Fast and Inexpensive Phenotyping and Genotyping Methods for Evaluation of Barley Mutant Population
Abstract
:1. Introduction
2. Results
2.1. Screening for Waxy Mutants from the TILLING Population to Evaluate the Efficiency of Mutant Isolation
2.2. Sequence Analysis of the Waxy Gene in the Isolated Mutants
2.3. Detection of a Mutation in the Waxy Gene by Cleavage of Heteroduplex DNA Using the Purified Recombinant CELI Endonuclease
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Mutagenesis
4.2. Iodine Staining
4.3. Genomic DNA Extraction
4.4. Amplification and Sequencing of the Waxy Gene Fragments
4.5. Cleavage of Heteroduplex DNA Using a Recombinant CELI Endonuclease
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hisano, H.; Sato, K. Genomic regions responsible for amenability to Agrobacterium-mediated transformation in barley. Sci. Rep. 2016, 6, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McCallum, C.M.; Comai, L.; Greene, E.A.; Henikoff, S. Targeted screening for induced mutations. Nat. Biotechnol. 2000, 18, 455–457. [Google Scholar] [CrossRef] [PubMed]
- Till, B.J.; Cooper, J.; Tai, T.H.; Colowit, P.; Greene, E.A.; Henikoff, S.; Comai, L. Discovery of chemically induced mutations in rice by TILLING. BMC Plant Biol. 2007, 11, 19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Till, B.J.; Reynolds, S.H.; Weil, C.; Springer, N.; Burtner, C.; Young, K.; Bowers, E.; Codomo, C.A.; Enns, L.C.; Odden, A.R.; et al. Discovery of induced point mutations in maize genes by TILLING. BMC Plant Biol. 2004, 4, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uauy, C.; Paraiso, F.; Colasuonno, P.; Tran, R.K.; Tsai, H.; Berardi, S.; Comai, L.; Dubcovsky, J. A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat. BMC Plant Biol. 2009, 9, 115. [Google Scholar] [CrossRef] [Green Version]
- Caldwell, D.G.; McCallum, N.; Shaw, P.; Muehlbauer, G.J.; Marshall, D.F.; Waugh, R. A structured mutant population for forward and reverse genetics in barley (Hordeum vulgare L.). Plant J. 2004, 40, 143–150. [Google Scholar] [CrossRef]
- Cooper, J.L.; Till, B.J.; Laport, R.G.; Darlow, M.C.; Kleffner, J.M.; Jamai, A.; El-Mellouki, T.; Liu, S.; Ritchie, R.; Nielsen, N.; et al. TILLING to detect induced mutations in soybean. BMC Plant Biol. 2008, 24, 9. [Google Scholar] [CrossRef] [Green Version]
- Minoia, S.; Petrozza, A.; D’Onofrio, O.; Prion, F.; Mosca, G.; Sozio, G.; Cellini, F.; Bendahmane, A.; Carriero, F. A new mutant genetic resource for tomato crop improvement by TILLING technology. BMC Res. Notes. 2010, 12, 69. [Google Scholar] [CrossRef] [Green Version]
- Winkler, S.; Schwabedissen, A.; Backasch, D.; Bökel, C.; Seidel, C.; Bönisch, S.; Fürthauer, M.; Kuhrs, A.; Cobreros, L.; Brand, M.; et al. Target-selected mutant screen by TILLING in Drosophila. Genome Res. 2005, 15, 718–723. [Google Scholar] [CrossRef] [Green Version]
- Wienholds, E.; van Eeden, F.; Kosters, M.; Mudde, J.; Plasterk, R.H.; Cuppen, E. Efficient target-selected mutagenesis in zebrafish. Genome Res. 2003, 13, 2700–2707. [Google Scholar] [CrossRef] [Green Version]
- Büschges, R.; Hollricher, K.; Panstruga, R.; Simons, G.; Wolter, M.; Frijters, A.; van Daelen, R.; van der Lee, T.; Diergaarde, P.; Groenendijk, J.; et al. The barley Mlo gene: A novel control element of plant pathogen resistance. Cell 1997, 88, 695–705. [Google Scholar] [CrossRef] [Green Version]
