Relationships between Nut Size, Kernel Quality, Nutritional Composition and Levels of Outcrossing in Three Macadamia Cultivars
Abstract
1. Introduction
2. Results and Discussion
2.1. Kernel Recovery and Incidence of Whole Kernels
2.2. Fatty Acid Composition
2.3. Mineral Nutrient Concentrations
2.4. Levels of Cross- and Self-Paternity
3. Materials and Methods
3.1. Study Sites
3.2. Sampling Design, Sample Collection and Processing
3.3. Fatty Acid Analysis
3.4. Mineral Nutrient Analysis
3.5. Paternity Analysis
3.6. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Souza, R.G.M.; Schincaglia, R.M.; Pimentel, G.D.; Mota, J.F. Nuts and human health outcomes: A systematic review. Nutrients 2017, 9, 1311. [Google Scholar] [CrossRef] [PubMed]
- Bitok, E.; Sabaté, J. Nuts and cardiovascular disease. Prog. Cardiovasc. Dis. 2018, 61, 33–37. [Google Scholar] [CrossRef] [PubMed]
- Bai, S.H.; Brooks, P.; Gama, R.; Nevenimo, T.; Hannet, G.; Hannet, D.; Randall, B.; Walton, D.; Grant, E.; Wallace, H.M. Nutritional quality of almond, canarium, cashew and pistachio and their oil photooxidative stability. J. Food Sci. Technol. 2019, 56, 792–798. [Google Scholar] [CrossRef] [PubMed]
- Kornsteiner-Krenn, M.; Wagner, K.-H.; Elmadfa, I. Phytosterol content and fatty acid pattern of ten different nut types. Int. J. Vitam. Nutr. Res. 2013, 83, 263–270. [Google Scholar] [CrossRef]
- Aquino-Bolaños, E.N.; Mapel-Velazco, L.; Martín-del-Campo, S.T.; Chávez-Servia, J.L.; Martínez, A.J.; Verdalet-Guzmán, I. Fatty acids profile of oil from nine varieties of Macadamia nut. Int. J. Food Prop. 2017, 20, 1262–1269. [Google Scholar] [CrossRef]
- Bai, S.H.; Darby, I.; Nevenimo, T.; Hannet, G.; Hannet, D.; Poienou, M.; Grant, E.; Brooks, P.; Walton, D.; Randall, B.; et al. Effects of roasting on kernel peroxide value, free fatty acid, fatty acid composition and crude protein content. PLoS ONE 2017, 12, e0184279. [Google Scholar]
- Kim, Y.; Keogh, J.B.; Clifton, P.M. Benefits of nut consumption on insulin resistance and cardiovascular risk factors: Multiple potential mechanisms of actions. Nutrients 2017, 9, 1271. [Google Scholar] [CrossRef]
- Gama, T.; Wallace, H.M.; Trueman, S.J.; Bai, S.H. Variability in crude protein and mineral nutrient concentrations of almonds. Acta Hortic. 2018, 1219, 213–218. [Google Scholar] [CrossRef]
- Gama, T.; Wallace, H.M.; Trueman, S.J.; Hosseini-Bai, S. Quality and shelf life of tree nuts: A review. Sci. Hortic. 2018, 242, 116–126. [Google Scholar] [CrossRef]
- Garg, M.L.; Blake, R.J.; Wills, R.B.H. Macadamia nut consumption lowers plasma total and LDL cholesterol levels in hypercholesterolemic men. J. Nutr. 2003, 133, 1060–1063. [Google Scholar] [CrossRef]
- Hiraoka-Yamamoto, J.; Ikeda, K.; Negishi, H.; Mori, M.; Hirose, A.; Sawada, S.; Kitamori, K.; Onobayashi, Y.; Kitano, S.; Tashiro, M.; et al. Serum lipid effects of a monounsaturated (palmitoleic) fatty acid-rich diet based on macadamia nuts in healthy, young Japanese women. Clin. Exp. Pharmacol. Physiol. 2004, 31, S37–S38. [Google Scholar] [CrossRef] [PubMed]
- Sabaté, J.; Oda, K.; Ros, E. Nut consumption and blood lipid levels: A pooled analysis of 25 intervention trials. Arch. Intern. Med. 2010, 170, 821–827. [Google Scholar] [CrossRef] [PubMed]
- Billingsley, H.E.; Carbone, S.; Lavie, C.J. Dietary fats and chronic noncommunicable diseases. Nutrients 2018, 10, 1385. [Google Scholar] [CrossRef] [PubMed]
- Hong, M.Y.; Groevn, S.; Marx, A.; Rasmussen, C.; Beidler, J. Anti-Inflammatory, antioxidant, and hypolipidemic effects of mixed nuts in atherogenic diet-fed rats. Molecules 2018, 23, 3126. [Google Scholar] [CrossRef]
- Hosseini-Bai, S.; Trueman, S.J.; Nevenimo, T.; Hannet, G.; Randall, B.; Wallace, H.M. The effects of tree spacing regime and tree species composition on mineral nutrient composition of cocoa beans and canarium nuts in 8-year-old cocoa plantations. Environ. Sci. Pollut. Res. 2019, 26, 22021–22029. [Google Scholar] [CrossRef]
- Collings, R.; Harvey, L.J.; Hooper, L.; Hurst, R.; Brown, T.J.; Ansett, J.; King, M.; Fairweather-Tait, S.J. The absorption of iron from whole diets: A systematic review. Am. J. Clin. Nutr. 2013, 98, 65–81. [Google Scholar] [CrossRef]
