How Do Novel M-Rootstock (Vitis Spp.) Genotypes Cope with Drought?
Abstract
1. Introduction
2. Results
2.1. The Physiological Response of Grapevine Rootstocks to Drought
2.2. The Transcriptional Response of Grapevine Rootstocks to Drought
3. Discussion
3.1. Water-Limiting Conditions for Grapevine Rootstocks
3.2. The Effect of Water Stress on Grapevine Rootstock Genotypes
3.3. Delineation of Group Strategies to Face Drought
4. Material and Methods
4.1. Plant Material and Growth Conditions
4.2. Irrigation Management and Treatments
4.3. Plant Phenotyping
4.4. Gene Expression Analysis
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding plant responses to drought—From genes to the whole plant. Funct. Plant Biol. 2003, 30, 239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pellegrino, A.; Lebon, E.; Simonneau, T.; Wery, J. Towards a simple indicator of water stress in grapevine (Vitis vinifera L.) based on the differential sensitivities. Aust. J. Grape Wine Res. 2005, 11, 306–315. [Google Scholar] [CrossRef] [Scilit]
- Jackson, D.I.; Lombard, P.B. Environmental and Management Practices Affecting Grape Composition and Wine Quality—A Review. Am. J. Enol. Vitic. 1993, 44, 409–430. [Google Scholar]
- Gale, G. Saving the vine from Phylloxera: A never-ending battle. In Wine: A Scientifc Exploration; Sandler, M., Pindler, R., Eds.; Taylor and Francis: London, UK, 2002; pp. 70–91. ISBN 9780203361382. [Google Scholar]
- Bianchi, D.; Grossi, D.; Tincani, D.T.G.; Simone Di Lorenzo, G.; Brancadoro, L.; Rustioni, L. Multi-parameter characterization of water stress tolerance in Vitis hybrids for new rootstock selection. Plant Physiol. Biochem. 2018, 132, 333–340. [Google Scholar] [CrossRef] [Scilit]
- Bianchi, D.; Grossi, D.; Simone Di Lorenzo, G.; Zi Ying, Y.; Rustioni, L.; Brancadoro, L. Phenotyping of the “G series” Vitis hybrids: First screening of the mineral composition. Sci. Hortic. 2020, 264. [Google Scholar] [CrossRef] [Scilit]
- Cochetel, N.; Escudié, F.; Cookson, S.J.; Dai, Z.; Vivin, P.; Bert, P.; Muñoz, M.S.; Delrot, S.; Klopp, C.; Ollat, N.; et al. Root transcriptomic responses of grafted grapevines to heterogeneous nitrogen availability depend on rootstock genotype. J. Exp. Bot. 2017, 68, 4339–4355. [Google Scholar] [CrossRef] [Scilit]
- Vannozzi, A.; Donnini, S.; Vigani, G.; Corso, M.; Valle, G.; Vitulo, N.; Bonghi, C.; Zocchi, G.; Lucchin, M. Transcriptional Characterization of a Widely-Used Grapevine Rootstock Genotype under Different Iron-Limited Conditions. Front. Plant Sci. 2017, 7, 1–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ollat, N.; Peccoux, A.; Papura, D.; Esmenjaud, D.; Marguerit, E.; Tandonnet, J.P.; Bordenave, L.; Cookson, S.J.; Barrieu, F.; Rossdeutsch, L.; et al. Rootstocks as a Component of Adaptation to Environment; Wiley: Hoboken, NJ, USA, 2016; ISBN 9781118735985. [Google Scholar]
- IPCC. Global warming of 1.5 °C. In Summary for Policymarkerskers; World Meteorological Organization: Geneva, Switzerland, 2018; pp. 1–26. ISBN 9789291691517. [Google Scholar]
- Giorgi, F.; Lionello, P. Climate change projections for the Mediterranean region. Glob. Planet. Chang. 2008, 63, 90–104. [Google Scholar] [CrossRef] [Scilit]
- IPCC. Climate Change 2013: The Physical Science Basis—Summary for Policymakers; Cambridge University Press: Cambridge, UK, 2013. [Google Scholar]