- Su, Z.; Bernardo, A.; Tian, B.; Chen, H.; Wang, S.; Ma, H.; Cai, S.; Liu, D.; Zhang, D.; Li, T.; et al. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat. Genet. 2019, 51, 1099–1105. [Google Scholar] [CrossRef] [PubMed]
- Asare, E.K.; Baga, M.; Rossnagel, B.G.; Chibbar, R.N. Polymorphism in the barley granule bound starch synthase 1 (Gbss1) gene associated with grain starch variant amylose concentration. J. Agri. Food Chem. 2012, 60, 10082–10092. [Google Scholar] [CrossRef] [PubMed]
- Domon, E.; Saito, A.; Takeda, K. Comparison of the waxy locus sequence from a non-waxy strain and two waxy mutants of spontaneous and artificial origins in barley. Genes Genet. Syst. 2002, 77, 351–359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, B.; Wen, X.; Kodali, N.S.; Oleykowski, C.A.; Miller, C.G.; Kulinski, J.; Besack, D.; Yeung, J.A.; Kowalski, D.; Yeung, A.T. Purification, cloning, and characterization of the CEL I nuclease. Biochem. 2000, 39, 3533–3541. [Google Scholar] [CrossRef] [PubMed]
- Pimkin, M.; Caretti, E.; Canutescu, A.; Yeung, J.B.; Cohn, H.; Chen, Y.; Oleykowski, C.; Bellacosa, A.; Yeung, A.T. Recombinant nucleases CEL I from celery and SP I from spinach for mutation detection. BMC Biotechnol. 2007, 7, 29. [Google Scholar] [CrossRef] [Green Version]
- Sainsbury, S.; Thuenemann, E.C.; Lomonossoff, G.P. pEAQ: Versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol. J. 2009, 7, 682–693. [Google Scholar] [CrossRef]
- Patron, N.J.; Smith, A.M.; Fahy, B.F.; Hylton, C.M.; Naldrett, M.J.; Rossnagel, B.G.; Denyer, K. The altered pattern of amylose accumulation in the endosperm of low-amylose barley cultivars is attributable to a single mutant allele of granule-bound starch synthase I with a deletion in the 5’-non-coding region. Plant Physiol. 2002, 130, 190–198. [Google Scholar] [CrossRef] [Green Version]
- Hebelstrup, K.H.; Nielsen, M.M.; Carciofi, M.; Andrzejczak, O.; Shaik, S.S.; Blennow, A.; Palcic, M.M. Waxy and non-waxy barley cultivars exhibit differences in the targeting and catalytic activity of GBSS1a. J. Exp. Bot. 2017, 68, 931–941. [Google Scholar] [CrossRef]
- Momma, M.; Fujimoto, Z. Interdomain disulfide bridge in the rice granule bound starch synthase I catalytic domain as elucidated by X-ray structure analysis. Biosci. Biotechnol. Biochem. 2012, 76, 1591–1595. [Google Scholar] [CrossRef] [Green Version]
- Isshiki, M.; Yamamoto, Y.; Sato, H.; Shimamoto, K. Nonsense-mediated decay of mutant waxy mRNA in rice. Plant Physiol. 2001, 125, 1388–1395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, Y.F.; Imam, J.S.; Wilkinson, M.F. The nonsense-mediated decay RNA surveillance pathway. Ann. Rev. Biochem. 2007, 76, 51–74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Talamè, V.; Bovina, R.; Sanguineti, M.C.; Tuberosa, R.; Lundqvist, U.; Salvi, S. TILLMore, a resource for the discovery of chemically induced mutants in barley. Plant Biotechnol. J. 2008, 6, 477–485. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, M.; Barakate, A.; Uzrek, N.; Macaulay, M.; Sourdille, A.; Morris, J.; Hedley, P.E.; Ramsay, L.; Waugh, R. A highly mutagenised barley (cv. Golden Promise) TILLING population coupled with strategies for screening-by-sequencing. Plant Methods 2019, 15, 99. [Google Scholar] [CrossRef]