- Kaganov, B.; Caroli, M.; Mazur, A.; Singhal, A.; Vania, A. Suboptimal micronutrient intake among children in Europe. Nutrients 2015, 7, 3524–3535. [Google Scholar] [CrossRef] [PubMed]
- Brown, R.C.; Gray, A.R.; Tey, S.L.; Chisholm, A.; Burley, V.; Greenwood, D.C.; Cade, J. Associations between nut consumption and health vary between omnivores, vegetarians, and vegans. Nutrients 2017, 9, 1219. [Google Scholar] [CrossRef]
- Engel, M.G.; Kern, H.J.; Brenna, J.T.; Mitmesser, S.H. Micronutrient gaps in three commercial weight-loss diet plans. Nutrients 2018, 10, 108. [Google Scholar] [CrossRef]
- Kim, S.; Fenech, M.F.; Kim, P.-J. Nutritionally recommended food for semi-to strict vegetarian diets based on large-scale nutrient composition data. Sci. Rep. 2018, 8, 4344. [Google Scholar] [CrossRef]
- Baroni, L.; Goggi, S.; Battaglino, R.; Berveglieri, M.; Fasan, I.; Filippin, D.; Griffith, P.; Rizzo, G.; Tomasini, C.; Tosatti, M.A.; et al. Vegan nutrition for mothers and children: Practical tools for healthcare providers. Nutrients 2019, 11, 5. [Google Scholar] [CrossRef] [PubMed]
- Kodad, O.; Socias i Company, R. Fruit quality in almond as related to the type of pollination in self-compatible genotypes. J. Am. Soc. Hortic. Sci. 2008, 133, 320–326. [Google Scholar] [CrossRef]
- Kodad, O.; Estopañán, G.; Juan, T.; Socias i Company, R. Xenia effects on oil content and fatty acid and tocopherol concentrations in autogamous almond cultivars. J. Agric. Food Chem. 2009, 57, 10809–10813. [Google Scholar] [CrossRef] [PubMed]
- Acar, I.; Eti, S. Nut quality of ‘Kirmizi’, ‘Siirt’ and ‘Ohadi’ pistachio cultivars as affected by different pollinators. Acta Hortic. 2011, 912, 81–86. [Google Scholar] [CrossRef]
- Alizadeh-Salte, S.; Farhadi, N.; Arzani, K.; Khoshghalb, H. Almond oil quality as related to the type of pollen source in Iranian self-incompatible cultivars. Int. J. Fruit Sci. 2018, 18, 29–36. [Google Scholar] [CrossRef]
- Xu, Y.X.; Hanna, M.A. Evaluation of Nebraska hybrid hazelnuts: Nut/Kernel characteristics, kernel proximate composition, and oil and protein properties. Ind. Crops Prod. 2010, 31, 84–91. [Google Scholar] [CrossRef]
- O’Hare, T.J.; Trieu, H.H.; Topp, B.; Russell, D.; Pun, S.; Torrisi, C.; Liu, D. Assessing fatty acid profiles of macadamia nuts. HortScience 2019, 54, 633–637. [Google Scholar] [CrossRef]
- Oliveira, I.; Meyer, A.S.; Afonso, S.; Aires, A.; Goufo, P.; Trindade, H.; Gonçalves, B. Phenolic and fatty acid profiles, α-tocopherol and sucrose contents, and antioxidant capacities of understudied Portuguese almond cultivars. J. Food Biochem. 2019, 43, e12887. [Google Scholar] [CrossRef]
- Brittain, C.; Kremen, C.; Garber, A.; Klein, A.-M. Pollination and plant resources change the nutritional quality of almonds for human health. PLoS ONE 2014, 9, e90082. [Google Scholar] [CrossRef]
- Rasouli, M.; Imani, A. Effect of supplementary pollination by different pollinizers on fruit set and nut physicochemical traits of ‘Supernova’, a self-compatible almond. Fruits 2016, 71, 299–306. [Google Scholar] [CrossRef][Green Version]
- Oukabli, A.; Lansari, A.; Walali-Loudiyi, D.E.; Abousalim, A. Effects of controlled self-pollination and cross-pollination on fruit set, embryo viability and pomological traits in the self-compatible almond cv ‘Tuono’. Acta Hortic. 2002, 591, 429–435. [Google Scholar] [CrossRef]
- Fattahi, R.; Mohammadzedeh, M.; Khadivi-Khub, A. Influence of different pollen sources on nut and kernel characteristics of hazelnut. Sci. Hortic. 2014, 173, 15–19. [Google Scholar] [CrossRef]
- Zhang, X.-H.; Yuan, D.-Y.; Zou, F.; Fan, X.-M.; Tang, J.; Zhu, Z.-J. Studies on the pollen xenia of Castanea henryi. Acta Hortic. Sin. 2016, 43, 61–70. [Google Scholar]
- Denney, J.O. Xenia includes metaxenia. HortScience 1992, 27, 722–728. [Google Scholar] [CrossRef]
- Sedgley, M. Pollen tube growth in macadamia. Sci. Hortic. 1983, 18, 333–341. [Google Scholar] [CrossRef]
- Vithanage, H.I.M.V.; Ironside, D.A. The insect pollinators of macadamia and their relative importance. J. Aust. Inst. Agric. Sci. 1986, 52, 155–160. [Google Scholar]
- Sedgley, M.; Bell, F.D.H.; Bell, D.; Winks, C.W.; Pattison, S.J.; Hancock, T.W. Self-and cross-compatibility of macadamia cultivars. J. Hortic. Sci. 1990, 65, 205–213. [Google Scholar] [CrossRef]