- Schultz, H.R. Climate change and viticulture: A European perspective on climatology, carbon dioxide and UV-B effects. Aust. J. Grape Wine Res. 2000, 6, 2–12. [Google Scholar] [CrossRef] [Scilit]
- Taiz, L.; Zeiger, E. Plant physiology. 3rd edn. Ann. Bot. 2003, 91, 750–751. [Google Scholar] [CrossRef] [Scilit]
- Shao, H.B.; Chu, L.Y.; Shao, M.A.; Abdul Jaleel, C.; Hong-Mei, M. Higher plant antioxidants and redox signaling under environmental stresses. Comp. Rend. Biol. 2008, 331, 433–441. [Google Scholar] [CrossRef] [Scilit]
- Steudle, E. Water uptake by roots: Effects of water deficit. J. Exp. Bot. 2000, 51, 1531–1542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tombesi, S.; Nardini, A.; Frioni, T.; Soccolini, M.; Zadra, C.; Farinelli, D.; Poni, S.; Palliotti, A. Stomatal closure is induced by hydraulic signals and maintained by ABA in drought-stressed grapevine. Sci. Rep. 2015, 5, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Schachtman, D.P.; Goodger, J.Q.D. Chemical root to shoot signaling under drought. Trends Plant Sci. 2008, 13, 281–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, H.; Sutherland, R. Stomatal control of xylem embolism. Plant Cell Environ. 1991, 14, 607–612. [Google Scholar] [CrossRef] [Scilit]
- Hochberg, U.; Herrera, J.C.; Cochard, H.; Badel, E. Short-time xylem relaxation results in reliable quantification of embolism in grapevine petioles and sheds new light on their hydraulic strategy. Tree Physiol. 2016, 36, 748–755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Medrano, H.; Tomás, M.; Martorell, S.; Flexas, J.; Hernández, E.; Rosselló, J.; Pou, A.; Escalona, J.M.; Bota, J. From leaf to whole-plant water use efficiency (WUE) in complex canopies: Limitations of leaf WUE as a selection target. Crop J. 2015, 3, 220–228. [Google Scholar] [CrossRef] [Scilit]
- Farquhar, G.D.; Sharkey, T.D. Stomatal conductance and photosynthesis. Ann. Rev. Plant Biol. 1982, 61, 561–591. [Google Scholar] [CrossRef] [Scilit]
- Lovisolo, C.; Lavoie-lamoureux, A.; Tramontini, S.; Ferrandino, A. Grapevine adaptations to water stress: New perspectives about soil/plant interactions. Theor. Exp. Plant Physiol. 2016, 28, 53–66. [Google Scholar] [CrossRef] [Scilit]
- De Smet, I.; Zhang, H. Abscisic acid in root growth and development. In Plant Roots: The Hidden Half; Eshel, A., Beeckman, T., Eds.; CRC Press: Baton Rouge, FL, USA, 2013; pp. 16.1–16.13. [Google Scholar]
- Audran, C.; Borel, C.; Frey, A.; Sotta, B.; Meyer, C.; Simonneau, T.; Marion-Poll, A. Expression studies of the zeaxanthin epoxidase gene in Nicotiana plumbaginifolia. Plant Physiol. 1998, 118, 1021–1028. [Google Scholar] [CrossRef] [Scilit]
- Ikegami, K.; Okamoto, M.; Seo, M.; Koshiba, T. Activation of abscisic acid biosynthesis in the leaves of Arabidopsis thaliana in response to water deficit. J. Plant Res. 2009, 122, 235–243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manzi, M.; Lado, J.; Rodrigo, M.J.; Zacariás, L.; Arbona, V.; Gómez-Cadenas, A. Root ABA Accumulation in Long-Term Water-Stressed Plants is Sustained by Hormone Transport from Aerial Organs. Plant Cell Physiol. 