- Yao, X.F.; Wu, S.; Guo, L.; Liu, C.M. Efficient CELI endonuclease production in Nicotiana benthamiana through transient expression and applications in detections of mutation and gene editing events. Plant Sci. 2020, 296, 110469. [Google Scholar] [CrossRef]
- Mon, H.; Lee, J.; Fukushima, M.; Nagata, Y.; Fujii, M.; Xu, J.; Nishi, O.; Iiyama, K.; Kusakabe, T. Production and characterization of celery mismatch endonuclease CEL II using baculovirus/silkworm expression system. Appl. Microbiol. Biotechnol. 2013, 97, 6813–6822. [Google Scholar] [CrossRef]
- Wahara, M.; Inoue, C.; Kohguchi, T.; Sugai, K.; Kobayashi, K.; Nishiguchi, M.; Yamaoka, N.; Yaeno, T. Improved method for in situ biolistic transformation to analyze barley-powdery mildew interactions. J. Gen. Plant Pathol. 2017, 83, 140–146. [Google Scholar] [CrossRef]
- Nakagawa, T.; Kurose, T.; Hino, T.; Tanaka, K.; Kawamukai, M.; Niwa, Y.; Toyooka, K.; Matsuoka, K.; Jinbo, T.; Kimura, T. Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J. Biosci. Bioeng. 2007, 104, 34–41. [Google Scholar] [CrossRef]
- Yaeno, T.; Li, H.; Chaparro-Garcia, A.; Schornack, S.; Koshiba, S.; Watanabe, S.; Kigawa, T.; Kamoun, S.; Shirasu, K. Phosphatidylinositol monophosphate-binding interface in the oomycete RXLR effector AVR3a is required for its stability in host cells to modulate plant immunity. Proc. Natl. Acad. Sci. USA 2011, 108, 14682–14687. [Google Scholar] [CrossRef] [Green Version]
Primer | Sequence (5′→3′) | Direction |
---|---|---|
Hv_waxy_1F-2 | CTTCATCTTCCTCCTGTCCTGTGTG | Forward |
Hv_waxy_1R-2 | AGCCGTACGTTGGATCTGTTCCTGAAA | Reverse |
Hv_waxy_2F | ACACACTACAACCTCTGCCACT | Forward |
Hv_waxy_2R-2 | TTGCTCCGACAGTCCTCATACC | Reverse |
Hv_waxy_3F | TCTGGCCACGTCCCAGCT | Forward |
Hv_waxy_3R | TCTTCTCCTTGGTCTTGCCCC | Reverse |
Hor_wx_4F | TACAAGCGCGGAGTGGAC | Forward |
Hor_wx_4R | ACGAGATGTTGTGGATGCAG | Reverse |
Hv_waxy_5F | AGTCCAATGGCATCTACAGG | Forward |
Hv_waxy_5R | CTCTTGAGCAGCTTCTCAAAC | Reverse |
Hv_waxy_6F | GACGTCCAGATCATTCTCCTT | Forward |
Hv_waxy_6R | ACGTCCTCCCAGTTCTTGGCA | Reverse |
Hv_waxy_7F-2 | GGTCAAGAACTGCATGATCCAGGAT | Forward |
Hv_waxy_7R | TGTTGCATCGATCTTGGCG | Reverse |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kawamoto, Y.; Toda, H.; Inoue, H.; Kobayashi, K.; Yamaoka, N.; Araki, T.; Yaeno, T. Fast and Inexpensive Phenotyping and Genotyping Methods for Evaluation of Barley Mutant Population. Plants 2020, 9, 1153. https://doi.org/10.3390/plants9091153
Kawamoto Y, Toda H, Inoue H, Kobayashi K, Yamaoka N, Araki T, Yaeno T. Fast and Inexpensive Phenotyping and Genotyping Methods for Evaluation of Barley Mutant Population. Plants. 2020; 9(9):1153. https://doi.org/10.3390/plants9091153
Chicago/Turabian StyleKawamoto, Yudai, Hirotaka Toda, Hiroshi Inoue, Kappei Kobayashi, Naoto Yamaoka, Takuya Araki, and Takashi Yaeno. 2020. "Fast and Inexpensive Phenotyping and Genotyping Methods for Evaluation of Barley Mutant Population" Plants 9, no. 9: 1153. https://doi.org/10.3390/plants9091153
APA StyleKawamoto, Y., Toda, H., Inoue, H., Kobayashi, K., Yamaoka, N., Araki, T., & Yaeno, T. (2020). Fast and Inexpensive Phenotyping and Genotyping Methods for Evaluation of Barley Mutant Population. Plants, 9(9), 1153. https://doi.org/10.3390/plants9091153