- Heard, T.A. Behaviour and pollinator efficiency of stingless bees and honey bees on macadamia flowers. J. Apic. Res. 1994, 33, 191–198. [Google Scholar] [CrossRef]
- Sacramento, C.K.; Pereira, F.M.; Perecin, D.; Sabino, J.C. Capacidade combinatória para fructificação em cultivares de nogueira macadâmia. Pesq. Agropec. Bras. 1999, 34, 2045–2049. [Google Scholar] [CrossRef]
- Trueman, S.J. The reproductive biology of macadamia. Sci. Hortic. 2013, 150, 354–359. [Google Scholar] [CrossRef]
- Howlett, B.G.; Nelson, W.R.; Pattemore, D.E.; Gee, M. Pollination of macadamia: Review and opportunities for improving yields. Sci. Hortic. 2015, 197, 411–419. [Google Scholar] [CrossRef]
- Kaluza, B.F.; Wallace, H.M.; Heard, T.A.; Klein, A.-M.; Leonhardt, S.D. Urban gardens promote bee foraging over natural habitats and plantations. Ecol. Evol. 2016, 6, 1304–1316. [Google Scholar] [CrossRef]
- Grass, I.; Meyer, S.; Taylor, P.; Foord, S.; Hajek, P.; Tscharntke, T. Pollination limitation despite managed honeybees in South African macadamia orchards. Agric. Ecosyst. Environ. 2018, 260, 11–18. [Google Scholar] [CrossRef]
- Howlett, B.G.; Read, S.F.J.; Alavi, M.; Cutting, B.T.; Nelson, W.R.; Goodwin, R.M.; Cross, S.; Thorp, T.G.; Pattemore, D.E. Cross-Pollination enhances macadamia yields, even with branch-level resource limitation. HortScience 2019, 54, 609–615. [Google Scholar] [CrossRef]
- Wallace, H.M.; Vithanage, V.; Exley, E.M. The effect of supplementary pollination on nut set of Macadamia (Proteaceae). Ann. Bot. 1996, 78, 765–773. [Google Scholar] [CrossRef]
- Trueman, S.J.; Turnbull, C.G.N. Effects of cross-pollination and flower removal on fruit set in macadamia. Ann. Bot. 1994, 73, 23–32. [Google Scholar] [CrossRef]
- Vithanage, V.; Meyers, N.; McConchie, C. Maximising the Benefits from Cross-Pollination in Macadamia Orchards; Horticulture Australia Ltd.: Sydney, Australia, 2002. [Google Scholar]
- Langdon, K.S.; King, G.J.; Nock, C.J. DNA paternity testing indicates unexpectedly high levels of self-fertilisation in macadamia. Tree Genet. Genomes 2019, 15, 29. [Google Scholar] [CrossRef]
- Hardner, C.; Winks, C.; Stephenson, R.; Gallagher, E. Genetic parameters for nut and kernel traits in macadamia. Euphytica 2001, 117, 151–161. [Google Scholar] [CrossRef]
- O’Connor, K.; Hayes, B.; Hardner, C.; Alam, M.; Topp, B. Selecting for nut characteristics in macadamia using a genome-wide association study. HortScience 2019, 54, 629–632. [Google Scholar] [CrossRef]
- Australian Macadamia Society. The Australian Macadamia Industry; Australian Macadamia Society: Lismore, Australia, 2017. [Google Scholar]
- Department of Agriculture and Fisheries. Macadamia Industry Benchmark Report. 2009–2018 Seasons; State of Queensland: Brisbane, Australia, 2019.
- Jones, W.W. A study of developmental changes in composition of the macadamia. Plant Physiol. 1939, 14, 755–768. [Google Scholar] [CrossRef]
- Jones, W.W.; Shaw, L. The process of oil formation and accumulation in the macadamia. Plant Physiol. 1943, 18, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Sakai, W.S.; Nagao, M.A. Fruit growth and abscission in Macadamia integrifolia. Physiol. Plant. 1985, 64, 455–460. [Google Scholar] [CrossRef]
- Nagao, M.A.; Sakai, W.S. Influence of nut age on ethephon-induced abscission of macadamia. Sci. Hortic. 1988, 36, 103–108. [Google Scholar] [CrossRef]
- Trueman, S.J.; Turnbull, C.G.N. Fruit set, abscission and dry matter accumulation on girdled branches of macadamia. Ann. Bot. 1994, 74, 667–674. [Google Scholar] [CrossRef]
- Herbert, S.W.; Walton, D.A.; Wallace, H.M. Pollen-Parent affects fruit, nut and kernel development of Macadamia. Sci. Hortic. 2019, 244, 406–412. [Google Scholar] [CrossRef]
- Herbert, S.W.; Walton, D.A.; Wallace, H.M. The influence of pollen-parent and carbohydrate availability on macadamia yield and nut size. Sci. Hortic. 2019, 251, 241–246. [Google Scholar] [CrossRef]
- Vock, N.; Bell, D.; Gallagher, E.; Bryen, L.; McConachie, I.; Firth, D.; O’Hare, P.; Jones, K.; Stephenson, R. Macadamia Variety Identifier; Queensland Department of Primary Industries: Brisbane, Australia, 1999.