2015, 56, 2457–2466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manzi, M.; Lado, J.; Rodrigo, M.J.; Arbona, V.; Gómez-Cadenas, A. ABA accumulation in water-stressed Citrus roots does not rely on carotenoid content in this organ. Plant Sci. 2016, 252, 151–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McAdam, S.A.M.; Brodribb, T.J.; Ross, J.J. Shoot-derived abscisic acid promotes root growth. Plant Cell Environ. 2016, 39, 652–659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, H.; Gao, Z.; Chen, L.; Wei, K.; Liu, J.; Fan, Y.; Davies, W.J.; Jia, W.; Zhang, J. Dynamic analysis of ABA accumulation in relation to the rate of ABA catabolism in maize tissues under water deficit. J. Exp. Bot. 2007, 58, 211–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rock, C.D.; Heath, T.G.; Gage, D.A.; Zeevaart, J.A. Abscisic alcohol is an intermediate in abscisic Acid biosynthesis in a shunt pathway from abscisic aldehyde. Plant Physiol. 1991, 97, 670–676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, X.; Zeevaart, J.A. The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water-stressed bean. Proc. Natl. Acad. Sci. USA 1999, 96, 15354–15361. [Google Scholar] [CrossRef] [Scilit]
- Speirs, J.; Binney, A.; Collins, M.; Edwards, E.; Loveys, B. Expression of ABA synthesis and metabolism genes under different irrigation strategies and atmospheric VPDs is associated with stomatal conductance in grapevine (Vitis vinifera L. cv Cabernet Sauvignon). J. Exp. Bot. 2013, 64, 1907–1916. [Google Scholar] [CrossRef] [Scilit]
- Rossdeutsch, L.; Edwards, E.; Cookson, S.J.; Barrieu, F.; Gambetta, G.A.; Delrot, S.; Ollat, N. ABA-mediated responses to water deficit separate grapevine genotypes by their genetic background. BMC Plant Biol. 2016, 16, 91. [Google Scholar] [CrossRef] [Scilit]
- Iuchi, S.; Kobayashi, M.; Taji, T.; Naramoto, M.; Seki, M.; Kato, T. Regulation of drought tolerance by gene manipulation of 9- cis -epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J. 2001, 27, 325–333. [Google Scholar] [CrossRef] [Scilit]
- Santiago, J.; Rodrigues, A.; Saez, A.; Rubio, S.; Antoni, R.; Dupeux, F.; Park, S.; Marquez, J.; Cutler, S.; Rodriguez, P. Modulation of drought resistance by the abscisic acid receptor PYL5 through inhibition of clade A PP2Cs. Plant J. 2009, 60, 575–588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshida, R.; Hobo, T.; Ichimura, K.; Mizoguchi, T.; Takahashi, F.; Aronso, J.; Ecker, J.R.; Shinozaki, K. ABA-Activated SnRK2 Protein Kinase is Required for Dehydration Stress Signaling in Arabidopsis. Plant Cell Physiol. 2002, 43, 1473–1483. [Google Scholar] [CrossRef] [Scilit]
- Raghavendra, A.S.; Gonugunta, V.K.; Christmann, A.; Grill, E. ABA perception and signalling. Trends Plant Sci. 2010, 15, 395–401. [Google Scholar] [CrossRef] [Scilit]
- Soar, C.J.; Speirs, J.; Maffei, S.M.; Penrose, A.B.; Mc Carthy, M.G. Grape vine varieties Shiraz and Grenache differ in their stomatal response to VPD: Apparent links with ABA physiology and gene expression in leaf tissue. Aust. J. Grape Wine Res. 2006, 12, 2–12. [Google Scholar] [CrossRef] [Scilit]
- Boneh, U.; Biton, I.; Zheng, C.; Schwartz, A.; Ben-Ari, G. Characterization of potential ABA receptors in Vitis vinifera. Plant Cell Rep. 2012, 31, 311–321. [Google Scholar] [CrossRef] [Scilit]
