matthios, A.; Cerveny, L.; Kucera, R.; Kacerovsky, M.; Duintjer Tebbens, J.; Bonnin, A.; Abad, C.; et al. Serotonin Homeostasis in the Materno-Foetal Interface at Term: Role of Transporters (SERT/SLC6A4 and OCT3/SLC22A3) and Monoamine Oxidase A (MAO-A) in Uptake and Degradation of Serotonin by Human and Rat Term Placenta. Acta Physiol. 2020, 229, e13478. [Google Scholar] [CrossRef]
- Paulmann, N.; Grohmann, M.; Voigt, J.P.; Bert, B.; Vowinckel, J.; Bader, M.; Skelin, M.; Jevšek, M.; Fink, H.; Rupnik, M.; et al. Intracellular Serotonin Modulates Insulin Secretion from Pancreatic β-Cells by Protein Serotonylation. PLoS Biol. 2009, 7, e1000229. [Google Scholar] [CrossRef] [Green Version]
- Farrelly, L.A.; Thompson, R.E.; Zhao, S.; Lepack, A.E.; Lyu, Y.; Bhanu, N.V.; Zhang, B.; Loh, Y.-H.E.; Ramakrishnan, A.; Vadodaria, K.C.; et al. Histone Serotonylation Is a Permissive Modification That Enhances TFIID Binding to H3K4me3. Nature 2019, 567, 535–539. [Google Scholar] [CrossRef] [PubMed]
- Maggiorani, D.; Manzella, N.; Edmondson, D.E.; Mattevi, A.; Parini, A.; Binda, C.; Mialet-Perez, J. Monoamine Oxidases, Oxidative Stress, and Altered Mitochondrial Dynamics in Cardiac Ageing. Oxid. Med. Cell. Longev. 2017, 2017, 3017947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Resta, J.; Santin, Y.; Roumiguié, M.; Riant, E.; Lucas, A.; Couderc, B.; Binda, C.; Lluel, P.; Parini, A.; Mialet-Perez, J. Monoamine Oxidase Inhibitors Prevent Glucose-Dependent Energy Production, Proliferation and Migration of Bladder Carcinoma Cells. Int. J. Mol. Sci. 2022, 23, 11747. [Google Scholar] [CrossRef] [PubMed]
- Bianco-Miotto, T.; Craig, J.M.; Gasser, Y.P.; van Dijk, S.J.; Ozanne, S.E. Epigenetics and DOHaD: From Basics to Birth and Beyond. J. Dev. Orig. Health Dis. 2017, 8, 513–519. [Google Scholar] [CrossRef] [PubMed]
- Majali-Martinez, A.; Weiss-Fuchs, U.; Miedl, H.; Forstner, D.; Bandres-Meriz, J.; Hoch, D.; Djelmis, J.; Ivanisevic, M.; Hiden, U.; Gauster, M.; et al. Type 1 Diabetes Mellitus and the First Trimester Placenta: Hyperglycemia-Induced Effects on Trophoblast Proliferation, Cell Cycle Regulators, and Invasion. Int. J. Mol. Sci. 2021, 22, 10989. [Google Scholar] [CrossRef]
- Weiss, U.; Cervar, M.; Puerstner, P.; Schmut, O.; Haas, J.; Mauschitz, R.; Arikan, G.; Desoye, G. Hyperglycaemia in Vitro Alters the Proliferation and Mitochondrial Activity of the Choriocarcinoma Cell Lines BeWo, JAR and JEG-3 as Models for Human First-Trimester Trophoblast. Diabetologia 2001, 44, 209–219. [Google Scholar] [CrossRef] [Green Version]
- Kwist, K.; Bridges, W.C.; Burg, K.J.L. The Effect of Cell Passage Number on Osteogenic and Adipogenic Characteristics of D1 Cells. Cytotechnology 2016, 68, 1661–1667. [Google Scholar] [CrossRef] [Green Version]
- Viau, M.; Lafond, J.; Vaillancourt, C. Expression of Placental Serotonin Transporter and 5-HT 2A Receptor in Normal and Gestational Diabetes Mellitus Pregnancies. Reprod. Biomed. Online 2009, 19, 207–215. [Google Scholar] [CrossRef]
- Devlin, A.M.; Brain, U.; Austin, J.; Oberlander, T.F. Prenatal Exposure to Maternal Depressed Mood and the MTHFR C677T Variant Affect SLC6A4 Methylation in Infants at Birth. PLoS ONE 2010, 5, e12201. [Google Scholar] [CrossRef] [Green Version]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Perić, M.; Horvatiček, M.; Tandl, V.; Bečeheli, I.; Majali-Martinez, A.; Desoye, G.; Štefulj, J. Glucose, Insulin and Oxygen Modulate Expression of Serotonin-Regulating Genes in Human First-Trimester Trophoblast Cell Line ACH-3P. Biomedicines 2023, 11, 1619. https://doi.org/10.3390/biomedicines11061619
Perić M, Horvatiček M, Tandl V, Bečeheli I, Majali-Martinez A, Desoye G, Štefulj J. Glucose, Insulin and Oxygen Modulate Expression of Serotonin-Regulating Genes in Human First-Trimester Trophoblast Cell Line ACH-3P. Biomedicines. 2023; 11(6):1619. https://doi.org/10.3390/biomedicines11061619
Chicago/Turabian StylePerić, Maja, Marina Horvatiček, Veronika Tandl, Ivona Bečeheli, Alejandro Majali-Martinez, Gernot Desoye, and Jasminka Štefulj. 2023. "Glucose, Insulin and Oxygen Modulate Expression of Serotonin-Regulating Genes in Human First-Trimester Trophoblast Cell Line ACH-3P" Biomedicines 11, no. 6: 1619. https://doi.org/10.3390/biomedicines11061619