- Trueman, S.J.; Richards, S.; McConchie, C.A.; Turnbull, C.G.N. Relationships between kernel oil content, fruit removal force and abscission in macadamia. Aust. J. Exp. Agric. 2000, 40, 859–866. [Google Scholar] [CrossRef]
- Trueman, S.J.; McConchie, C.A.; Turnbull, C.G.N. Ethephon promotion of crop abscission for unshaken and mechanically shaken macadamia. Aust. J. Exp. Agric. 2002, 42, 1001–1008. [Google Scholar] [CrossRef]
- Trueman, S.J. Yield responses to ethephon for unshaken and mechanically shaken macadamia. Aust. J. Exp. Agric. 2003, 43, 1143–1150. [Google Scholar] [CrossRef]
- Trueman, S.J. Preliminary evaluation of low ethephon doses for inducing fruit abscission of macadamia (Macadamia integrifolia) cv. A16. Trop. Agric. 2003, 80, 243–245. [Google Scholar]
- Walton, D.A.; Wallace, H.M. Ultrastructure of Macadamia (Proteaceae) embryos: Implications for their breakage properties. Ann. Bot. 2005, 96, 981–988. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Walton, D.A.; Wallace, H.M.; Webb, R. Ultrastructure and anatomy of Macadamia (Proteaceae) kernels. Aust. J. Bot. 2012, 60, 291–300. [Google Scholar] [CrossRef]
- Penter, M.G.; Nkwana, E.; Nxundu, Y. Factors influencing kernel breakage in the South African macadamia industry. S. Afr. Macadamia Grow. Assoc. Yearb. 2008, 16, 6–10. [Google Scholar]
- Australian Macadamia Society. Kernel Quality Standard for Processors; Australian Macadamia Society: Lismore, Australia, 2018. [Google Scholar]
- Hu, W.; Fitzgerald, M.; Topp, B.; Alam, M.; O’Hare, T.J. A review of biological functions, health benefits, and possible de novo biosynthetic pathway of palmitoleic acid in macadamia nuts. J. Funct. Foods 2019, 62, 103520. [Google Scholar] [CrossRef]
- Liu, A.G.; Ford, N.A.; Hu, F.B.; Zelman, K.M.; Mozafarrain, D.; Kris-Etherton, P.M. A healthy approach to dietary fats: Understanding the science and taking action to reduce consumer confusion. Nutr. J. 2017, 16, 53. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations (FAO). Fats and fatty acids in human nutrition: Report of an expert consultation. FAO Food Nutr. Pap. 2010, 91, 1–166. [Google Scholar]
- Kaijser, A.; Dutta, P.; Savage, G. Oxidative stability and lipid composition of macadamia nuts grown in New Zealand. Food Chem. 2000, 71, 67–70. [Google Scholar] [CrossRef]
- Birch, J.; Yap, K.; Silcock, P. Compositional analysis and roasting behaviour of gevuina and macadamia nuts. Int. J. Food Sci. Technol. 2010, 45, 81–86. [Google Scholar] [CrossRef]
- Griel, A.E.; Cao, Y.; Bagshaw, D.B.; Cifelli, A.M.; Holub, B.; Kris-Etherton, P.M. A macadamia nut-rich diet reduces total and LDL-cholesterol in mildly hypercholesterolemic men and women. J. Nutr. 2008, 138, 761–767. [Google Scholar] [CrossRef] [PubMed]
- Perna, S.; Giacosa, A.; Bonitta, G.; Bologna, C.; Isu, A.; Guido, D.; Rondanelli, M. Effects of hazelnut consumption on blood lipids and body weight: A systematic review and Bayesian meta-analysis. Nutrients 2016, 8, 747. [Google Scholar] [CrossRef] [PubMed]
- Bamberger, C.; Rossmeier, A.; Lechner, K.; Wu, L.; Waldmann, E.; Stark, R.G.; Altenhofer, J.; Henze, K.; Parhofer, K.G. A walnut-enriched diet reduces lipids in healthy Caucasian subjects, independent of recommended macronutrient replacement and time point of consumption: A prospective, randomized, controlled trial. Nutrients 2017, 9, 1097. [Google Scholar] [CrossRef] [PubMed]
- Atanasov, A.G.; Sabharanjak, S.M.; Zengin, G.; Mollica, A.; Szostak, A.; Simirgiotis, M.; Huminiecki, Ł.; Horbanczuk, O.K.; Nabavi, S.M.; Mocan, A. Pecan nuts: A review of reported bioactivities and health effects. Trends Food Sci. Technol. 2018, 71, 246–257. [Google Scholar] [CrossRef]
- Deon, V.; Del Bo, C.; Guaraldi, F.; Abello, F.; Belviso, S.; Porrini, M.; Riso, P.; Guardamagna, O. Effect of hazelnut on serum lipid profile and fatty acid composition of erythrocyte phospholipids in children and adolescents with primary hyperlipidemia: A randomized controlled trial. Clin. Nutr. 2018, 37, 1193–1201. [Google Scholar] [CrossRef] [PubMed]
- Kalita, S.; Khandelwal, S.; Madan, J.; Pandya, H.; Sesikeran, B.; Krishnaswamy, K. Almonds and cardiovascular health: A review. Nutrients 2018, 10, 468. [Google Scholar] [CrossRef] [PubMed]
- USDA Food Data Central. Nuts, Macadamia Nuts, Raw. Available online: https://fdc.nal.usda.gov/fdc-app.html#/food-details/170178/nutrients (accessed on 22 January 2020).