- Haider, M.S.; Zhang, C.; Kurjogi, M.M.; Pervaiz, T.; Zheng, T.; Zhang, C.; Lide, C.; Shangguan, L.; Fang, J. Insights into grapevine defense response against drought as revealed by biochemical, physiological and RNA-Seq analysis. Sci. Rep. 2017, 7, 13134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vivier, M.A.; Pretorius, I.S. Genetically tailored grapevines for the wine industry. Trends Biotechnol. 2002, 20, 472–478. [Google Scholar] [CrossRef] [Scilit]
- Migliaro, D.; De Lorenzis, G.; Di Lorenzo, G.S.; Nardi, B.D.; Gardiman, M.; Failla, O.; Brancadoro, L.; Crespan, M. Grapevine non-vinifera genetic diversity assessed by simple sequence repeat markers as a starting point for new rootstock breeding programs. Am. J. Enol. Vitic. 2019, 70, 390–397. [Google Scholar] [CrossRef] [Scilit]
- Bianchi, D.; Brancadoro, L.; De Lorenzis, G. Genetic Diversity and Population Structure in a Vitis spp. Core Collection Investigated by SNP Markers. Diversity 2020, 12, 103. [Google Scholar] [CrossRef] [Scilit]
- Keller, M. The Science of Grapevines. Anatomy and Physiology; Elsevier: Amsterdam, The Netherlands, 2015; ISBN 9780124199873. [Google Scholar]
- Porro, D.; Pedò, S.; Bertoldi, D.; Bortolotti, L.; Failla, O.; Zamboni, M. Evaluation of New Rootstocks for Grapevine: Nutritional Aspects. Acta Hortic. 2013, 984, 109–115. [Google Scholar] [CrossRef] [Scilit]
- Cifre, J.; Bota, J.; Escalona, J.M.; Medrano, H.; Flexas, J. Physiological tools for irrigation scheduling in grapevine (Vitis vinifera L.) An open gate to improve water-use efficiency? Agric. Ecosyst. Environ. 2005, 106, 159–170. [Google Scholar] [CrossRef] [Scilit]
- Schubert, A.; Restagno, M.; Lovisolo, C. Photosynthesis of grapevine leaves of different age at high and low light intensity. Strateg. Optim. Wine Grape Qual. 1996. [Google Scholar] [CrossRef] [Scilit]
- Dal Santo, S.; Zenoni, S.; Sandri, M.; De Lorenzis, G.; Magris, G.; De Paoli, E.; Di Gaspero, G.; Del Fabbro, C.; Morgante, M.; Brancadoro, L.; et al. Grapevine field experiments reveal the contribution of genotype, the influence of environment and the effect of their interaction (G × E) on the berry transcriptome. Plant J. 2018, 93, 1143–1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pinto, D.L.P.; Brancadoro, L.; Dal Santo, S.; De Lorenzis, G.; Pezzotti, M.; Meyers, B.C.; Pè, M.E.; Mica, E. The influence of genotype and environment on small RNA profiles in grapevine berry. Front. Plant Sci. 2016, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serra, I.; Strever, A.; Myburgh, P.A.; Deloire, A. Review: The interaction between rootstocks and cultivars (Vitis vinifera L.) to enhance drought tolerance in grapevine. Aust. J. Grape Wine Res. 2014, 20, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Carbonneau, A. The Early Selection of Grapevine Rootstocks for Resistance to Drought Conditions. Am. J. Enol. Vitic. 1985, 36, 195–198. [Google Scholar]
- Padgett-Johnson, M.; Williams, L.E.; Walker, M.A. Vine water relations, gas exchange, and vegetative growth of seventeen Vitis species grown under irrigated and nonirrigated conditions in California. J. Am. Soc. Hortic. Sci. 2003, 128, 269–276. [Google Scholar] [CrossRef] [Scilit]
- Meggio, F.; Prinsi, B.; Negri, A.S.; Simone Di Lorenzo, G.; Lucchini, G.; Pitacco, A.; Failla, O.; Scienza, A.; Cocucci, M.; Espen, L. Biochemical and physiological responses of two grapevine rootstock genotypes to drought and salt treatments. Aust. J. Grape Wine Res. 2014, 20, 310–323. [Google Scholar] [CrossRef] [Scilit]
- Corso, M.; Vannozzi, A.; Maza, E.; Vitulo, N.; Meggio, F.; Pitacco, A.; Telatin, A.; D’Angelo, M.; Feltrin, E.; Negri, A.S.; et al. Comprehensive transcript profiling of two grapevine rootstock genotypes contrasting in drought susceptibility links the phenylpropanoid pathway to enhanced tolerance. J. Exp. Bot. 2015, 66, 5739–5752. [Google Scholar] [CrossRef] [Scilit]
- Frioni, T.; Biagioni, A.; Squeri, C.; Tombesi, S.; Gatti, M.; Poni, S. Grafting cv. grechetto gentile vines to new m4 rootstock improves leaf gas exchange and water status as compared to commercial 1103p rootstock. Agronomy 2020, 10, 708. [Google Scholar] [CrossRef] [Scilit]
- Galbignani, M.; Merli, M.; Magnanini, E.; Bernizzoni, F.; Talaverano, I.; Gatti, M.; Tombesi, S.; Palliotti, A.; Poni, S. Gas exchange and water—Use efficiency of cv. Sangiovese grafted to rootstocks of varying water—Deficit tolerance. Irrig. Sci. 2016, 34, 105–116. [Google Scholar] [CrossRef] [Scilit]
- Chan, Z. Expression profiling of ABA pathway transcripts indicates crosstalk between abiotic and biotic stress responses in Arabidopsis. Genomics 2012, 100, 110–115. [Google Scholar] [CrossRef] [Scilit]
- Rattanakon, S.; Ghan, R.; Gambetta, G.A.; Deluc, L.G.; Schlauch, K.A.; Cramer, G.R. Abscisic acid transcriptomic signaling varies with grapevine organ. BMC Plant Biol. 2016, 16, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ollat, N.; Cookson, S.J.; Destrac-Irvine, A.; Lauvergeat, V.; Ouaked-Lecourieux, F.; Marguerit, E.; Barrieu, F.; Dai, Z.; Duchêne, E.; Gambetta, G.A.; et al. Grapevine adaptation to abiotic stress: An overview. Acta Hortic. 2019, 1248, 497–512. [Google Scholar] [CrossRef] [Scilit]
- Delzon, S. New insight into leaf drought tolerance. Funct. Ecol. 2015, 29, 1247–1249. [Google Scholar] [CrossRef] [Scilit]
- Lovisolo, C.; Schubert, A. Effects of water stress on vessel size and xylem hydraulic conductivity in Vitis vinifera L. J. Exp. Bot. 2018, 49, 693–700. [Google Scholar]
- Tyree, M.T.; Ewers, F.W. The hydraulic architecture of trees and other woody plants. New Phytol. 1991, 119, 345–360. [Google Scholar] [CrossRef] [Scilit]
- Gardner, C.M.K.; Robinson, D.; Blyth, K.; Cooper, J.D. Soil Water Content. In Soil and Environmental Analysis: Physical Methods; Smith, K.A., Mullins, C.E., Eds.; Marcel Dekker Inc.: New York, NY, USA, 2001; pp. 13–20. [Google Scholar]
- Scholander, P.F.; Bradstreet, E.D.; Hemmingsen, E.A.; Hammel, H.T. Sap Pressure in Vascular Plants: Negative hydrostatic pressure can be measured in plants. Science 1965, 148, 339–346. [Google Scholar] [CrossRef] [Scilit]
- De Lorenzis, G.; Rustioni, L.; Parisi, S.G.; Zoli, F.; Brancadoro, L. Anthocyanin biosynthesis during berry development in corvina grape. Sci. Hortic. 2016, 212, 74–80. [Google Scholar] [CrossRef] [Scilit]
- Fujita, A.; Soma, N.; Goto-yamamoto, N.; Mizuno, A.; Kiso, K.; Hashizume, K. Effect of Shading on Proanthocyanidin Biosynthesis in the Grape Berry. J. Jpn. Soc. Hortic. Sci. 2007, 76, 112–119. [Google Scholar] [CrossRef] [Scilit]