- Soil Survey of the Bundaberg Area, South East Queensland. 2019. Available online: https://publications.qld.gov.au/dataset/soil-survey-bundaberg-bab (accessed on 8 February 2019).
- Food and Agriculture Organization of the United Nations (FAO). Food Energy—Methods of Analysis and Conversion Factors; Food and Agriculture Organization of the United Nations: Rome, Italy, 2003. [Google Scholar]
- Amit, M. Vegetarian diets in children and adolescents. Paediatr. Child Health 2010, 15, 303–314. [Google Scholar] [PubMed]
- Marsh, K.A.; Munn, E.A.; Baines, S.K. Protein and vegetarian diets. Med. J. Aust. 2012, 1, 7–10. [Google Scholar] [CrossRef]
- Baroni, L.; Goggi, S.; Battino, M. Planning well-balanced vegetarian diets in infants, children, and adolescents: The VegPlate Junior. J. Acad. Nutr. Diet. 2019, 119, 1067–1073. [Google Scholar] [CrossRef]
- Borgna-Pignatti, C.; Marsella, M. Iron deficiency in infancy and childhood. Pediatr. Ann. 2008, 37, 329–337. [Google Scholar] [CrossRef]
- Gibson, R.S.; Heath, A.-L.M.; Szymlek-Gay, E.A. Is iron and zinc nutrition a concern for vegetarian infants and young children in industrialized countries. Am. J. Clin. Nutr. 2014, 100, 459S–468S. [Google Scholar] [CrossRef]
- Melina, V.; Craig, W.; Levin, S. Position of the Academy of Nutrition and Dietetics: Vegetarian diets. J. Acad. Nutr. Diet. 2016, 116, 1970–1980. [Google Scholar] [CrossRef]
- Agnoli, C.; Baroni, L.; Bertini, I.; Ciappellano, S.; Fabbri, A.; Papa, M.; Pellegrini, N.; Sbarbati, R.; Scarino, M.L.; Siani, V.; et al. Position paper on vegetarian diets from the working group of the Italian Society of Human Nutrition. Nutr. Metab. Cardiovasc. Dis. 2017, 27, 1037–1052. [Google Scholar] [CrossRef] [PubMed]
- Chrysant, S.G.; Chrysant, G.S. Association of hypomagnesemia with cardiovascular diseases and hypertension. Int. J. Cardiol. Hypertens. 2019, 1, 100005. [Google Scholar] [CrossRef]
- Wu, D.; Chen, Y.; Guan, H.; Sun, Y. Association of abnormal serum electrolyte levels with hypertension in a population with high salt intake. Public Health Nutr. 2019, 22, 1635–1645. [Google Scholar] [CrossRef] [PubMed]
- Zeper, L.W.; de Baaij, J.H.F. Magnesium and calciprotein particles in vascular calcification: The good cop and the bad cop. Curr. Opin. Nephrol. Hypertens. 2019, 28, 368–374. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, I.B.; Watkins, C.B. Crop load affects mineral concentrations and incidence of bitter pit in ‘Cox’s Orange Pippin’ apple fruit. J. Am. Soc. Hortic. Sci. 1992, 117, 373–376. [Google Scholar] [CrossRef]
- Volz, R.K.; Ferguson, I.B. Flower thinning method affects mineral composition of ‘Braeburn’ and ‘Fiesta’ apple fruit. J. Hortic. Sci. Biotechnol. 1999, 74, 452–457. [Google Scholar] [CrossRef]
- Hofman, P.J.; Vuthapanich, S.; Whiley, A.W.; Klieber, A.; Simons, D.H. Tree yield and fruit minerals concentrations influence ‘Hass’ avocado fruit quality. Sci. Hortic. 2002, 92, 113–123. [Google Scholar] [CrossRef]
- Marques, J.R.; Hofman, P.J.; Wearing, A.H. Between-Tree variation in fruit quality and fruit mineral concentrations of Hass avocados. Aust. J. Exp. Agric. 2006, 46, 1195–1201. [Google Scholar] [CrossRef]
- Choi, S.-T.; Ahn, G.-H.; Kim, E.-G.; Son, J.-Y.; Park, Y.-O.; Joung, W.-K. Fruit characteristics and mineral nutrient concentrations depending on different sizes of “Fuyu” persimmon fruits. Agric. Sci. 2019, 10, 1015–1022. [Google Scholar] [CrossRef]
- Urata, U. Pollination Requirements of Macadamia; Hawaii Agricultural Experiment Station Technical Bulletin No. 22; Hawaii Agricultural Experiment Station, University of Hawaii: Honolulu, HI, USA, 1954. [Google Scholar]
- Sedgley, M.; Blesing, M.A.; Vithanage, H.I.M.V. A developmental study of the structure and pollen receptivity of the macadamia pistil in relation to protandry and self-incompatibility. Bot. Gaz. 1985, 146, 6–14. [Google Scholar] [CrossRef]
- Trueman, S.J. Benzyladenine delays immature fruit abscission but does not affect final fruit set or kernel size of Macadamia. Afr. J. Agric. Res. 2010, 5, 1523–1530. [Google Scholar]
- Vaughton, G.; Carthew, S. Evidence for selective fruit abortion in Banksia spinulosa (Proteaceae). Biol. J. Linn. Soc. 1993, 50, 35–46. [Google Scholar] [CrossRef]
- Korbecka, G.; Klinkhamer, P.G.L.; Vrieling, K. Selective embryo abortion hypothesis revisited—A molecular approach. Plant. Biol. 2002, 4, 298–310. [Google Scholar] [CrossRef]
- Alcaraz, M.L.; Hormaza, J.I. Influence of physical distance between cultivars on yield, outcrossing rate and selective fruit drop in avocado (Persea americana, Lauraceae). Ann. Appl. Biol. 2011, 158, 354–361. [Google Scholar] [CrossRef]
- Cunningham, S.A.; Fournier, A.; Neave, M.J.; Le Feuvre, D. Improving spatial arrangement of honeybee colonies to avoid pollination shortfall and depressed fruit set. J. Appl. Ecol. 2016, 53, 350–359. [Google Scholar] [CrossRef]
- Sáez, A.; Di Virgilio, A.; Tiribelli, F.; Geslin, B. Simulation models to predict pollination success in apple orchards: A useful tool to test management practices. Apidologie 2018, 49, 551–561. [Google Scholar] [CrossRef]
- Willcox, B.K.; Robson, A.J.; Howlett, B.G.; Rader, R. Toward an integrated approach to crop production and pollination ecology through the application of remote sensing. PeerJ 2018, 6, e5806. [Google Scholar] [CrossRef]
- Climate Statistics for Australian Locations. Available online: http://www.bom.gov.au/climate/averages/tables/cw_039128.shtml (accessed on 22 January 2020).
- Meyers, N.M.; Morris, S.C.; McFadyen, L.M.; Huett, D.O.; McConchie, C.A. Investigation of sampling procedures to determine macadamia fruit quality in orchards. Aust. J. Exp. Agric. 1999, 39, 1007–1012. [Google Scholar] [CrossRef]
- McGeehan, S.L.; Naylor, D.V. Automated instrumental analysis of carbon and nitrogen in plant and soil samples. Commun. Soil Sci. Plant Anal. 1988, 19, 493–505. [Google Scholar] [CrossRef]
- Rayment, G.E.; Higginson, F.R. Australian Laboratory Handbook of Soil and Water Chemical Methods; Inkata: Melbourne, Australia, 1992. [Google Scholar]
- Martinie, G.D.; Schilt, A.A. Investigation of the wet oxidation efficiencies of perchloric acid mixtures for various organic substances and the identities of residual matter. Anal. Chem. 1976, 48, 70–74. [Google Scholar] [CrossRef]
- Munter, R.C.; Grande, R.A. Plant tissue and soil extract analysis by ICP-atomic emission spectrometry. In Developments in Atomic Plasma Spectrochemical Analysis; Byrnes, R.M., Ed.; Heyden: London, UK, 1981; pp. 653–672. [Google Scholar]
- Shapcott, A.; Forster, P.I.; Guymer, G.P.; McDonald, W.J.F.; Faith, D.P.; Erickson, D.; Kress, W.J. Mapping biodiversity and setting conservation priorities for SE Queensland’s rainforests using DNA barcoding. PLoS ONE 2015, 10, e0122164. [Google Scholar] [CrossRef] [PubMed]