- Reid, K.E.; Olsson, N.; Schlosser, J.; Peng, F.; Lund, S.T. An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development. BMC Plant Biol. 2006, 6, 27. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Hayes, M.A.; Feechan, A.; Dry, I.B. Involvement of Abscisic Acid in the Coordinated Regulation of a Stress-Inducible Hexose Transporter (VvHT5) and a Cell Wall Invertase in Grapevine in Response to Biotrophic Fungal Infection. Plant Physiol. 2010, 153, 211–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lund, S.T.; Peng, F.Y.; Nayar, T.; Reid, K.E.; Schlosser, J. Gene expression analyses in individual grape (Vitis vinifera L.) berries during ripening initiation reveal that pigmentation intensity is a valid indicator of developmental staging within the cluster. Plant Mol. Biol. 2008, 68, 301–315. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Rootstock | Pedigree |
|---|---|
| 1103P | V. berlandieri cv. Resseguier nr. 2 × V. rupestris cv. Du Lot |
| 110R | V. berlandieri cv. Boutin × V. rupestris cv. Du Lot |
| 140Ru | V. berlandieri cv. Boutin × V. rupestris cv. Du Lot |
| 161-49C | V. berlandieri × V. riparia |
| 41B | V. vinifera cv. Chasselas × V. berlandieri cv. Planchon |
| 420A | V. berlandieri × V. riparia |
| K5BB | V. berlandieri Resseguier nr. 2 × V. riparia cv. Gloire de Montpellier |
| M1 | Kober 5BB × Teleki 5C (V. berlandieri cv. Planchon × V. riparia) |
| M3 | Kober 5BB × Teleki 5C |
| M4 | unknown × 1103 P |
| Schwarzmann | V. riparia × V. rupestris |
| SO4 | V. berlandieri cv. Resseguier nr. 2 × V. riparia cv. Gloire de Montpellier |
| Parameter | Group A | Group B | Group C | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Pn | 2.93 | ± | 0.66 | a | 1.47 | ± | 1.15 | b | 3.68 | ± | 1.62 | a |
| Gs | 35.80 | ± | 13.40 | a | 28.26 | ± | 16.16 | a | 67.25 | ± | 36.23 | b |
| E | 0.77 | ± | 0.26 | a | 0.66 | ± | 0.36 | a | 1.38 | ± | 0.67 | b |
| ΨS | −0.76 | ± | 0.13 | a | −0.59 | ± | 0.14 | b | −0.66 | ± | 0.14 | ab |
| Genes | Primer Sequence (5′ → 3′) | Reference | Tissue |
|---|---|---|---|
| VvZEP | F: GGTAAGAAGGAAAGGTTGC R: CAATAGGAGTCCCTGATTTGATGC | Hayes et al. [70] | roots |
| VvNCED1 | F: TGCAGAGGACGAGAGTGTAA R: AGCTACACCAAAAGCTACGA | Hayes et al. [70] | |
| VvNCED2 | F: ATGCTCAAACCGCCTCTGAT R: TCCCAAGCATTCCAGAGGTG | Lund et al. [71] | |
| VvPP2C4 | F: TGGGCTTTGGGATGTTATGT R: TGTGCAGGAGTCTCATCAGC | Boneh et al. [40] | leaves |
| VvSnRK2.6 | F: CACCAACCCACCTTGCTATT R: AAACGTGCCTCATCCTCACT | Boneh et al. [40] | |
| VvABF2 | F: GGCACCCAGGCTAGTTAA R: GCAGAGTACACGCTAGATTG | Rossdeutsch et al. [34] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bianchi, D.; Caramanico, L.; Grossi, D.; Brancadoro, L.; Lorenzis, G.D. How Do Novel M-Rootstock (Vitis Spp.) Genotypes Cope with Drought? Plants 2020, 9, 1385. https://doi.org/10.3390/plants9101385
Bianchi D, Caramanico L, Grossi D, Brancadoro L, Lorenzis GD. How Do Novel M-Rootstock (Vitis Spp.) Genotypes Cope with Drought? Plants. 2020; 9(10):1385. https://doi.org/10.3390/plants9101385
Chicago/Turabian StyleBianchi, Davide, Leila Caramanico, Daniele Grossi, Lucio Brancadoro, and Gabriella De Lorenzis. 2020. "How Do Novel M-Rootstock (Vitis Spp.) Genotypes Cope with Drought?" Plants 9, no. 10: 1385. https://doi.org/10.3390/plants9101385
APA StyleBianchi, D., Caramanico, L., Grossi, D., Brancadoro, L., & Lorenzis, G. D. (2020). How Do Novel M-Rootstock (Vitis Spp.) Genotypes Cope with Drought? Plants, 9(10), 1385. https://doi.org/10.3390/plants9101385