- Ivanova, N.V.; Fazekas, A.J.; Hebert, P.D.N. Semi-Automated, membrane-based protocol for DNA isolation from plants. Plant Mol. Biol. Rep. 2008, 26, 186. [Google Scholar] [CrossRef]
- Nock, C.J.; Elphinstone, M.S.; Ablett, G.; Kawamata, A.; Hardner, C.M.; King, G.J. Whole genome shotgun sequences for microsatellite discovery and application in cultivated and wild Macadamia (Proteaceae). Appl. Plant Sci. 2014, 2, 1300089. [Google Scholar] [CrossRef] [PubMed]
- Naik, V.M.; Ashwath, N.; Lamont, R.W.; Shapcott, A. Novel microsatellite markers for conservation of Australian native Samadera bidwillii. Open J. Ecol. 2018, 8, 75–85. [Google Scholar] [CrossRef][Green Version]
| Cultivar and Nut Size | ||||||
|---|---|---|---|---|---|---|
| “Daddow” (Site 1) | “816” (Site 2) | “A4” (Site 2) | ||||
| Small | Large | Small | Large | Small | Large | |
| Nut-in-Shell Mass (g) | 4.75 ± 0.05a | 8.59 ± 0.10b | 5.17 ± 0.08a | 8.79 ± 0.08b | 6.33 ± 0.09a | 9.97 ± 0.27b |
| Kernel Mass (g) | 1.72 ± 0.03a | 3.31 ± 0.03b | 2.20 ± 0.05a | 4.06 ± 0.04b | 2.65 ± 0.06a | 4.29 ± 0.07b |
| Kernel Recovery (%) | 35.9 ± 0.4a | 38.8 ± 0.3b | 42.5 ± 0.7a | 46.2 ± 0.4b | 41.6 ± 0.8a | 43.7 ± 0.6b |
| Whole Kernels (%) | 60.0 ± 2.4a | 76.0 ± 3.5b | 79.0 ± 3.6 | 82.0 ± 2.4 | 64.0 ± 2.7a | 72.0 ± 2.4b |
| Fatty Acid | Cultivar and Nut Size | |||||
|---|---|---|---|---|---|---|
| “Daddow” (Site 1) | “816” (Site 2) | “A4” (Site 3) | ||||
| Small | Large | Small | Large | Small | Large | |
| Myristic Acid (C14:0) | 0.51 ± 0.02 | 0.51 ± 0.02 | 0.60 ± 0.02 | 0.61 ± 0.02 | 0.29 ± 0.01 | 0.28 ± 0.01 |
| Palmitoleic Acid (C16:1 cis) | 17.57 ± 0.44a | 19.55 ± 0.37b | 17.18 ± 0.34 | 17.38 ± 0.34 | 18.38 ± 0.30 | 19.10 ± 0.29 |
| Palmitic Acid (C16:0) | 9.30 ± 0.12a | 10.06 ± 0.11b | 9.75 ± 0.15a | 10.26 ± 0.14b | 9.39 ± 0.11a | 9.77 ± 0.10b |
| Linoleic Acid (C18:2) | 1.04 ± 0.05 | 1.13 ± 0.06 | 1.02 ± 0.05 | 0.95 ± 0.04 | 0.91 ± 0.04a | 1.02 ± 0.03b |
| Oleic Acid (C18:1 cis) | 59.93 ± 0.53a | 57.14 ± 0.42b | 60.10 ± 0.39 | 60.12 ± 0.44 | 57.83 ± 0.37a | 56.98 ± 0.36b |
| Elaidic Acid (C18:1 trans) | 4.72 ± 0.10 | 4.55 ± 0.09 | 3.74 ± 0.07 | 3.58 ± 0.06 | 4.52 ± 0.09 | 4.64 ± 0.08 |
| Stearic Acid (C18:0) | 3.24 ± 0.08 | 3.28 ± 0.10 | 3.79 ± 0.11a | 3.43 ± 0.09b | 4.76 ± 0.14a | 4.34 ± 0.14b |
| Eicosenoic Acid (C20:1) | 1.70 ± 0.04 | 1.70 ± 0.04 | 1.56 ± 0.03 | 1.54 ± 0.03 | 1.27 ± 0.04 | 1.34 ± 0.04 |
| Arachidic Acid (C20:0) | 1.99 ± 0.04 | 2.07 ± 0.04 | 2.27 ± 0.05a | 2.14 ± 0.03b | 2.66 ± 0.05 | 2.52 ± 0.06 |
| Fatty Acids | Cultivar and Nut Size | |||||
|---|---|---|---|---|---|---|
| “Daddow” (Site 1) | “816” (Site 2) | “A4” (Site 3) | ||||
| Small | Large | Small | Large | Small | Large | |
| Saturated (%) | 15.05 ± 0.16a | 15.93 ± 0.14b | 16.41 ± 0.20 | 16.43 ± 0.20 | 17.06 ± 0.18 | 16.92 ± 0.21 |
| Unsaturated (%) | 84.95 ± 0.16a | 84.07 ± 0.14b | 83.60 ± 0.20 | 83.57 ± 0.20 | 82.94 ± 0.18 | 83.08 ± 0.21 |
| Unsaturated:Saturated | 5.70 ± 0.07a | 5.31 ± 0.05b | 5.18 ± 0.10 | 5.15 ± 0.08 | 4.91 ± 0.06 | 4.98 ± 0.07 |
| Nutrient1 | Cultivar and Nut Size | |||||
|---|---|---|---|---|---|---|
| “Daddow” (Site 1) | “816” (Site 2) | “A4” (Site 2) | ||||
| Small | Large | Small | Large | Small | Large | |
| N | 1530 ± 10a | 1450 ± 10b | 1600 ± 10a | 1500 ± 10b | 1540 ± 10a | 1430 ± 10b |
| Al | 0.38 ± 0.03 | 0.39 ± 0.04 | 0.32 ± 0.02 | 0.30 ± 0.01 | 0.43 ± 0.03a | 0.31 ± 0.01b |
| B | 1.08 ± 0.06a | 0.93 ± 0.03b | 0.77 ± 0.04 | 0.77 ± 0.04 | 1.10 ± 0.06a | 0.88 ± 0.04b |
| Ca | 53.07 ± 1.73a | 44.39 ± 1.38b | 59.03 ± 1.74a | 48.54 ± 1.24b | 74.59 ± 2.06a | 57.92 ± 1.22b |
| Cu | 0.28 ± 0.01a | 0.25 ± 0.01b | 0.37 ± 0.01a | 0.33 ± 0.01b | 0.35 ± 0.01 | 0.33 ± 0.01 |
| Fe | 3.04 ± 0.09a | 2.49 ± 0.07b | 2.30 ± 0.09 | 2.08 ± 0.08 | 2.26 ± 0.12a | 1.97 ± 0.04b |
| K | 404.99 ± 8.97a | 439.90 ± 8.40b | 368.80 ± 6.26a | 403.71 ± 6.69b | 370.95 ± 8.65a | 423.04 ± 7.04b |
| Mg | 145.05 ± 2.12a | 130.77 ± 1.88b | 128.82 ± 1.96a | 117.81 ± 1.53b | 119.27 ± 1.95 | 115.50 ± 1.63 |
| Mn | 2.58 ± 0.11a | 1.93 ± 0.08b | 0.52 ± 0.03 | 0.48 ± 0.02 | 0.64 ± 0.03a | 0.56 ± 0.03b |
| Na | 6.11 ± 0.41 | 5.90 ± 0.39 | 7.53 ± 0.42 | 8.02 ± 0.41 | 8.87 ± 0.97 | 8.75 ± 0.94 |
| P | 261.84 ± 3.27a | 245.23 ± 2.94b | 234.35 ± 3.05a | 205.03 ± 3.05b | 234.68 ± 3.80a | 221.86 ± 3.26b |
| S | 142.49 ± 2.06a | 131.78 ± 1.83b | 132.61 ± 2.24a | 113.53 ± 2.22b | 157.16 ± 2.49a | 150.69 ± 1.88b |
| Zn | 1.79 ± 0.04 | 1.81 ± 0.05 | 1.44 ± 0.05a | 1.29 ± 0.04b | 1.68 ± 0.06 | 1.64 ± 0.05 |
| Paternity | Cultivar and Nut Size | |||||
|---|---|---|---|---|---|---|
| “Daddow” (Site 1) | “816” (Site 2) | “A4” (Site 2) | ||||
| Small | Large | Small | Large | Small | Large | |
| Cross (%) | 93 ± 2 | 82 ± 3 | 80 ± 2 | 75 ± 3 | 89 ± 2 | 91 ± 2 |
| Self (%) | 5 ± 2 | 2 ± 1 | 4 ± 2 | 0 | 0 | 0 |
| Locus | Primer Sequences (5′–3′) | Repeat Motif | Fluorescent Label | Allele Size Range (bp) | |
|---|---|---|---|---|---|
| Mac001 | F: | GTGACTGGTGGACACCAAAACCCA | (AT)11 | VIC | 407–429 |
| R: | GCACTAGGTGTCACCCCCACTTCT | ||||
| Mac002 | F: | CCCAACTGGGTTTGCAAGGACCAA | (CT)8 | NED | 271–313 |
| R: | AGTAGCCGCGAGCTGATCGAAGAT | ||||
| Mac005 | F: | CATAGCATGAGTTTCAAGGGATAA | (AAG)10 | FAM | 255–356 |
| R: | ATTACAAACCCACTCTTCGATTT | ||||
| Mac006 | F: | TTTCATCATTGATCATCATAGGTACA | (AG)11 | PET | 314–368 |
| R: | GAGCTAATACTTAACCAGGTGAACA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Richards, T.E.; Kämper, W.; Trueman, S.J.; Wallace, H.M.; Ogbourne, S.M.; Brooks, P.R.; Nichols, J.; Hosseini Bai, S. Relationships between Nut Size, Kernel Quality, Nutritional Composition and Levels of Outcrossing in Three Macadamia Cultivars. Plants 2020, 9, 228. https://doi.org/10.3390/plants9020228
Richards TE, Kämper W, Trueman SJ, Wallace HM, Ogbourne SM, Brooks PR, Nichols J, Hosseini Bai S. Relationships between Nut Size, Kernel Quality, Nutritional Composition and Levels of Outcrossing in Three Macadamia Cultivars. Plants. 2020; 9(2):228. https://doi.org/10.3390/plants9020228
Chicago/Turabian StyleRichards, Tarran E., Wiebke Kämper, Stephen J. Trueman, Helen M. Wallace, Steven M. Ogbourne, Peter R. Brooks, Joel Nichols, and Shahla Hosseini Bai. 2020. "Relationships between Nut Size, Kernel Quality, Nutritional Composition and Levels of Outcrossing in Three Macadamia Cultivars" Plants 9, no. 2: 228. https://doi.org/10.3390/plants9020228
APA StyleRichards, T. E., Kämper, W., Trueman, S. J., Wallace, H. M., Ogbourne, S. M., Brooks, P. R., Nichols, J., & Hosseini Bai, S. (2020). Relationships between Nut Size, Kernel Quality, Nutritional Composition and Levels of Outcrossing in Three Macadamia Cultivars. Plants, 9(2), 228. https://doi.org/10.3390/plants9020228

